99 15 4132 https://omeka.wilkes.edu/omeka/files/original/9de94f511961609563259a9e807f8335.pdf 01a62f224419be885242aa7b8d54defa PDF Text Text .Plans To Raze Buildings D,e layed HOMECOMING NOMI-NEES-Front row from left: Sandra Tomko, Marla Brodsky, Mary Giblin, Janet Vierbuchen, Geri McAfee. Back row from- left : Diane Seech, Margaret Scholl, Peggy Mascelli, Gayle Lovering, Colleen Gries, Carol Benek. Homecomi~g------------------~------------ Queen Nominees Chosen Elections for the 1980 Homecom- .York. She has been a member of ing Queen will be today from 10 Student Government her freshman a.m. until 6:30 p,m. in the Student and senior years as well as class .Center and from 4:30 p.m. until 6:30 secretary her sophomore year. As a p.m. in the Pickering flail lobby . -senior Carol is the assistant direcThe entire student body may vote tor of 'the Student Center. She has one nominee as queen and two also been named to the Dean's List. nominees for runners-up. Students The daughter of Mr. and Mrs. musthave their ID cards in order to Frank Benek, Carol plans to attend a graduate or professional school. vote. · Marla Brodsky, majoring in Al Wirkman, Homecoming ChairPsychology, has been active in Stuman, &lated that there are 11 dent Government for four years. As nominees this year instead of the vice-president of SG her junior and customary 10 because two girls were tied for the tenth position. The senior years, Marla has also been co-chairman of Arts and Crafts nominees are Carol Benek, Marla pay, Winter Weekend, and Social Brodsky, Mary Giblin, Colleen Committee. She has been involved Gries, Gayle Lovering, • Peggy with freshman orientation for three Mascelli, Geri McAfee, Margaret years as well as co-editor of the Scholl, Diane Seech, Sandy Tomko, New Student Record her junior and Janet Vierbuchen. year. The daughter of Mel and Carol Benek. maJormg in Sylvia Brodsky, Marla hails from Biology, is from Johnsop City. New Old Bethpage, New York. After Wilkes, she plans to receive her Masters Degree in Student Affairs and wants to be a dean of a college. Majoring in Nursing/Psychology, Mary Giblin is from Pajermo, New Jersey. For the past three years, Mary has been involved with the Homecoming Committee as well as the Publication Committee. She has also been editor of the Amnicola for two years, serving as co-editor this year. As a senior, Mary is active with Big Brothers and Big Sisters along with being a resident assistant. Mary is the daughter of Owen and Mary Giblin. Colleen Gries, majoring in Accounting, has been the Debate Union President for four years. As a current member of Theta De1ta Rho, Colleen was president of her • junior class. This year, she is chairman of Commerce and Finance StuContinued on pal!e 2. White's resolution stated that the college is planning to expand the campus through the construction of a new dormitory, and that the college and the historical society have reached an agreement that would allow the college to freely remove the three existing buildings to make way for construction. The resolution asked that the college be commended for its expansion efforts. When the resolution was read at the meeting, however, ~ DiPietro pointed out that he was contacted by the chairman of the historical society and that he was informed that no such a·greement exists between the college and the historical society.(See related story this page.) There was some question as to whether the council had any l~gal authority in the situation and coun-cil voted to table the resolution and refer it to the city attorney . After the -meeting DiPietro told the Beacon that he did not like the story printed in the TimM Leader and he noted that he resented the · headline and claimed it was not 1 true. He noted that he hopes that the college and the historical society are able to solve the problem. AccordingJ o a tape provided by WCLH, DiPietro was asked why he voted to table he resolution and he responded, "The reason that I voted to table the resolution, and I'm glad that council went along with it, is that I think that this is an issue that deals with certain information that council is not direct' ly involved in. " I think that Wilkes and the Office of Historic Preservaion and those appropriate people from the Historical and Geological Society are attempting to work this issue · our and I think that we should Jet them work it out." has had a long-time commitment to DiPietro went on to say : "Cerpreserving the late 19th and 20th 1 tainly council, myself, are very proCentury architecture of the campus ud to have Wilkes College in our and desires " to construct new community. It's a fine academic inbuildings that are arichitecturally in stitution. We recognize the con·harmony with those already pre- tribution to our community Wilkes sent." -makes. This resolution did not adThe review board has determined dress itself to that particular point. that none of the buildings in ques- I think what it asks us to do was to tion are "outstanding examples of take note of some agreements and fifteen different categories of ar- discussions held between people chitectural design existing in the who are not part of city council, and River Street Historic District." council was reluctant to do that. I Also, West Northampton Street is a don't think this is appropriate for secondary street and "its continui- council to pass on the kind of issue . ty is broken on the ends by that the resolution addressed and buildings fronting on River Street that's why-we tabled it. We tabled it and on South Franklin Street." . and referred it to our solicitor, who It points out that the college has , incidentally gave us the opinion recently Spent $460,000 to restore that it isn't appropriate for council the building housing the Con- to deal with and what's so basic I yngham Student Center. The pro- t~ink is that council wants the parposed building is designed in a man- ties to resolve this issue themselves ner that would make it compatible and to address it." with the student center building and He also comented,"The point is other buildings in the area. In addiContinued on page 2. Continued on page 8 The Beacon reported last week that plans to raze three buildings tQ make way for a proposed residence hall have run into a snag. The problem concerns a possible historic design~tion for the buildings in question : Butler, Shawnee and Susquehannock Halls. The college ~as been discussing the problem with the Historical Society in an attempt to work something out. The issues has also been brought up at City Hall. At last . Tuesday's City Council work session, Councilman Edward White announced that fie would present a resolu~ion at the regular council meeting on Thursday commending Wilkes for its expansion effort. According to an article published in the Times Leader last Wednesday under the headline " DiPietro Says Wilkes College 'Using' Council," Councilman DiPietro voiced· his opposition to the resolution and involvement in the matter in · general.' The article states in past as follows: "If White's resolution is passed, DiPietro said,'We would be telling the federal govenment that the people who did the historic preservation study were wrong. I dorft want city council to be strapped between Wilkes College and the historical society.' DiPietro claimed White has a vested interest in Wilkes College and that he met recently with Andrew Shaw concering the resolution." At city council's meeting on Thursday, Councilman White stated that ne never met with Shaw concerning the resolution. ·Three College B u i l d i n g s - - - - - - - - - - : - - - - - - - - - CofYlmittee Evaluates·Historical Impact An Ad Hoc Committee, has been the historic district open to quesset up between members of the col - tion. Also, the memorandum · states; lege and the Wyoming Historical and Geological Society to evaluate " both parties to this agreement are the historic significance of anxious to clarify the status of these ' buildings located at 76 and 78 West buildings in terms of the objectives Northampton Street and 110 South of the Historic Sites Survey and the developmental plans of Wilkes ColRiver Street. According to a memorandum of lege." The memorandum refers to the agreement between the college and the Executive Director of the committee as a three member historical society, a Historic Sites group mutually acceptabie to both Survey was issued by -the.Wyoming side. The committee is chaired by Historical and·· Geological Society, H. Benjamin Powell of the Departdated October 5, 1979, proposing the ment of History at Bloomsburg establishment of a River Street State College. The other members Historic District which would in- of the committee are Ralph L. Retired Executive clude the entire Wilkes College Hazeltine, Director of the Wyoming Historical campus, among other properties. The Memorandum stales that the and Geological Society, and college has proposed the expansion William L. Conyngham, Vice Presi- . of its residence hall facilities which dent of the Wyoming Historical and would necessitate the removal of Geological Society, and a member three buildings within this historic of the Board of Trustees of Wilkes · district, and the Historic Sites College. According to the agreement, the Survey leaves the historic significance of all the buildings in com_mittee is requested to submit a written report to the representatives of both parties, and the conclusions drawn by the committee will be considered by both parties. The agreement was signed by Dr. Andrew Shaw, Dean of Management and the Executive Director of the Historical Society. The report filed by the committee notes that the buildings in question are: 110 South River Street, also known as Butler Hall, 76 West Northampton Street, also known as _Shawnee Hall, and 78 West Northampton Street, also known as · Susquehannock Hall. The report also points out that on page four of the Historic Sites Survey it is stated that " nofall properties inventoried are worthy of protracted preservation fight. ... '' and recommends on page 55 that " a periodic evaluation of buildings and areas not listed in this report should be made, particularly as new information and facts are brought to _light." It also notes that the college �Pa e 2, The Beacon October 2, 1980 Homecoming Nominees Want To• e p T e Community? ✓ Give Blood In The Gym Oct. 91 Continued from page I . dent Advisory Board, co-captain of she will become Editor-in-Chief ot the majorettes, and is a member of the Beacon. Margaret is a member Commuter Council. Colleen has Are you interested in helping on Thursday and sign in. A drop o of Theta Delta Rho and was on the local chapter of the American Red been named to the Dean's List and other people here at the college or blood will be taken from the ear to freshman orientation staff for two Cross. Anyone can donate between also won numerous debate and in the community? Would you be test for iron content. Temperature years. Majoring in Business Adthe hours of 10 a.m. and 3:45 p.m. public speaking awards including willing to give a few hours a week to and blood pressure will be taken, ministration, Margaret is from EdThere are 2300 potential donors national honors. As the daughter of sponsor a party for underprivileged and then the donator will be led to a wardsville, Pennsylvania. Followamong the facu!ty, administration, children or tutor a junior high stutable to lie down where a licensed, Mr. and Mrs. Joseph Gries, Colleen ing graduation she plans to work in and students · of Wilkes. The dent in history? These are just a public relations. average donation last year was 150 · registered nurse will draw the is from Dallas, Pennsylvania. She few of the activities which the 1>ints, which was a low percentage. blood. Afterwards, HSC will pro- . plans to attend Graduate School Diane Seech, from Columbia, Human Services Committee of vide cookies,. sandwiches and juice and receive her · masters in Maryland, is the daughter of AnIn order to stir up more interest, Wilkes College sponsors. The comfor those who feel a little weak or Business Administration and Comdrew and Anna Seech. Diane has Debbie Prater said HSC is conmunications. mittee is actively led by two hungry. served as co-chairman of Student ducting an active publicity camGayle Lovering, the daughter of presidents, Debbie Prater and See! It doesn't sound so awful, Government Social Committees her paign. The HSC members are Debbie Mazzanti. They are assisted sophomore and junior years. She is recruiting potential donors at dorm - does it? So remember, ·bring your Francis and Dolores Lovering, is by Vice-President Fran·Scarantino, roomate or friend over to the gym from Budd Lake, New Jersey. She also a member of the Human -Sermeetings, and Dean Ralston has secretaries Chris Lain ·and Carol .been asked to encourage the faculty on Thursday. There is a definite has been involved with the Am- -.....vices Committee and tl)e EmergenDiscabage, and treasurer Gary shortage of blood in the United nicola, NSO, and Intramural and cy Alert Team. Majoring in and administration to donate pints Nothestien. Approximately forty States and every pint counts. The Social Committees. Gayle, a resiof blood. The club is also using local Biology, Diane plans to attend a members meet on Tuesdays ·at 12 Human Services Committee is of- dent assistant is also a member of radio stations and newspapers to graduate or medical school follownoon to discuss such activities as fering a little incentive for potential the field hockey team. Majoring in ing graduation. help them advertise their goal of The March of Dimes Walk-a-thon . donors. They will give $25.00 to the Nursing, Gayle plans to work for a Sandy Tomko, majoring in Nurs400 pints for Thursday, October 9. and The Crop Walk (a walk for dorm with the highest percentage year following -graduation and then ing, has been -involved in the " Donating blood only takes up of donors and the club with the attend a specialization school. _ World Hunger) . "' Human Services Committee, NSO, one half hour to 45 minutes of y<>ur Active on the tennis team for four Their "main events" this year highest percentage receives a and IRHC. As a resident assistant, time and is not painful," assures are going to be the blood drives. On trophy! I am looking forward to years, Peggy Mascelli is co-captain Sandy has been a dorm represenPrater. She also recommends seeing a lot of people walking this year. As a member of the LetThursday, October 9 in the Wilkes tafive as well as a member of the eating a substantial meal before College Gym,·the Human Services around campus with red cross pins terwoman's Club and Accounting freshman orientation staff. She is donating blood. Any student, prostuck on their lapels. That is their and Business Club, Peggy is also a Committee will sponsor their first the daughter of Mr. and Mrs. Frank fessor, administrator or member of resident assistant. She has been way of saying, "I care." blood drive in affiliation with the the community can enter the gym Tomko and her hometown is ConRoya Fahmy named to the Dean's List and the yngham, Pennsylvania. Judicial Council. The daughter of Also a Nursing major, Janet VierPeter J . Mascelli, Sr., Peggy is buchen is currently serving as Razing Delayed from Plains, Pennsylvania. Peggy, president of the Nursing Student majoring •in Accounting, plans to Organization. Now in her senior ontinued from page I . work for a public accounting firm year, Janet is I involved in Inthat there is a historic site survei and eventually plans to receive her tramural tennis and is a resident th.a t's a public document. It's been CPA. Two fund requests were made at treasurer, Sue Palmer, and SG assistant. The daughter of Mr. and presented to•the government, and Geri McAfee has been a four-year Student Government's meeting. representatives Tom Farley and Mrs. William Vierbuchen. J anet One came from the Women's Ac- Lisa Warden. The nominees for • to change that document, or to alter ·participant of the field hockey hails from Bridgewater, New it, or make implications about it team. Geri is also a current tivities Association represented by Homecoming Queen were also anJersey. Following graduation, must come from other p::ople, and membel'..of the Letterwoman's Club Colleen Gries. The other was a loan nounced. (See page 1 for related Janet plans to work with hospitaliznot from city government, and and NSO. She is a resident assistant request by Rob Doty representing story and photo.) It was also noted ed cancer patients. that's my point. '' and was a dorm representative. Slocum Hall. Doug Fahringer that the turnout was very poor at Councilman White was asked Geri is majoring in Nursing and is Colleen .Gries requested $895 for recent elections. what his purpose was in bringing up from Norristown, Pennsylvania. the WAA to rent buses in order to Nominations for freshmen ofthe resolution. He responded that She is the daughter of Mrs. James attend the remaining away fottball ficers rand representatives will be his purpose was "to save taxpayers McAfee. ' ' games. In. order that the matter be held on Thursday. Students are a lot of money not to have to send Secretary of the senior class, voted on before this weekend's reminded that under the new camtheir children out of the territory to Margaret Scholl, is the daughter of game, President Joe Galli closed paign regulations, only college ID go to school. " He noted that the colMrs. William Scholl and the late and reopened the meeting to allow a cai:<fs will be accepted for votipg. lege does a fine job with its William Scholl. Margaret was vote on the request. The motion · Bulletin boards have been Folk Rock students, " and I want to help." Feature Editor of the Beacon her passed 19-0-0. Colleen Gries added ordered for the side entrance of the Guitarists & Vocalists Louis Czachor junior year and is currently serving that there are usually several emp- Student Center, each floor of the as Managing Editor. Next spring, ty seats on the buses. Interested Hotel Sterling and Mirier Hall. AP: students should contact her atJ east prov al of Charles Abate, the college one week before the game to make business manager is pending. arrangements. Al Wirkman,chairman of the NOTICE A $ 700 loan request came from homecoming committee,announc"SING-IN" AT WILKES NUMBER 9 i Rob Doty, -chairman of the SG- ed that tickets for the dinner dance Slocum clambake scheduled for are on sale in the SG office, second Sponsored by the Wilkes College SHOP ~ Saturday, October 25 from 2 to 5 floor of Weckesser Hall.The single , Christian Fellowship and Inter. . Northampton St. 9w College Fellowship at the Dorothy r p.m. The event is co-sponsored by 1 tickets cost $14 each.Students will Dickson Darte Center for the Per- J Wilkes-Barre, Pa. 18701 Student Government and Slocum pick seats and identify them with Hall. SG has donted $200 to the their. students numbers. Reserving forming Arts on Sunday, October 5, Boutique•Jewelry•Clothes 1980, at 3:·oo p.m. r , event. "The loan ~uest is so that tables will not be allowed. There "Sing 'ln" will feature live ac- J Layaway Available r we can pay for the clams and ham- are ten seats per table. compani ment with guitars and W• Acc-.,t Master Charge & Visa J burgers we ordered," stated Doty. . Parliamentarian Ana Nunez After much discussion concerning· stated that 45 club~ and organizaother instruments. No admission charge. Everyone is wel~ome. - ~ __.. _ _ _ _ _ the repayment of the loan and tions were present at the charter ticket sales procedures, Galli clos- renewal meeting."Some "clubs have ed and reopened the meeting so the changed l)ames, some con- ►, council could vote on the request. solidated, some added and others Come In & See _Why SG stipulated that the loan be ' deleted," she said. {n a few weeks, repayed within one week after the an updated list of campus clubs and .COR.INNE & JOEY clambake. A vote was taken and the organizations will be available. Are Packing Them In At request was passes 19-0-0. SG Advisor, Mrs. Doris Barker, closrepresentative Dana Shaffer stated ed Ute meeting by commenting that that he hOpes the event turns out there has been a great influx of -309 SOUTH MAIN PLAZA WILKES-BARRE ~ well and Slocum Hall does not get students getting ID cards into debt. validated. " I ttiink it's due in part to In other business, Rob Doty, co- the voting and I hope it continues, " BuyOne ' chairman of the Publicity and Elec- she stated. tions Committee announced the or lllrt Pim, EnlNswlle NOTICE winners of the replacement elec288-2235 There will be a meeting of the tions held last week. Elected as SG Journalism Society this Sunday at or representatives from the class of 1:00 p.m. in Parrish Hall, room 27. 1981 were Cheryl Crea and Les All members are urged to attend. Try one of our Nicholas. The newly elected class Anyone wishing to join the Jour- -Get Any One Free ' GiantGoumetlurgen o( 1982 president is Bruce Willi.am~. nalism Society is also welcome. En. With This Coupon -21 different varieties trance to .Parrish Hall will be --~ · _ Offer Expires October 15. lflO WC , . -sened seven days a week. through the side door only. Clambake And Buses FundedAt SG Meeting "JUST US". Friday Night r-------~-----~ - ii l i i. L i i i i ·J ...................................................,,. iI . :::::~~ . !I More Than A Blir1?er Place I~ Hot Meatball Hero Italian Sausa~ Hero Cheese SteaR Hero ; i '_JiM I -UANDYS I ! i ...................................................... ___________.. ~ , �I October 2, 1980, The Beacon, Page 3 Meal Ticket Program Discussed By IRHC IRHC held their meeting Sunday ed. Joe Galli noted that a study is night with the major topic of discus- being conducted on the Learning sion being the meal ticket program. Center as to how it is and was being Joe Galli complained that several used by students. Some resident unauthorized students were using students said that if the Learning the cafeteria to eat their meals Center could not be used late at without paying for their food .Galli night that perhaps a deal could be noted in particular that a few made with the library to remain students that own apartments are open to about 3 a.m. Jon Pliskin, a the ones that are abusing the ser- member of the committee looking vice for resident students. " It's un- into the Stark rules,noted that the fair," noted Galli and added," We suggestion of keeping the library are the ones paying for the food .' ' open is being considered.There is Recognizing the problem, a sug- also a possiblity of having the Stugestion was made to go back to the dent Center extending its hours. old system of using the student IDs Under old business, IRHC presiinstead of meal tickets in order to dent Janine Tucker thanked all who be served the meals.A · special helped with Parent's Day and noted number could be engraved on the that it was a success.Tucker also card for all resident students that explained that Fred Daniele and eat at the cafeteria.This procedure Keith Williams are now appointed would enable stude.11ts to use their to the Intramural group and that IDs more often while trying to corJayne Grim and Bqrb McGee have rect the current misuse problem at been appointed to serve on the Stuthe cafe.The disadvantage to this dent Advisory Board. system is that some students might The meeting concluded with a not have their cards with them and reminder that an ugly picture conunless they are able to pay for their test is being held and that next meals, they will be turned away week two people will be selected o from the cafe. chair the committee. Another suggestion to remedy the situation was made to maintain the current system of meal tickets, but to stronger enforce the system . No one would be allowed in the cafe during meal time without a meal ticket and a more enforced check will be made on the students and The new election rules were the their meal tickets.Bruce Williams, maor topic of discussion at the Monchairman of the food committee day night meeting of Commuter will examine the problem in more Council. Rob Doty and Chris Fellin, detail this week. Chairmen of the Publicity and ElecIn other business,the new Stark tions Committee presented their rules and regulations were discuss- proposal of moving student elec-------------------------- ISupport Triorganiza~ional Meeting Of Ac~i~i~ies Urged A triorganizational meeting was held on Sunday for officers and representatives of Student Government, Commuter Council, and Inter-Residence Hall Council. SG president Joe Galli opened the . meeting by stating that its purpose was for the representatives to get acquainted with each other. President Robert S. Capin was present at the meeting and he commended the student leaders for the jobtheyhavedonesofarthisyear. He noted, "I am really happy about what I have seen take place this year." Capin urged the representatives to encourage their fellow students to support all of the activities of the college. He commented, "When activities are sponsored, the success Galli noted that there is " very littie turnout of faculty and administration" at college sponsored activities. He told the reps to encourage the faculty to participate in the activities. In other business, Al Wirk"llan announced that tickets for the Homecoming dinner dance are on sale in the SG office, and he ran down the list of events for Homecoming. He noted that there will be more displays and floats than last year. Marla Brodsky announced that an arts and crafts day will be held soon and everyone should watch the Beacon for more information. She asked that everyone participate. Tom Rooney reported that this year SG will sponsor two trips to Florida during the spring break. One trip will be to Fort Lauderdale and the other trip will be to Daytona Beach. Rob Doty announced that there will be a clambake this Saturday from 2:00 until 5:00 at Ralston Field. Hamburgers, hotdogs, clams, and soda will be served. Tickets are on sale for $3.50 and this includes admission to a party in the Student Center after Clambake from9 :00untill :OO. It was pointed out that last week the Beacon erroneously reported that the cost of the triorganizational meeting was $300. In fact, the cost was $100. The meeting ended as the members of the three groups sang songs. Louis Czachor The end of the fourth ·week of classes was last Friday. This means that last Friday was the last day for withdrawals from courses without the permission of the course instructor. From the beginning of the semester until last Friday, any course could be dropped after the student notified his instructor, his advisor, the appropriate Dean of Student Affairs and filled out the necessary paperwork for the Registrar. After the fourth week, however, a student can drop a course only with the written approval of the instructor, faculty advisor, and appropriate Dean of Student Affairs. This is the_ first year for this withdrawal system. Previously, students could drop courses without the, instructor's approval through the tenth week of classes. However, Registrar Doris Barker pointed out that she has ' ' always required the three signatures after the first week of classes anyway" because these people have to know if a student is taking a certain course, and if the instructor is not notified, he can arbitrarily give a New w1·thdrawal Po11·cy,· N o Pro blem For Registrar . of the activities is completely dependent on participation" . Capin then asked for respect for college property. He asked that everyone"trytoprotectourgrassa bit. " He explained that people should try not to walk on the grass and should try to keep the campus clean. He added, " Many people say that for an urban campus, we have an appealing campus and it should be kept that way ." Proposal For New Election Site Presented To Commuter Council RECYCLEYOUR HIGH SCHOOL RING! ITWlllHEIP BUYYOURNEW COLLEGE RING. When you trade-in your men's tions from the Student Center to a more centralized location. The " centralized" location will be the lobby of the Stark Learning Center. In addition to moving the elections to Stark, the voting hours will also be extended for a longer period of time. There will also be voting in the cafe in the evening for those students that could not make it to Stark during the day. Chris Fellin noted that "elections on campus are really hurting. The new campaign rules are to help students have a better chance in voting and participating in the elections." The decision for a " centralized" location will be used on a trial basis starting with the upcoming freshman elections. Under reports, the CC-IRHC Halloween Party slated for Friday, October 30, is goin~ very well. The Herman James Band will be performing and Poly-Care will cater the event. Tickets will be $1.50 with a 50 cent refund at the door for anyone who dresses up in costume. Prizes of $50, $25 and $10 will be given respectively to the first through third place best overall costume. The coffeehouse Committee reported that Pat Godwin will be performing on Tuesday October 14, from 11 to 1 o'clock in the Student Center. It was also announced that • another coffeehouse is currently being set up for the month of November. Martha Gallagner will be expected to perform. Gallagner plays the flute, guitar, harp and the pennywhistle. , In old business, CC President Bill Miller thanked all who helped at ' Parent's Day and who participated in the Tri-Organizational meeting. Miller especially wished to thank Becky Schmidt for making the , Parent's Day sign for the council. 1 Under new business, Colleen : Gries and Edward Stachowiak $ were appointed to Commuter Coun• cil's new Publicity and Election Committee. This new committee • will work closely with Rob Doty and 0 Chris Fellin and the new election rules. Plans are also underway for an Includes All Artists Octoberfest sometime this month. : Colleen Gries and Nancy Bowanko All Labels : head the Octoberfest Committee. Council will also be working on drawing up "Council and Committee Objectives" in the near future. CC was also invited to attend a com587 South Main St. Wilkes-Borre, Pa. muter convention sponsored by SUNY. Due to the closeness to the Homecoming celebrations, cc will ~ Narrows Shopping Center • not be attending. Miller noted that Commuter Council will be par' Edwardsvil~e, Pa. __ • ticipating with the group in the near ~-_,..,...,ff4,..,..,..,...,.,.,..,..,..,~ future and at the next convention. ~ school r·1ng 'or $88• 00I..._H_ff_ff__._.__.__.,.~~-,.......,.-~~ 10K ·gold h'V' • I' • · · • · Stereo LP :. on a Lustrl·um collAnA ring -v' America's newest fine $ 00 • SALE jeweler's alloy. . . . . . . . . . . . . . . . . 78 • \t>ur R~~~~'! .. . . .... . ... ... $10.00 Trade in your women's 10K gold high school ring for S3 6. 00 and buy your Lustrium college ring for only S 4 2. 00 10K gold high school trade-ins also apply on all Josten's 10K or 14K gold college rings. • I Oct .. ON.Y JOSTENS H RNG PEOPI.£. DATE_M_o_n_.-_T_u_e_s_._o_c_t_6_&_7_ __ TIME JOam-4pmpLACE Bookstore S 10.00 Deposit c'.:1.~-------------------------- All sa.98 LP's : SALE : 5 99 Genera~ Radio & Electric Co. Music Factory "O" . The report from the Registrar's office is that at this point there have been about as many withdrawals as other years at this time. Despite the controversy surrounding the new rules, Barker reported that so far there have been no problems. She added that she does not expect any problems during the next several weeks either. She concluded, "I really don't think the new policy is to penalize the students. It's just to get them to get more rap time with the professor." Louis Czachor NOTICE REPORTERS ARE NEEDED. Anyone interested in writing news and-or feature stories for the Beacon is asked to attend the weekly meeting on Sunday at 1:00 p.m: in Room Tl of Parrish Hall. Use the side entrance to ·the building. If you cannot attend, but are interested in writing, leave a note in the messages envelope on the office door. Include your name and telephone number. NOTICE The Political Science Club will meet on Thursday at 12:00 in the Political Science library (located on the lower level in Franklin Hall) . �Page 4, The Beacon, October 2, 1980 Ne111 Campaign Rules••··--································ Brodsky Feels Coa,erage Un/air To the Editor: Campaign regulations passed by Student Government have made the headlines! Last week's edition of the Beacon was an example of biased and exploitive reporting. Objectivity is obviously not a concept understood by several members of the Beacon staff. Few representatives have expressed a negative viewpoint on many progressive ideas proposed by the new campaign rules. Many reresentatives have expressed positive viewpoints. The Beacon has elected to support the negative viewpoint and completely disregard all of the Editorial reply: This letter is in response to last week's articles concerning Commuter Council and Student Government and the page 4 editorial entitled "The Students' Choice." The author has accused tlle Beacon of exploitive reporting simply because the reporters have presented the facts in their articles as the facts and comments were presentd to them at the respective meetings. If some items are to remain confidential, this shoud be stated as such during the course of the meeting by use of the "oif the record" agreement. Moreover, the article referred to OD page 4 is in fact an editorial. Therefore, expression of opinion in this article is inherent. (Page 4 has been the editorial page in the Beacon for at least three years.) Accoridng to the American Heritage Dictionary, an editorial is " ... an article in a publication expressing opinion.'' Additionally, the Beacon has never downgraded the new cam- Beacon) in one out of three arpositive attributes. Is this reporting ticles? NONE! ! The students are representative of the students? NO! led to beleive the campaign rules Therefore the reporting does not provide the information presented. are blasphemous, becuase the reporters say so. Let the 2,000 The editorial claims, " How many students are willing .to invest $25 or students make up their own mind and save space for the campaign $50 in an office and then face the rules to ·be printed. If they are so possibility of not even being important as to spark comment on elected?' ' The editorial also claims each page, present the facts, then that the new rules will put a burden on potential candidates if they must · make the coments. How can a secondary source downgrade petition for , signatures! ! If those something which has never been who wish to be student leaders are tried? The intitial campaign may not willing to put a little effort into a start off slow; but the progression campaign, they shouldn't run. For of useful ideas is a necessity at this when they do get into office, they school. This year we are achieiving better be prepared to work . Work· this goal ; so take advantage of ing for something you believe in potential positive outcomes. The was never a crime. We want to proBeacon ls incorrect in assuming the mote more student involvement; students' answer to '.'The student's having 50 signatures for each canchoice?" until the students let them didate will certainly provoke potenknow the answer. Let's get unintial voters to question the issues, formed students aware of what is qualifications, and abilities of each candidate. What kind of factual ex- · going on, intead of what some pea. pie think should be happening. A planations are reported (by the college newspaper should work for paign rules as the letter states. · students, not against them . "The Students' Choice" merely Marla Brodsky pointed out another side of the Vice-President, Student Gnvernstory, which was almost neglected m en t . by the leading organizations. The Beacon, by pointing out the opposdisagreement's sake is not part of ing argument, bas, in fact, worked the Beacon's journalistic for the students in so far as the philosophy. To be impartial does students are the ones most aflected not require the Beacon to be unby the rules, and should be aware of questioning or to refrain from both sides of the issue. editorial expression. It is this sense The Beacon is not diametrically of fair play and objectivity which opposed to Student Government enables the Beacon to point out the policy and procedure. In fact, the opposing point of view rather than Beacon supports many of SG's just blindly accepting policy set endeavors and assists in promoting • forth by any organization. mutually agreeable topics. However, the Beacon is not a rubPolicy ber stamp of SG policy nor should it be. Additionally, disagreement for Letters to the editor are welcomed from all interested parties. Letters MUST be typed neatly and submitted by 3:00 p.m. on the Sun4. All information for publication day before publication. Letters MUST BE· PRESENTED TO THE may be delivered to the Beacon ofBEACON BY THE SCHEDULED fice, second floor of Parrish Hall, or DEADLINE IN ITS FIN AL FORM! · the Beacon box in the library before . Material should be in the Beacon this deadline. Office, second floor of parrish Hall All letters MUST be signed IN or in the Beacon box in the library INK, but names will be withheld no later than 3 p.m. on the Sunday upon request. Class year and-or apbefore publication. It should be propriate title should be included typed in double spaced format on with the signature, This status will 8% x 11 white paper. This rule will oe verified by the editors. Any letbe enforced and the editors reserve ter bearing-a signature and-or title the right not to include any indeemed as fraudulant by the formation received after this editors after verification will not be deadline or not in the specified forpublished. mat. Editorial discretion will be used , in all cases, especially where questionable language is used. All let' ters will be published . as written, without corrections (except fot the preceeding case), and the views ex·pressed in letters are those of the , author and not those of the· Beacon orcollege. Letter Submitted Material Policy Campus club and organization officers take note: The following standards will apply when submitting material for publication in the Beacon. I. Include the type of affair being conducted. Give complete details regarding admission fees, entertainment, refreshments, etc. 2. State the time, day, date and location of the affair. 3. List names of committee members responsible for organizing the affair with proper titles, if applicable. ,- f ----------------~ Homeco~ing Schedule ' 'Thursday, ·o ctober 9 Bonf_lr:e t 'Raleton F.leld 10:p .•. t & ' Queen announced at thl• ti•• ' : F rlday. 0 ctober 10 D~• Der Da nee :-Se-v-e-ra-1s-u-b~-~-r~-c-~te_m_s_a-nd-let-,Gue Genetti Inn 7 .p.•. -1 •--·" ters were received after the 3 p.m. '& Muelc by "Ticket" on Sunday and as a result, . t' dea~e could not be printed this week. !t Students are reminded that all submitted materials should be placed t' Saturday, o 'ctober 11 P d 11 in the Beacon box in the library or f ara e . · • - • f in the Beacon offic~ by Sunday at 3 p.m. before publication to insure 9 -;'p. - · • t 0 - Id D I9 ht t that tG Y• P a rt tr these items be considered for &S d O t. b 12 · f pablication in that week's issue. , U D a V, C O er · Please refer to the Letter to the tArt• and Craft• Day 1 · 5 :p .•. t Editor Policy and , Submitted • Materials Policy on this page for f O·■ ta14e tlae St••·• •t Center f fm1Jlerc1etaus. , cc President Defends New Campaigr1 Rules To the Editors and all Wilkes hastily put into effect, and that the Students : more student input that is received, Over the past few weeks Com- · the better these guidelines will muter Council, Student Governserve all the Wilkes students. These ment and the Inter-Residence Hall revisions also point out that the maCouncil have been discussing the jor student bodies are cooperating newly proposed election guidelines. on these new rules so that each perThe discussions held at these sons opinion is heard . meetings have lead to some reviIn the next edition of The Beacon sions In the original draft which the new guidelines should be make the rules more equitable to published so that all Wilkes all students interested in running students become lamiliar with the for an elected campus office. process of running for elected ofAfter the discussions held at fice. Commuter Council, revisions conChange for change sake accerning the number of names on the complishes nothing. These new petition for nomination for Comelection guidelines however will en- · muter Council representatives courage more student participation were agreed upon as was a reducin elections and will make Student tion in the amount a candidate Government, Commuter Council could spend on his campaign for and Inter-Residence Hall Council printed material. The number of more responsive to student needs signatures required for nomination and opinions. A change such as this to Commuter Council was cut from should be welcomed by all students 50 to 30 to better reflect the fact that at Wilkes. Commuter Council representatives Sincerely yours, speak for approximately one half of William R. Miller their class and that 10 per cent of Commuter Council President that figure would equal 30. The amount of money a candidate can Editorial reply: For a copy of the opt to spend was reduced from $50 new campaign rules, see page 8. to $25 to encourage the candidate to Further comments concerning the use printed material but not abuse new rules are welcomed by the this option and to encourage the Beacon. <Please see Letter to the candidate to spend more time Editor Policy this page.) meeting the people he will represent. NOTICE Commuter Council along with Due to the selection of the Student Government is also conHomecoming Queen, the Beacon sidering establishing a centralized will not be distributed until Thursvoting booth in the Stark Learning day night after the bonfire. Look for Center Lobby for the increased use the 1980-81 Homecoming Queen on of all Wilkes Students. , Friday, October JO in the Beacon ! These revisions point out that these election guidelines were not r:===T1%jG~~0l?f=--. USPS 832-080 Editor-in-Chief Patti Sparlow News Editor Louis Czachor Managing Editor Margaret Scholl Asst. Sports Editor Dave Capin Asst. News Editor Darlene Schaffer Feature Editor Mary Kay Pogar Copy Editor Lisa Gurka Business Manager Vanessa Martz Advertising Manager Michele Serafin Asst. Feature Editor Circulation Manager/ Cartoonist Michele Fidrych Sports Editor Peter Steve "Photographer Frank Jeffrey Advisor Dr. Norma Schulman Reporters: Sue Beckenbaugh, Nancy Bowanko, Robert· Buchsbaum, Lisa Cobb Elaine Czachor, Roya Fahmy, Doug Fahringer, John Finn, Jennifer Frohiinger, Mark James, Candy Marshall, Daria Morris, Rich Nordheim, George Saba, Anthony Sibiya. · Parrish Hall 16 S. River St. Wilkes-Barre, Pa. 18766 PubHshed weekly during the school year from September to May except for vacation periods and semester breaks. Entered as second class postage paid in Wilkes-Barre. Send form number 35,79 to the Beacon, Wilkes College, Wilkes-Barre, Pa. 18766. Subscription rate to non-students: $4.00 per year. Advertising rate : $2.50 per.column inch. · Phone: (717) 824-4651 All views expressed are those of the individual writer and not neces~arily of the publication ~r the college. ---- ----- - - - - - - - - - ·1------------......1 L::::===============:::;::=========:!.1 �October 2, 1980, The Beacon, Pa~e 5 From Backstage &citement-~- Ca~t Of ''Romeo and~ aliet'' Recreates FaDloas Tragedy -----~-To Magical Transformation• "Are you the costume mistress?" close. Even though it's hard work, I 10:00 P.M. - I go backstage to Sunday, September 28, 3:30 P.M. touring co~pany in America. It I questioned, and she replied that wouldn't trade this experience for ·congratulate the actors and -:-- I leave the Dorothy Dicksen was started 19 years ago by P~ilip yes, she and Katie Thorpe, who the world. How many 24-year-old ac.tresses. They all seem pleased Darte Center for Performing Arts Miester and his wife ih New York. plays Lady Capulet, Juliet' s1 . girls are traveling all over the with their performance of Romeo after play practice. The dark stage 'The cast that played Romeo and mother, ironed and washed and United States doing what they love and .. . Romeo! Oh, my gosh, I is lit with a single naked light bulb J.uliet Sunday night has been took care of the costumes while the the most?" forgot to interview Romeo . .. on a lamp stand. The theatre looks rehearsing in the Catskill Mouncompany was on the road. 6:00 P.M. - I leave the theatre to Well, I caught him as he was walkempty and deserted. As I am leav- tains of New York for only six and Katheleen Henderson (Juliet) is grab a bite to eat anci the actors go ing out of the makeup room. "I'm ing; I run into Mr. Alfred Groh, the one-half weeks. They are also per5'2", slim, with large blue gray back to the Hotel Sterling to rest, Mitchell Sugarman," he replied director of the Concert and Lecture forming two other shows on their eyes and long, blondish-brown hair. exercise, jump rope and do yoga to with a beautiful smile, and I hail Series at Wilkes. I ask him whe,n the tour this year; Shakespeare's from Sacramento, California." He National Shakespeare Company is tragedy Richard III, and A Comedy . She was born in Brooklyn, New ' prepare for the show. York, and attended the famous 7:00 P.M. (still Sunday night) told me he studied with a private arrjving to perform Romeo and of Errors: They will be on tour from High School of Performing Arts for The actors are now on call. That drama coach in Los Angeles and Juliet and he says they are arriving now until December 14 and will go two years. She then trained with the means they have to be at the has taken dancing and singing within one half hour. "The actors back on the road from January 10 are coming, the players will be here until May 15. Sun. night Wilkes~ well-renowned Stella Adler, one of theatre getting in makeup and lessons for 8 years. This is his sethe oldest drama coaches in the costume an~ preparing for the cond year with the company and he soon!" It is almost as if we are in a Barre, Pennsylvania, got a special United States. She is 24 years old show. They are putting the lastis enjoying the experience. Then he small town in Elizabethan England .treat because it was the company's hearing the cries of the simple folk opening night for the 1980-81 season. and this is her first year with the minute finishing touches on the set quickly jaunted off to help someone company. She also competed and setting up the props. take down the set. as they wait for the traveling troupe Some of the actors felt they could against 1000 other actresses for her 8:00 P.M. Sunday, September 28, As I was interviewing him, for of Shakesperian actors to entertain have used a bit more rehearsal but role as Juliet. " It is the most exthe Wilkes College Concert and Lee- some odd reason, I felt like a gigglI felt their professional them. citing and tiring thing in the world ture Series presents the National ing adolescent asking her favorite 4:00 P.M. - the transformation Shakespearian training certainly to be on the road. You stay in difShakespeare Company performing dreamy rock star for his autograph. of the stage is amazing:In one short was evident last night. ferent hotels in different towns and Romeo and Juliet - As the curtain Who knows, maybe I have a 5:00 P.M. the same day - I half hour the group has arrived and cities, and you get to meet all of opens, I stare at the r~age astonish- weakness for Shakespaerian acis setting up the stage. There is an wandered downstairs to the old bus parked by the loading dock costume room where I found a tiny, America. Small-town American au- ed. Four hours ago there was only a tors, especially handsome ones. diences_ are- much different from b3re light bulb. Now the stage is 12:00 midnight - I'm sure the backstage and the crew is running · graceful looking young girl trying New York audiences. They are less washed with warm red and yellow cast is sleeping now, taking a wellaround in faded jeans -and work to hang up some costumes that she critical and more appreciative. You fights which illuminate a painted deserved rest after an exhausting shirts carrying boxes and hanging had just ironed. "Could you help me know, the audience oecomes your scrim and tasseled curtains. As the day. Tomorrow at 1:00 P.M. they lights. I wonder where all the ~ith these?" she questioned in a friend on the road because so much players move and speak on stage, I will load up their old, dilapidated beautiful actors and actresses are, soft piping voice, "I just can't seem of your personal life is taken away. become more surpris-:d. Four bus and drive to Trenton, New this crew must only be the techni- to reach the rack." Then she inThe actors and actresses in this hours ago guys in grubby jeans and Jersey, to perform Richard the III. cians. Mr. Groh told me to speak to troduced herself. "Hello, I'm troupe have already become my three tired-looking young women I am sort of glad I didn't see them Carole Baker, the company Katheleen Henderson, I P,lay family, we are becoming very entered the theatre, now at 9:00 leave on Monday ; I would have manager, and I finally find her Juliet." they are transformed into the been a little sad. Because Sunday among the steel girders and beautiful Shakespaerian actors night those 12 actors and actresses lighting cables. "Hi! " she says whom I expected to see. It seemr, brought glitter antl excitement to breathlessly after just shouting an like 24-year-old Kathleen Hender- the Wilkes College Theatre and left order -to one of the workmen, · son has regressed 10 years as she with it' as fast as they had swept in "Would you like to sit down for . a plays the haunted young Juliet. Sunday afternoon. minute and chat?" Carole Baker is the company manager for the National r..,...,...,.""=✓-r✓✓->QC Shakespeare Company. She books , the shows at colleges and universities, reserves hotel rooms for the crew, does all the public relations on the road and plays psychologist when any of the actors or actresses needs to talk. This is her first year as company manager and her second year with the company. Last The First Presbyterian Church on South Franklin Street will present the R year she was an actress and this ~third film in its film series on Thursday, October 2, at 8 p.m. at the church. year she plays the nurse in Romeo SThe film is "Distant Thunder," a for,eign film about a young Brahmin who and Juliet. "BBBut," I stammer, begins to question his values ~~'.'.:':'.~~Cost of the film ls 12.50. "you mean all these ordinary looking people are the players?" "Yup," she replied with a smile, "the youngish guy hanging the §I A mixed media installation piece, "Experimentive Direction in the lights is Romeo and the tall heavyVisual Arts," by John Stascek is currently being exhibited at the Sordoni set man who is putting up the scrim Art Gallery until October 5. Hours of the gallery are from 1-5 p.m., Sunday plays Juliet's father." I then spoke through Friday, and from 10 a~m~~~o~:turdays. to Carole some more about her per- · "A MIME'S EYE VIEW"-Tony Montanaro and two assistants will prosonal career in acting. She was vide Wilkes with a mime's eye view- a look into the silent world of the art of born and raised in El-Paso, Texas, mime. The SG Film Committee will show another movie this week in the CPA. and came to New York City after The classic art of mime will be graduating with a B.A. in Theatre off from touring and · founded a "House Calls," starring Walter Matthau, Glenda Jackson, and Art arney, will be shown at~ and 9:30 p.m. on Friday, ~ctober 3. Arts from the University ofTexas. demonstrafed in . a program of theatre and school, which. led to She. did some commercial work mime episodes called "A Mime's many projects. He produced and -t- _ _ _ ..,_ _ _ then decided she needed more ex- Eye View," by Tony Montanaro directed the theatre's touring \mits perience in classical theatre. She and two assisting artists, The profrom this home base. He also The Concert and Lecture. Series will present two cultural events this · auditioned for Mario Stettler: direc- gram will be ptesented at the CPA beca_me involved·in television, con~ week. On Tuesday, October 7, Tony Montanaro and two other mimes will tor of the Nafional Shakespeare under the auspices of the G.oncert ducting a year long artist-in- perform "A Mime's Eye View,',, a program of mime episodes, On Wednes-· Company in Norfolk, Virginia. and Lecture Series at 8 p.m. on residency for a public television day, October 8, The National Players will present a Victorian farce , When Carole found out she was cast Tuesday, October 7. station in Maine. ''Charley's Aunt." Both programs will start at 8 p.m. in the CPA, The program will feature mime in May of 1978, she,was understan· After six years off the road, Mondably ecstatic, she had been in com- episodes in the silent style, but will tanaro ·has created new works to petition with 1,()()() other actresses include other forms of theatrical perform, and is again Qn tour. Last Ther1 will be an SG-Slocum clambake at Ralston Field on Saturday, Ocfrom all over the United States. expression including folktales, fan- · year he toured in the western and tober 4. The cost for an entire day of food and fun is only $3.50. Starting at 2 Carole uses no special method in tasies, fables ·and other selectioris northeastern United States. This her acting; sometimes she draws from literature using-voice. music, year, he plans to take the group on pm., -there will be hamburgers, hot dogs, an,d other good food, with clams on personal experiences for her narrative, an<fmovement. available for $.75 a dozen. The $3.50 ticket also is good for admission to the an international tour in addition to Tony Montanaro's group first Student Center party that night. his U.S. tours. scenes, sometimes she does not. "I don't think I will be doing any more performed "A Mime's Eye View" Wil~es is fortunate to be one stop Shakespeare after this year and in New York City in the early 1960's on Mo_ntanaro's schedule this fall, even though we don't get paid to critical acclaim. Montanaro ci:>nso be sure to see the group's perThe class of '83 will hold a party in the Student Center on Friday night, much, the experience has been tinued performing and touring to formance on' Tuesday night. It is October 3. The party starts at 9 p.m. and will continue unlU 1 a.m. Tickets college and community stages most valuable." certain to be a fascinating exwill be sold starting Thursday in the Student Center and in the cafe. throughout, the country until 1972. perience. The National Shakespeare Company is the oldest Shakespearian At this time, Montanaro-took time Mary Kay Pogar ~...ccooooo000coc00:,o,-..oococ10C:ac..:,oocccioc~:o=ooc~ Mimes to Perform at the CPA § . Mary Kay Says.-.:;,-..,.~ ~ What's Happening I I I I •:1 ·I I ls S 8 - . ------- �age 6, The Beacon, October 2, 1980 ''Romeo and Juliet'' ·l'_er/ornaers Popular with Wilkes Audience Combining superb acting and playing the violence and passion in- comic relief before Mercutio's beautiful costumes, the National volved in the situations . death, such a serious mood was Shakespeare Company recreated The performance did have its destroyed, the famous romance, "Romeo ,and flaws, however. Although these However, it should be emphasizJuliet" in the CPA on Sunday night. flaws were relatively minor, they ed that the actors and actresses did A large crowd of students, faculty .did detract from the overall quality _· perform extremely well . It was onand members of the public attendof the play. The most· noticeable ly by accident that the atmosphere ed, expecting to enjoy the popular flaw occurred during one of the of the tragedy was disrupted. The love story, and they were not disapfight scenes, in which Mercutio and performers did their best to_restore pointed. In fact, several members Tybalt (played by Louis Fischer ) the appropriate mood, and conseof the audience gave the per- - were dueling. In the middle of a quently, the final moments of the formers a standing ovation. , flurried exchange of rapier thrusts, play were flawless. As expected, .the actor who Peters ( who played Mercutio) lost Overall, then, the play went over 6. Visiting ~rtlsts' Qroup Show: Cohen. 1. ..... Aalto Pinto, Hagin, C~sllift{I played Romeo, Mitchell Sugarman, his shoe. Although he was able to well with the audience. The actors Twen lteth-Cenlury Finish Architect Envuonmental Sculptu re , Pa111t1rlg , Sm ithsoman lnst1tul ion Traveling Exh1b1 t1on and the actress who played Juliet, put the shoe on his foot again with and actresses gave a realistic and Photography. Ceramics August 23 - Septemoer 14 Kathleen Henderson, were the most little break in continuity, it was sensitive performance of the Wi lkes Colleg e Art Depar tment Studio 2. John Stucek wo,kshops popular with ·the audience, but enough for the audience to notice. violence and passion between Mixed-Media Installation January 18 - Februa ry 8 several of the · other performers As can be expected, the audience members of the Capulet and MonNew York 7. Regional Scholastics Art Awards Sep/ember 21 - Oclober 5 w_ere also received wen: Jerry found the situation-humorous. The tague families . · It was only unJunior and Senior H1gh School Art Peters, who portrayed Romeo's · action continued, but the mood was fortunate that a small flaw marred 3. Ste.. Poleskle AH Media • February 14 - March 8 Coll age s and Drawings of Aerobatic Art friend, Mercutio, gave an lost. the audience's perception of the 6. Wilkes College Art Faculty: Colson, It was un for t unate that the t rag1c · a t mosp here of one or two Cornell Universi ty Art Department o•vorzon, Fuller, Maxwell, simon, agreeable performance, an the auOcrooer 20 - · November 9 ster11ng ~ dience -appreciated his humorous . mishap occurred when it did - dursituations. 4. OIA Printshow, New York All Med,a • Marc h 1s - AP" 1 0 antics. Ing a tense scene, just before MerMary Kay Pogar Recenl T, ends 1n Pnnlmaking 9. Students 01 "The Eight": Bellows, All the performers played their cutio is killed. The situation did Orgarn zat1on of Independent A1 t 1s t s Novemoe, 16 - Dec embe r I Hopper, Goltlleb, Newman, M■rsh ~ parts realistfcally, but those menrelieve some of the tension in the and J S. Peper As Art Ma1orothers H1s1011c al Survey ot Leading Art,st s tioned above turned in truly situation, but it came at a time O Recent Trends in the Use of Paper Ap,,, 12 - May 11 memorable performances. The acwhen comic relief was not in order. Sm11hsonian lnst11ut1on Travehng Exh1b111on 10. Wilkes-Barr, Architecture tors and actresses handled the emoUnfortunately, the disruption of the San I Diego has a chicken, Oec~mber 14 - January 11 D·o,. mqs ~~~:cg •_a pcs an,1 Models tionally charged scenes well, tension at- this particular time Philadelphia has the Phanatic and =-,,r ◄r ◄w- ~•-·, ·__ -Sr -3 neither over-playing nor under- detracted from the overall enjoy- Wilkes now has a Colonel. Two girls fried out for the position on Satur"" d S i ment of the play' s true atmosphere, ,..Oft Cert Gft ecture er es • • • • • • • • • e e • • • • • • • • • • • because it seemed to set a prece- day, September 27, at the foo tball ' dent for the remainder of the au- game. dience's reactions to the tense or Sharon Michner, a freshman solemn moments Qf the tragedy. biology major; said, "It's an outlet For instance, when Tybalt is kill- for my rowdiness. " A freshman A Victorian farce, "Charley's unt,'' will be performed by the Naed, and his body carried out by the elementary major, Cathy Reynolds onal Players on Wednesday night servant, Peter (played by Peter stated, " We need to show spirit and 1the CPA at 8 p.m. The play is the Whitehouse ) the audience laughed. I want to help." ~ond program this week to be Although one could find some The outcome? According to Joe >0nsored by the Concert and Lechumor in this situation, since Peter Galli, President of Student Governcarried Tybalt out upside down, the tre Series. ment, both girls will serve as the The comedy was first perfor med · solemn atmosphere of the play at Colonel during alternate games. He 1London at the Royalty Theatre in this point should have prevented added that hopefully, an official 192. It became an overnight sensaany laughter. However, because of Colonel mascot uniform will be on due to the humorous situations the previous element of unexpected available before Homecoming. 1at occur in the comedy. The Jpularity of the play has grown ; ' nmensely. There are several road >mpanies on tour in various counies performing this fl!mous corpiy. Many notable actors have ap~ared in the play at one time or oother, including Rex Harrison, oel Coward, and J ack Benny. · 'l'he play is about two Oxford .udents, Jack and Charley, who re in love with two young women. 1ck and Charley invite the girls to "CHARLEY'S AUNT"-Charley and his friend , Jack, entertain two lady 1eir room for lunch to meet friends while Charley's "aunt" acts as chaperone . harley's wealthy aunt. However, 1e aunt finds she can not go to the r,!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!jl ncheon, thus creating a problem (;,~ ,r the two men : the girls cannot There really wasn't much choice sit Jack and Charley unchaperon- Masc f se ec fe d L f o Offer Famous Victorian Farce UNTILNC»! CHCDSINGA COLLEGE RING WAS~· __~ .. _ , _ Susquehanna Environmental Advocates Presents: t However, the two find a friend :hearsing for a school play - and s costume happens to be that of an d lady. The friend agrees to pose ; the aunt for the afternoon, but is is not an end to the complicams because Charley's real aunt rentually does show up. But she ;sumes another name upon learng that an imposter is using hers. . the end, everything turns out for e best and the play ends happily. So take an hour or two out of your hedule to enjoy a first-rate comly performed by a national spected company of actors and :tresses. Remember- " Charley's mt" in the CPA, Wednesday night 8p.m. NOTICE Elections for Homecoming Queen II be held todav from 10 a.m. to 4 Rally to Stop t-h e Berwick ~~ NUKE r~✓" ra...."'y ,.u. &t-_'1-' , IIO ~ • ~ "/~ Join the Cause. - • 0 • • • • - • ' _. ~-~'. .,.;·• _ -, ~ .•. .. _.·.. , •. · ::-,~: . ·- . .,____ j ' ' .:.• - . - " Nationally Known Speakers Public Interest Speak~rs professional Musicians Mime Artists 11 a.m. to? Sat., Oct. 4 A~rncc frnm th& Berwick in Women's rings. But no mo re. Jostens now offer distin~tively different fashion designs that will make your decision difficult. Like the Designer Filigree and Petite Filigree shown here. All styles are available in 10K gold, 14K gold and Lustrium. See them all. Deciding won't be easy. From $78.00 DATE: _M_o_n_ . -_T_u-,-e_s_._O_c_t._6_&_7_ _____ .TIME: IQ am - 4 pm PLACE: Bookstore ~1\1~ $10.00 Deposit �October 2, 1980, The Beacon, Page 7 , Grievance Board Established To Hear Student Complaints A few Wilkes seniors are in the Hall, and will be conducted in two process of establishing a relatively sessions. The first ·session will be unique and somewhat daring com- open to any students and faculty mittee on campus. If successful, members who wish to offer comthis committee will provide an op- ments to the board. Students should portunity for any student to openly be aware thaLif they wish to appear or confidentially voice a comment. before the board with a gripe but do suggestion, or grievance concern- not want their identity disclosed, they may do this. Also, the format ing any aspect of Wilkes College. The need for such a board was is not limited to matters concerning first articulated by Dr. Howard faculty and curriculum alone. The Williams, chairman of the Com- _meeting will then be closed to board merce and Finance Department, members only, at which time they who feels there is presently no ade- will discuss the comments. One week after the meeting, the ·quate forum for students to convey suggestions or gripes to the faculty comments will be reported to Dr. and administration. Many students, Williams, who will act as a liason protecting their own interests. will between the SAB and the faculty . be either silent about their Dr. Williams' responsibility of grievance or unwilling to carry such a matter any further than the door of a department chairman. Consequently, many problems go unsolved. This idea was conveyed by Dr. Williams to several Commerce and Last Thursday, the Senate passed Finance studen_ts, including senior what has been called the single Colleen Gries, yVho organized and most important bill for students in developed the board. and is its · the next five years. The bill , the chairman. Gries will be assisted by Conference Report of the Norm Witco and Bill Kosci_nski, Reauthorization of the Higher senior representatives ; Molly Sam- Education Act, H.R. 5192, · passed mon, junior representative; Kirk the Senate, by the lopsided margin Foreman and Martha Mazzetteli, of 83-6. To become law, the bill sophomore representatives. One needs only President Carter's junior and one freshman are still signature. . ~• needed to meet the repr-esentation The bill contains many items that goal set by the board. The members are of interest to students and was will be proportioned fro m accoun- lobbied hard by Steve Leifman, lobting, business administration, and byist for COPUS . Among the provieconomics majors. sions of the bill are : gradual inThe board's fi rst meeting is ten- crease in the BEOG program from tatively scheduled for Wednesday, $1,800 to $2,600, a gradual increase October 1, at 3:00 in the conference in the _percenta_ge of cost that the room on the fifth floor of Parrish government will pay in the BEOG receiving and acting upon the board's final recommendations will be ,~hared by Professor Joseph Chfmola. · In addition to the Boards' regular functions, they are also planning to survey last year's alumni to find out what benefits they feel they received or were denied at Wilkes. The board feels the graduates will be more willing to offer constructive criticism than most students presently enrolled. The Alumni Office is supplying the names and addresses of the graduates. The board will also place a suggestion box on the 5th floor of Parrish Hall. John f<'inn Bill Aidi~g Students Passed By US Senate ll Horse Ale... the adventurous ale. The 12-Horse Ale Adventurer's Award , .\ t~ns•· \ a1 ..:I~_, . 111,1 ,Ii, ,r pl.11,1 · l,11 kn , ,11 I Ii, · hu,1li;dl I, .1111 :--.u, 1.1,11 , 111, h, ·l1wd ~1;11, · In l,11 k,_n.i.: 1., llc ·ld g11;d-. :tnd ·:o . 1 \1 1. t IH•lll[-. , -.111 ; tl,ud1t \\ "PP" " llt i>ll ' lk ·U:t1111 ·-.. l11( ; dl111 .l! 111.11 I., \;pd-.. fut ·· t1J..g ;i! I n '.'-\11t· ··1•. \ T I<. \ \\• ,111,1 11 1, , 1·,1111 1 Ii, · 1• ,1.111 \ ·:11 ... 11, 1 1111 · , 11111111u11pb , ·1· 1111 Wilkes-Barre - Dr. Bradford Kinney; assistant professor of speech at Wilkes College, recently conducted a Speakers' Training Seminar for the United Way's "Loaned Executive Program ." "How to Effectively Use PUblic Speaking in Solicitations," the title of Kinney's talk, dealth with understanding human nature as a basis for utilizing persuasive techniques when approaching potential donors . ( ••••• Live on closed-circuit TV, it's the Holmes and Ali World Heavy Weight Championship. The place is the Kingston Armory. The date is Thursday, ' October 2. The time is 9 p.m. All seats ar.e $20 and tickets are available at the Gallery of Sound, Hottles, Alice A's Disco and at the Kingston Armory. Doors will open at 8 p.m. ••••• Today are Homecoming Queen el.ections and nominations for freshman SG and CC representatives. Elections for SG and CC representatives will be next Thursday, while freshman class officer nominations will be on Thursday, October 9. ••••• Members of the Northeastern Pennsylvania Regional Antique Club of America recently presented a check to Wilkes College in appreciation for , the use of Ralston Field for its annual auto show. This annual presentation is given for use by the grapplers club, which aids the college wrestling program . - 1 , h1 °11t111,,n, . .r- . '/ ' from Genesee - ••••• Rte . 315, Wilkes-Borre Twp . 822-4219 Brewers·of America's best selling ale. . .I Historical Impact Evaluated Home Delivery OPEN 7 DAYS 11-1 Arrow Beer Dist. Co. · ..... Wilkes-Barre Recreation Board will be sponsoring a home garden contest at the Farmers' Market on Public Square today. Ribbons and cash prizes will be awarded to the first three finalists in each category. All con- I testants are requested to bring their entries to the stage area on the Square · by 11 a.m. Judging will start at 11 :30 a.m. and wiull be under the direction of the Luzerne County Agricultural Agency. Competition is open to the public. 125 Academy Street Your Genesee Moster Distributor in Wilkes-Borre is I The Wilkes College l<' aculty Women recently met in the Annette Evans Faculty House and presented the Eleanor Coates Farley Scholarship to Dina Sauer. Ms. Casimir Tyburski, scholarship chairman and Mrs. Gerald Wuori, past president of the group, awarded the scholarship. The scholarship is given annually by the club to a Wilkes student. · · Januzzi's Pizza and Hoagies ri\~Ale , ••••• How about a blast from the past? Well , Wilkes-Barre's newes. - restaurant, the Station, is featuring top groups and soloists each Sunday night. This past week the Shirelles, featuring Shirley Alston, performed. This week the Drifters with the origin~! Dock Green will perform in the , Gandy Dancer Room . For. more information, call the Station at 829-9000. Bookancl Record Mart ~c,{ ······ Admissiontestsformedschool (MCAT) and for dental school <DAT) will be given on Saturday, Ocotober 4. Law school admissions (LSAT) will be next Saturday. Registration deadline for the pharmacy college admission test is Friday, October 10. ~ Continued rrom page I. tion, the design of the building allows several trees to be preserved " which enhance the appearance of the intersection of River and Nor"4._.4,-.._◄lf'!I..._........ thampton Streets. The dormitory would be located so that it would not dominate Chesapeake and Delaware Halls which " received national attention in the a.r chitectural press around' the turn of the century.'' 11 S. Main St. Butler Hall is seen as having no Wllk...larre practical value for the college, and the reconstruction of its exterior 800ICS-RECORDS-TAPES which is in poor condition, is seen as ftS-4717 not financially feasible for the colCliff and Monarch Notes lege. The buildings at 76 and 78 West Northampton Street are regarded u,, 111 11 ;1111]-.. .. 1"111 -.. ,.d1111 · p1, ·,, 111t ·1I In \I, ·. <~, ·11, ·-..n · I:! ll,,r,1 · \le · L ,1wn1·11,1· \ , 1,1 1 li, ·\01111 program from 50 percent.to 70 per-cent, a raise on the ceiling on the National Direct Student Loan (NDSL ) from $5,000 to $10,000 and a raise on the ceiling on the Guaranteed Student Loan from $7,500 to$12,500. There is also a grace period of six months past graduation before these loans must be repaid. This bill does, however, call for an increase in the interest rates charged on these loans. Interest rates on the NDSL was raised from 3 percent to 4 percent, while the GSL jumped from 7 percent to 9 percent. One other major point for students in this legislation is an article that prohil>its the payment of sub-minimum wages' to students on College Work-Study programs On the whole, this bill is probably one of the best things that will come out of Congress for students in recent Y.ears. COPUS played a role in making it possible and we hope to be able to continue working in this capacity. But, we can't do it alone. If you are interested in joining COPUS, we meet every Tuesday at 4:30p.m. in the COPUS office on the second floor of Weckesser Hall. New members are ,always welcome. seGco_ n Bits as · inefficient for use as dormitories, and if they were preserv- . ed~ the college would not be able to develop the River Street frontage successfully. The conclusions of the committee are that the removal of the buildings in question will not have a negative impact upon the character of the historic district and the committee felt that they are " not worthy of inclusion in any historic property r,:egistration program." Also, "The construction of a new building of the form proposed by the college will enhance the architectural character of the area in question." In addition, "the block of West Northampton Street between River and Franklin Streets should be deleted in the River Jtreet Historic· District Inventory of Historic Places. Louis Czachor Nomination for Freshman Student Government representatives and Commuter .Council representatives will be held today in Stark Learning Center room IOI at II: 30 a.m. Those interested in the positions are reminded that they must present a written statement of intent ,and a petition containing 50 signatures for SG positions and 30 signatures for CC positions. �Page 8, The Beacon, October ~.)980 (\stronorrier Arthur R. Upgren To Present Lectures Oct. 9, 10 New Ca-paign Rule• ✓ I. All persons who wish to be candidates for any office in a Student Government supervised election, must get 50 signatures, l.D. numbers and telephone numbers, from members of his or her class. CC reps must get 30 signatures. In order to be nominated the presidents of Student Government, Commuter Council, and Inter-Residence Hall Council, must receive 200, 100, and 100 signatures respectively. Every candidate must present a written statement of intent as well as signature petitions when being nominated. · three lectures, two of which are recommended to the general public and the third will be at a somewhat more techinical level. The first lecture on Thursday evening at 8 p.m. is entitled "Light Pollution : The Artificial Illumination of ·the Night Sky." This pro- · blem has plagued amateurs an(j professionals alike but serious studies of the subject are few . Professor Upgren must be numbered among the few contributors to the field. The lecture will be presented in Stark Learning Center, Room 1, at 8 p.m. All interested persons are invited to attend. The ~ond lecture will be given at 11 a.m. Friday, October 10, in SLC 166. "New Discoveries Among the Planets From Space Exploration" will feature some spectaculr slides and is intended for a general audience. The public is invited to attend. There are no prerequisi~s. save a livley curiousity. . At 3 p.m. Friday, October 10, the third lecture, "Distances to the Stars" will be presented in SLC l. This should be of special interest to students of the sciences and engineering, if Professor Upgren is persuaded to explain the detials of the methods of determining stellar distances. Professor Upgren is a native of Minneapolis, Minnesota. He receiv. ed the baccalaureate degree from Minnesota in 1955, the masters degree from Michgan in 1958 and the Ph.D. degree from Case in 1961. Following the receipt of the doctoral degree he spent two years as research associate at the Sproul Obvservatory, Swarthmore: His next post was at the United States Nav,al Observatory in Washington, D.C. from whence he moved to his present location, first as acting director and now director of the Van Vleck Observatory and chariman of the astronomy department at Wesleyan Univeristy. While on campus Dr. Upgren will use SLC 441b when he is not lecturing. Students are encouraged to call on DR. Upgren in his office. Riot Brealcs Out·· At Rocle Concert SPECIAL NOTICE Happy Birthday, Dr. Fahmy, from your two favorite students at Wilkes College. Dr. Arthur R. Upgren, director of the Van Vleck ' Observatory, Wesleyan University, will be on 1 campus Thursday afternoon and Friday, October 9 and ~o. Dr, Upgren is a Harlow Shapley visiting lecturer, one of a select band of astronomers chosen by the American Astronomic.al Society to represent the profession to colleges and the public. The name Harlow Shapley belonged to one of the grea( 20th century astronomers whose ~ research did for man's place in the Milky Way what Cop~rnicus had done for man's place in the solar system. The astronomical society seeks to honor -shapley's memory by selecting woryhy men to perpetuate his efoorts in public education. Dr. Upgren's visit is cosponsoroed by the department of physics, of earth and environmental sciences and the Sigma Xi Club of Wilk~s College. During his stay at Wilkes College, Dr. Upgren will be available to consult with students and will deliver II. HOW TO CAMPAIGN A. General Rules 1. Any candidate may use a maximum of $25 on their campaign. Presidents of Student Government, C.C., and IRHC shall be allowed a maximum of $50. Campaign monies must be funded by_that candidate and funds may not be contributions from supporting groups. All receipts must be turned into the Student Government office 48 hours ·before the election. Receipts must indicate phone number and supplier of materials. , 2. All campaign materials must besigne·d and dated by the candidate in the lower right hand corner (on the front) before the materi._al is posted. All candidates must submit a copy of "their signatures at nominations to the Governmental Affairs Committee prior to po~ting any campaiF materials. Any unsigned materials will be removed by Student Government members and/or the governmental affairs committee members and taken to the S.G. office, where they may be claimed. Any exception to this rule must be presented to the Governmental Affairs Committee. 3. No candidate shall use any Wilkes College activity posters, used or unused, front or back, for campaign purposes. 4. No campaign materials may exceed 14" by 22". No campaign materials from any one candidate may take up more than 10 per cent of any one bulletin board. 5. Campaign materials affixed to trees may only be tied or taped. No campaign materials shall be nailed, thumbtacked, or stapled to trees. 6. No "off campus" campaigning will be allowed. "Off-campus" shall be defined as the river-common, city-owned property, and non-college owned property. An exception is ade for the tree-lawn area adjacent to college property. · 7. No candidate shall post more than one sheet and banner on campus. 1 Ill. PUBLIC FORUM 1. Each candidate for presidential electiQns is required to make a statement of platform at an organized public forum . While rock was being played on During the riot, bottles, rocks, the inside, rocks were being thrown bricks, and other objects were 1. No candidate shall remove or deface an oponent's campaign on the outside. That'1'"how one could thrown. Kingston Armory sustainmaterials. No candidate shall encourage others to remove or deface an explain the riot that broke out ed some minor property damage as opponent's campaign materials. No campaign materials of any one Thursday night, shortly after 8:30 did another business in the area. An candidate may cover that of another candidate. p.m. at the Kingston Armory while automobile dealership, Motor 2. No campaigning, soliciting or loitering shall be permtted within a the group, Blue Oyster Cult, was Twins on Market Street, reported 30-foot radius of the ballot box. This includes the candiate, his or her coperforming. t.hat a windshield of one of i~s cars workers, or any campaign materials. No campaign material visible According to Ronald Labatch, was broken. In addition, a newscar from the ballot box ewill be permitted during an election. news coordinator for WCLH Local from WDAU-TV, Channel 22 was V. GRIEVANCE PROCEDURE AND RECOURSE News, "the riot occurred when a overturned on West Market Street. 1. Violators' nominations for any office will not be accpeted for a group of people tried to crash the Lt. Col. Stanley ·smith, Comperiod of one term. One term of office shall extend for the academic gate to get into the concert. They manding Officer of the 109th Field year. didn't have any tickets and the 18 or Artille,ry · Battalion noted in the 2. If any candidate wishes to contest an election, he or she must do so so security guards were unable to Citizen's Voice that "the future before noon of the day following the election. All cases will be heard and hold the crowd back. " When the looks bleak for concerts here. But decided upon by the governmental affairs committee. The vote on such Northeast Security guards were the matter will rest with the ara decision shall be as soon as possible after the contestment. unable to ·control the crowd, police mory board and headquarters in VI. RUNNING THE ELECTION were called in for assistance. Harrisburg." 1. Ballots from all elections shall be placed in a secure box and shall Responding were police and fy-e Darh;ne Scharte be counted only the govenmental affairs committee. units from the cities of Wilkes 2. No write-in vptes will be recognized. Barre, Kingston, Forty Fort, and 3. Absentee ballots will not be accepted in any election. Edwardsville. State police were 4. Voting in all student government supervised elections will be done also on hand. only with an officially valdiated Wilkes l.D. card. In order to somewhat disperse VII. ELECTION RESULTS the unruly group, local fire depart1. All candidates must remove their campaign materials following an ments turned high pressure water election by noon of the following day. hoses on the people. Tear gas was 2. Election results will not be announced until all campaign materials also used and the city's K-9 corps have been removed. The earliest that the results will be announced was brought in to help. In the scufshall be noon of the day following the election, provided all campaign fle, 20 people were hurt and 41 peomaterials are removed. Results will be posted in Stark Lobby, Housing ple were arrested. Of those arOffice, Student Cent~r, library, Student Government Office, and Parrested, 22 were - juveniles. Road rish Hall. manager for Blue Oyster Cult, VIII. REGULATIONS FOR ALL CAMPUS BUILDINGS Steven L. Schenck, was one of the 1. No campaign materials shall be posted on walls, doors, or glass arrested. Hearings for those arsurfaces. Campaign materials may be posted on any bulletin board in · rested-will be sometime this week. the buildings. All campaign material that is posted elsewhere will be removed by the employees of that building and returned to student - •••••••••••••••••♦ government. • • ♦ IV. CAMPAIGN ETHICS . NOTICE Help Needed Immediately! The Sordoni Art Gallery is looking for two strong male students to help with the Gallery installations. Must qualify for the College work-study program. See Cara Berryman in the Gallery office. r--------iiii--•--• SHAI■ allC SALON Men's and Women's holr 1tyllnt manlcurN and~• 15S.~St. ........,.Po. I\) ....,, --.L _i1Jr Ix. BULLETIN BoARDs l. All bulletin boards are under . the jurisdiction of the associate dean of student affairs and the student government publicity committee. X. Any violations of the above guidelines shall be reason to declare an election invalid by a majority decision ofthe governmental affairs committee. · Campaign Suggestions A. All candidates are encouraged to have at least one CAMPAIGN MANAGER. Campaign managers may help with the campaign, but may not substitute for candidate. B. Each candidate is encouraged to seek organizd \ upport from a delegation of students led by the campaign manager. Support may not include financial contributions. 1.,,;;;;_;;;;,;.;.;,;;,;;;,;,;.;;,;,;,;.,;,;;,;;.;;;,;;,;;.;;;;;;.;,;;;;,;_______________ : ♦ ♦ ♦ ♦ ♦ EasfW1 ng • • ♦ 41 S. Main St. , W-8 •♦ We hove a great selection of In- ♦ dian tops , skirts, dresses and ♦ bedspreads ., ♦ Also leather handbags : and . · ♦ Landlo.1bber Jeans. ♦ All at reasonable prices ♦ ♦ Come in an see US• ♦ ♦ ♦ ♦ d ·I ♦ f ••••••••••••••••♦ , I (JIJITI fl ll fl flfli~ r.r1[1 .SIJSifilll~ See Bob,Jobn,and Mike MON.-THURS. 11 A.M .-9 P.M. TUES., WED. FRI. & SAT. 11 :00 A.M.-5:30 P.M. 288-3751 0 ,Z �October 2, 1980, The Beacon, Page !I lt -SPORTS .. ' Atht~te 01 The Week. Blue And Gold Falls To 0-2; Meets Upsala On Saturday The Wilkes College Soccer team "zoomed" past crosstown rival King's College on Saturday at Ralston field by a score of 4-2. A large crowd was on hand to see the contest, and Dung Chi Duong rose to the occasion as he was involved in every goal the Colonels tallied . "Zumi," as he is otherwise referred to, scored two goals and had two veryimprssive assists. His outstanding offensive display has earned him Beacon "Athlete of the Week." Zumi, from Los ·Anegles, Calfironia, is a Viet Nam refugee who was forced to leave his hometown of Saigon because of the communist take -11ver in 1974. He came to Wilkes-Barre originally, and attended Bishop Hoban High School, where he graduated in 1977. Later that year, Zumi 's family moved to Los Angeles. However, Zumi loved Wilkes-Barre so much that he decided to attend Wilkes College. When asked how he originally became interested in soccer, Zumi expalined, "I played soccer in Viet Nam since I was a little boy.Soccer is the national sprt in Viet Nam, just like baseball is in the U.S.A." When he attended Bishop Hoban he couldn't play soccer because the school didn't have a soccer program . However, when he came to Wilkes he picked up where he left off in Viet Nam . Zumi was named "Zumi" captain of the soccer team for this year, his final year at Wilkes . " I am really happy I have been named Athlete of the Week and I would like to thank the rest of the team for helping me get this award. The most important thing to me is not the award, it is the victory over King's." Zumi went on to explain that the team was really up for the game and emphasized the importance of winning the game against King's because, "This will bring more school pride to Wilkes College." Although Zumi has had some trying times in his life, it seems he has adjusted well to the American way of life. The Beacon sports staff wishes Zumi congratulations, not only because he is an outstanding athlete, but because he is an outstanding person as well . 4 44 Senior Rick Burd set a school record - 294 yards and five touchdowns - in leading the undefeated Lycoming Warriors to a 40-0 thrashing of the Colconels at Ralston Field before a good Parent's Day crowd. Burd, a 6'3", 195-pound senior from Lock Haven, connected on 12 of 20, attempts, including two longbomb passes to his brother, junior Mike Burd, before leaving the game late in the third quarter. After a scoreless first quarter, Lycoming got on the board ·with their first score of the afternoon when Burd (Rick) hit Burd (Mike) for a 65-yard touchdown strike. Freshman Lance Spitler added the first of four extra points to put the , Warriors ahead 7-0. Lycoming's second score of the day came with 2: 39 left in the second quarter when Burd hit sophomore wide receiver Jeff Wert on a 23-yard T.D. pass to cap an 81yard scoring drive. Spitler's PAT made the score 14-0 which is how the first half ended. With only 2: 11 gone in the third quarter, Burd connected with Wert for a four-yard touchdown, which all but closed the door on the Colonel 's hopes for a home opener victory. At 9: 15 in the quarter, Burd hit brother Mike with a 77-yard T.D. .QB Hall On The Move bomb. Spitler's PAT logged the score at 27-0 in favor of the Warriors . Burd ended his recordsetting performance with a 10-yard T.D. pass to Wert with 3:22 left in the third quarter. Burd's replacement, Pete Waldron, ended Lycoming's scoring on the day when he threw a 21-yard T.D. pass to frehsinan John Betz with 2: 12 left in the game. Women's Tennis Team Falls To Three Division II Powers · Imagine yourself trying to long jump fifty feet, run a three minute mile and swim the entire length of the Susquehanna River. This was how the Wilkes women's tennis team felt when they had to play three Division two schools this past week . Talk about the agony of defeat! Wilkes lost three straight matches by the score of 9-0. If you think that's bad, wait until you see what happens when Wilkes has to face Bloomsburg this week. Many people say the Dallas Cowboys have a tough schedule, but they have yet to hear the agenda of the Wilkes women's tennis team . When the Colonelettes discover that they had to play five Division two schools in a row, they knew they were in trouble. These schools do not contain your ordinary " Hackers Haven'' tennis teams. They work all hours recruiting top high school players and spend countless hours practicing throughout the school year. For ~ ARMY & NAVY 113 South Main St. Downtown Wilkes-Barre ~ :Doilyl0..-.-5:JD,.M. - - I l'llon. 10..ftl.•fp.• aAfnl.i:1 ... Wt'., lll•CIOIDUIOY -PLUS. UIIY PAIIII PAIN1II PAIIIS f.AIIIII JWII RIUllilffl ...... ,..At ..,...,,,._ RAIIB INIIIS their first fun day of tennis, Wilkes took the road against Scranton University. The Royals showed no sympathy in handing the Colonelettes their first 9-0 loss. There was one bright spot in the match. Number one seed Cathy Price stunned the Scranton team by taking a set off their best player 2-6, 6-4, 4-6. The blue and gold then hosted another excellent team in Lock Haven State. Lock Haven was an all-freshman team that trounced Wilkes 9-0. Another sparkling performance by Cathy Price made the loss somewhat respectable. Price fought hard in losing a marathon 57, 7-5, 2-6 battle. East Stroudsburg invaded Wilkes-Barre on Monday led by former Wilkes standout Laura Canfield. The Colonelettes won a grand total of four games in singles and ·doubles compared to . 108 for Stroudsburg. The fun is not yet over for the Wilkes " netters." This week they will travel to Bloomsburg State and today will host Scranton University. Bloomsburg is one of the toughest Division II schools in the · country and Wilkes will need a miracle to beat them. It's tough to say how the team will do the re.mainder of the season. Their schedule is much easier after the Scranton match. Coach Snee has held extra practice sessions most of the year and her players are. looking forward to playing team:. that they can compete with . . Bob Buchi1baum The Colonels' closes chance to score came in the first quarter of play when they had a first and goal from the Warrior's one-yard line. This field position came about when freshman George Hall hit junior Tony Madden with a 27-yard pass from the Warriors' 32-yard line after a shanked Lycoming punt. But the Warriors' defensive line toughened up and denied the Blue and Gold a score by stopping four consecutive running plays out of the I-backfield. Lycoming had a total 557 yards total offense compared to the Colonels' 181. The colonels will carry an 0-2 record into next week's game against Upsala at East Orange, New Jersey. Upsala is also looking for their first win of the season next week, with a 0-2-1 record. Last year, the Blue and Gold beat the Vikings by a score of 20-3. FOR YOUR INFORMATION : Lycoming had a combined 369 yards through the air for six touchdowns and no interceptions, compared to the Colonels' 109 yards and three interceptions ... Carmen "Homer" LoPresto led all Wilkes rushers with 19 carries for 49 tough . yards .. .The Blue and Gold's defensive line and linebackers did another good job in shutting_off the opponents' ground game ...Rick Burd connected at will against the Colonels' secondary, but then again, whose secondary doesn't Burd connect against at will? ...Jerry Goss looked impressive at quarterback and if coach Schmidt options to use Goss as QB, .George Hall could be a BIG heir in the defensive backfield ...Tony Madden had a number of good matches in the game and is one of the better Coolonel receivers in recent years ... Anyone wishing to get incontact with Eddie White (Colonel Sports Information Director) may do so at his new extension, 444. Pete Steve �Page 10, The Beacon, October 2, 1980 Cross Country Gains Victory After losing two straight, the Wilkes College Colonels crosscountry team got back on the winning track with a big victory as they edged Philadelphia Pharmacy, 2729, in the 1980 home opener_ Ken Pascoe, last year's team MVP, looks again to be this year's MVP. Ken took first with--a winning time of 34:00 over the 10 kilometer (6.2 mile) course at Kirby Park. Dan Thomas followed in the runnerup slot at 34:39. Philadelphia Pharmacy took the next three spots with Ken Kondracki, formerly of Nanticoke High School, taking thrid with 34:58; Mark Scholl, fqurth at 35:28 ; and Jim Rodgers, fifth at 35 :37. Ed Eppler (35:46) and Neil Pascoe (35:54) followed with sixth and seventh, respect'tvely. Jim Bell finished 11th at 36:46, but it was a key 11th as he outkicked Phiadelphia Pharmacy's Mike Wolfe in the last 150 yards which enabled the Colonels to win the meet. Other Colonel runners were John Supinski, 38 :40; John Dill, 38 : 57; and Mike Tsivina, 43: 00. Coach Righter commented after the meet, "I'm very pleased. The guys ran with all their heart. They knew how important this meet was to them . Philadelphia Pharmacy was 5-0 after defeating Division 2 power Philadelphia Textile. Dan Thomas performed admirably and Neil Pascoe is beginning to mature as a freshman ." The harriers, now 3-2, were to have hosted Muhlenberg and Scranton on Wednesday, and then play host to Baptist Bible and PhiladelphiaTextileSaturday. Rich Nordheim Sports Calendar OCTOBER3 Field Hockey Bloomsburg(Away) OCTOBER4 Football-Upsala (Away> Soccer-Lycoming (Away l Volleyball-Moravian( Home) W. Tennis-Bapti!it Bible( Home) OCTOBER 7 Field Hockey-Delaware Valley(Away) Volleyball-Delaware Valey( Away> W. Tennis-Upsala(Home) OCTOBERS Soccer-Juniata (Away) Cross Country-Lebanon Valley(Away) OCTOBER9 Field Hockey-Marywood(Away) Volleyball-Misericordia <Home> - W. Tennis-Marywood(Away) Homecoming-Bonfire and Pep Rally at Ralston Field. NOTICE The Coalition of Independent College and University Students (COPUS-Wilkes) will meet onTuesday at 4:30 p.m. in the COPUS office (located on the second floor of WeckesserHall). • • • • •... NOTICE The volleyball game scheduled for Thursday, October 2, at King's will be played at Wilkes. The game against Baptist Bible scheduled for Monday, October 20, has been rescheduled for Tuesday, October 21. 111111111111••••• NOTICE WANTED! Manager for the wrestling team. Any freshman or sophomore interested is asked to contact the Coach John Reese in the Athletic Department, Weckesser Annex. I Skeletons Most of us thought the career of a sports legend had come to an end on September 15 of 1978. In November of that same year the Beacon carried an article entitled, "Requiem for the Heavyweight," which I hoped would stand as a pugilistic obituary for one of the greatest boxers of all time. It is now fall of 1980 and as All Saints Day approaches, the skeletons are coming out of the closet early, very early. The skeleton I am referring to emerged ~arty this summer covered with 252 pounds of brown flesh. Maybe it was the smell of the "long green" Bob Arum produced, the urge to hear crows diatonicaly chant his name, or the bogus feeling one gets from making too many cockroach killer commercials that compelled him to seek his crown again. The axact cause may never be known. Po w, - What is known is this: Cassius Clay, Cassius X, Muhammed Ali, the Black Superman, is back. _ It has been 20 years since the Rome Olympics in 1960, 16 years since the Sonny Liston fight in Lewistown, Maine in 1964, 13 years since his suspension from boxing and subsequent imprisonment in 1967, five year s since the third and final Frazier fight in 1975, and two years since Ali-Spinks 11, in all, Muhammed Ali's boxing career has been longer than this writer's life. Ali's career has spanned the civil rights movement, the -Vietnam War, the peace-love Woodstock generation, the deaths of Malcolm X and Marti'! Luther King, the From Tlae Closet political demise of Richard M. Nixlimit of what an individual can enon, the boxing ends of Floyd Patterdure. What that limit is will be son, Jimmy Ellis, Jerrey Quarry, ofund out after tonight.. . Joe Frazier, Ron Lyle, George Foreman, Jimmy Young, Duane Bobeck and Ken Norton, to name only a few. Stealing a line fron the Grateful Dead, "What a long strange trip it's been." In 197.0, Muhammed Ali said, "When you can whip every man in - the world you just never know peace." Considering the fact that tonight Ali will step into the ring, to face his ex-sparring partner, Larry Holmes, the quote becomes a textbook example of irony. Could it be - ,,. that Ali has neverknown peace and , __ ✓< never will. When the Brown ,.- ,,.Bomber Joe Louis was asked how , /, ~ , ,,..1/ good he thought Ali : s , ~ - ✓-Y, , / , /' j _ , I: ,__. ,. - ....--:,_- ~ :' - ---- - .~ : ,- - - = . _.,;· , / -- /) - replied, " I don 't think anybody will ever know how good he is. Tllere's nobody around to test him." To find peace, all heroes test themselves. Ali has already tested Christianity with his conversion from its Cross to Isla m's Crescent. He has tested tjie establishment. When it asked him to go to Viet Nam, he replied, "They can get themselves another nigger. 'Cause every day they die in Viet Nam for nothing. I might as well stay here and live and die for something. " Tonight Ali will test things he may not be able to overcome - time and himself. Just as the sport of boxing exists as a limit of the authorized savagery a society will permit, so will Ali stand as a I - --r, . 'Ali' Like Achilles poised at the Gates of Troy, So stands Ali, and he ain't no boy . Goin' out and whoopin' fate, Might not be worth the gate. Better make Larry kneel. Or he'll be the arrow in your heel. Stan Ray Record Nou, At 1-2• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Lopez Smiling After Booters De/eat Bia,al King's 4 - 2 Coach Ernesto Lopez had much to smile about this weekend. In a dazzling display of teamwork and talent, the Wilkes soccer team trounced arch rivals King's College by the score of 4-2. The game was not only action-packed but was also filled with emotion. Both Wilkes and King's had a sizeable number of fans, and each team was obviously out to win at all costs. Wilkes proved to be the better team. Twenty minutes into the first half, Zumi collected a pass from the left and sent a sizzler past the King's goalkeeper. That goal did the trick. Before the goal, it had seemed that the two teams were evenly balanced and whichever emerged as the victor would just be the lucky one. But hardly fifteen minutes after that goal, Zumi sent in the second one and from then on, it weas obvious who the victor would be. The second half was even more action-packed than th~ first. The King's team was out to upset Wilkes, and the Colonels were out to hold the lead. For a while it seemed as if the former would achieve their aims. Early in the second half, they scored their first goal. But even before their fans had stopped cheering, Carlos at right wing collected a pass and sent the ball screaming into the goal mouth. With the score at 3-1, King's began to use rough tactics, knocking a few Wilkes players down with alarming frequency. This almost started ·a fight and only the coaches' intervention avoided it. With tempers still charged, King's scored their second goal, bringing the score to 3-2, but again it was as if Wilkes had deliberately planned to give them a whiff of the sweet scent of victory and then suddenly take it away. Tony at the left wing beat a King's deftnder and shot the fourth goal in. Nothing could have saved King's after that. Wilkes kept up a constant series of attacks which had the spectators , wild. When-the final whistle blew it was happy pandemonium amongst the Wilkes players. The record now stands at 1-2, and with the same quality of play seen on Saturday. many other opponents might find • themselves in a tight corner. 1 Anthony D. Sibiya Your College Student Discount Card is now available for you to pick up at Bartikowsky Jewelers Catalog Showroom 141 South Main St. Wilkes-Barre 10% DISCQuNJ Please show your college I.D. Card You can also have our new 1981 Catalogue upon request. Discount cards are also available at the Beacon Office, 2nd Floor, Parrish 'Holl Plenty of Store Side Free-Parking I r I I �October 2, 1980, The Bea co~. Page 11 ~ Memory Lane ij~r~wo I. Name the professional team , with the most retired numbers, name the players and the names they wore. 2. Na me th ree professiona l sports teams (excluding soccer) whose name doesn't end with the letter " s." 3. Who was the only heavyweight champion never to win a championship fight '! . 4. Who holds the NFL record for most fumble recoveries in career? 5. Who holds the NFL record for most points in a.season? Bowling Re-ults Chuck Robbins ... 0 Intramural Flag Football Report I - - ---- z MIDTOWN PIZZA c.. Q We have specialties such as: ~ Stromboli, Calzone, S•usage Roll and Parmigiana Turnovers Buy a large pie for with this ~ = < ~ $4.35 and receive a < > small pie FREE. -~ ~ t>'f ?£.1 £., I never thought I ,would see the day that a professional athlete would b placed in the same category as a common crimina1 because- of hi agressiveness in a sport, but that day has app::trently arrived. In the September 25th issue of the Wilkes-Barre "Times Leader," an arti cle by Associated Press Sports writer Tom Seppy was published dealin with the House Judiciary Committee's crime subcommittee's hearing o violence in professional sports. The subcommittee was scheduled to discuss a bill proposed by Rep. Ronald Mott! (D-Ohio) which would declare it a federal crime for profes sional athletes to parti~ipate in extra-ordinary forms of violence during sporting event. · Listed to appear before the subcommittee were the commissioners of al major professional sports, former hockey player Henry Boucha, and tw academicians. Apparently, the commissioners were supposed to represen · 1r.1.1 > ~unuJoH 1ned ·s the sentiments of their respective leagues, Boucha was there to render a m:) smnna 'IJ'!O ·t actual account of violence in sports, and the academicians would report th ·saWJOH AJJl?'J Ol .lll!l .ll(l JO scientific facts behind " man's drive toward violence." asuaJap lSi!J SJI( lSOI .ll( pue WJI( Ol The irony behind this whole situation is the so-called authorities th The sports department is proud to annou~ce ~hat la~t week's. me~~ry U.)AJ~ Sl?M .lll!l 31(.(,"'UOlJON uax '& subocmmittee has scheduled to appear before them . Granted, Boucha ha photo has been identified. The Veterans Office m Parrish llall 1dentif1ed xos .llJl(M O~l?JJI(:) experienced a vicious attack in sports and could deliver an accurate ac No. 25 as Ed Davjs, while Athletic Director John Heese and Dean Arthur xos pa11 uoiso9 count of the consequences of such an attack. But this is all he can deliver. I Hoover identified both Davis:and Al Nicholas as the " Mystery athletes" in zzer sueaJJO MaN ·z would be one specific player's opinion on one specific incident. the photo. Congratulations to both the Vets.Mr. Heese and Dea n Hoover on The academicians, the subcommittee has requested to ippear, ca their correct responses. It is hoped more people will follow the example pJOj A.ll!lfM 91 'ON without a doubt provide valuable scientific information on huma they have set. GET INVOLVED!!! uosunw Ul?WJDl(J, SI 'ON behavior, but will this information cover the behavior of every player, th anuew A.ll(J!W L 'ON violence intensity of every sport, and the specific characteristics of each Ol~~l?WIQ aor s 'ON situation which may arise concerning violent attacks? . ~!Jlf.l 9 no'} t 'ON The final group of " authorities" the subcommittee will listen to is th l(lnH aqe9 & 'ON group of commissioners from every major professional sport. To me, thi They lost two, while Gary Mitchal Last Friday night, Poky's bowled : saa'lue A '!JO A Ma N aq.1, · I is the most ironic "authority" the subcommittee can ask to appear. rolled a 190 and Greg Price stroked in their usually graceful style with These men are the very ones who allowed violence to " get out of hand" in a 200. Other high scores are : Steve . .- - - - . . -...-------.ic,professional sports in the first place. These men who will undoubtedly sa Kathy Kulp stroking a 169 and Jon Levitski, 209 ; Sandy Cole man, 167 ; Pliskin rolling a 193. Stan Ray, of that they are in favor of eliminating violence from their supposedly well and Bill Petrick. 205! Decaying Human Flesh, rolled a organized sports, are the same men who were blind to the in crease in We are still looking for new 200 and 203 in• vain. His team lost violence in their sports over the past ten years. _ members. Bowling is a lot of fun . those two games. On the brighter It is the commissioners who bad the opportunities to curb the amount o Why not go to ·the alleys every Friside, the 752 Crew breezed by. winnviolence in sports early. in its " snow-balling" history, and elected to be igday at 4:00? We are not looking {or ing all three. Jack Kijek, the team norant of the severity of violent attacks. They permitted the " physical t people who are super fantastic · captain bowled a 202. No Names players" to continue their overly agressive ways of playing reportedly fo bowlers,J~st people who are willing have run into a bit ' of hard luck. the growth and betterment of the sport. But no matter what these and able"'to have a good time. For gentlemen fed to the general public, it was not long after that everyone info or to be placed on a team, con- -knew the real reason violence was allowed to continue was because of that Results : tact Robbie Bale Qn Ext. 112. always influential element, innoey ! ' Chicken Hawks - 19 It is an unwritten law that man enjoys to see physical and material Grissom-0 SPORTING GOODS TEAM STANDINGS : violence take place. Like one of his basic drives, violence is bred in the Falcons 8-1 COMPAN-Y mind of every man, woman, and child. Playing upon this element, the comStuds-33 The Aristocrats 7-2 We Accept Milster missioners allowed incidents of violenc~ to occur in exchange for higher ' Hotel-0 Poky's 7-2 Chilrge ilnd Visil gate returns. 752Crew 7-2 39 West Market Street Although it is the players who perform the violent attacks, why should Chicken Hawks - -22 The Force 6-3 Wilkes-Barre, Pa. 19701 they suffer the penalties ,of legal prosecution because· of something the Dirksen-0 The Rogas Squad -1-5 Phone: 822-1333 ' governing bodies of the sports fail to prohibit, and in many instances enAvengers 3--6 Next Week's Games : courage. Many of the " physical players" are not as talented as their teamFree Pdrlcing ill Hotel Sterling Genni Cream Ale 3-6 Oct. 6 - Chicken Hawks vs. Hotel mates and are only on the team bec;mse of their aggression. It is wrong for PJ.Burke 'H Decaying Human Flesh .,.7 - 4p.m. a person to try to earn a living at· the only .thing he knows how tp do best, Proprietor No Names2-i especially when it is encouraged by those who are supposd to " know bet-- -ter? " · ' Dr. Driscoll's Diplomats 2-7 Oct. 7 - Grissom vs. Extras - 4 p.m. My answer to this question has to be no ! I agree that violence should be eliminated from sports as soon as possible. We have no need for elbows in Oct. 8 - Studs vs. Dirksen - 4 p.m. the face, sticks over the head, baseballs speeding at the back, or tackle~ which end an opponents career. But the solution to the problem is not t Oct. 9 - WCLH vs. Grissom - 4 throw every athlete who looses his temper in1 he heat of competition int New York Style Pizza 0 p.m. jail. The solution lies in the "educating" of the commissioners of eac ~ We featue Sicilian style phza squares. sport, who ironically will be passing judgement on the future of " physical" ~ Oct. 10- Extras vs. Studs - 4 p.m. serve salads. hot platters and athletes. This situation is so vicious and yet so ironic, it makes one want t • ~ !au h into tears! · cold or hot boagies. 0 Answers - •· SXr~A \~t" Hours: 10:00 a.m . to 9:00 p.m. Sat. 10:00a.m. to6:00p1m. coupon < > > t:= -~ t:rl (":l 0 ~ ~ 0 41 South Main Street PHONE 829-7740 ,I , Expiration Date 10-1-eo. 2! DECKOU R'S BEER Acros$ from Bishop Hoban Ph. 122-7045 -lmportecl ......_ -Cold-rCo/1 in Advance for Kegs and Quartets (Must have LCB Card) �/ .• Vol. XXXIII, No. 5 October 2, 1980 F_ALL TIME GREETING - Ne faces on ompus are welcomed t Wilkes by the famous and preditica~le Weiss window. � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 October 2nd Date A point or period of time associated with an event in the lifecycle of the resource 1980 October 2 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/d6a03a3c71c9eecbd0ce05cbc2451f0a.pdf b2e1efd667b3f6b145ad237056444933 PDF Text Text N,e w Residence Hall ·Possible For College If financing can be arranged, there may be a new residence hall at the college in the near future. College President Robert S. Capin explained that the Board of Trustees has authorized proceeding with building a new residence hall if , Housing and Urban Development · (HUD) financing can be arranged along with financing other than conventional borrowing. Dean of Management Andrew Shaw noted that the college has applied for HUD loans the last several years, but the requests were not apTHREE LITTLE INDIANS - Chesapeake, Shawnee and Delaware Halls • proved. The most recent applicaare also included in the demolition project to build the new dormitory. tion has been approved by HUD on a regional level and is scheduled to be reviewed for national approval. The college should receive some indication by the end of October as to whether the request is approved. The money received from HUD would not, however, be enough to build the proposed $3.5 milion to $4 million residence hall. The remainder of the financing would Plans to raze three buildings to The Wyoming Historical and have to come from other sources make way' for a proposed residence Geoogical Society, the local tiall have been delayed because of a historical society, has applied for a such as the state building authority, possible historic designation for the historic designation for several of conventional borrowing, contribubuidings. the buildings on campus, including tions, or a combination of any or all those on South River Street and of these. Shaw commented that "if Northampton Street where some extremely wealthy individual Tri organizational West the college would like to build a has several million dollars to donate, the college would even connew residence hall. According to College President sider naming the building after Meeting Sla_ted· Robert them." S. Capin, the historical In addition to the problem of finsociety has proposed that there is 1 potential historic significance In the ding proper funding, the college has ForSG, IRHC buildings involved. This means that run into other problems. The new Student Government, Commuter all governmental agencies are building would be located at the Council and the Inter-Residence alerted to examine the environmen- corner of River and Northampton Hall Council will hold a Tri- tal imipact of any new construction Streets, and Butler, Shawnee, and Organizational Meeting on in any neighborhood containing Susquehannock Halls would have to be removed to clear the way for September 28 at 2 p.m. in the An- historically significant buildings. The plans for the new residence construction. However, there is a nette Evans Alumni House. Joe Galli, President of Student hall would include the demolition of problem involving a possible Government, stated that the Butler Hall on South River Street historic designation for those reasons for the meeting are r aried. and Shawnee and Susquehannock buildings and the college has been advised not to touch the buildings at " It is good for the three organiza- Halls on West Northampton Street. this time. (See related story.) tions to meet and get to know each Capin pointed out that these other," he said. Moreover, the buildings could be removed representatives from the individual anyway. As he said, "We are councils rarely get a chance to even masters of our own destiny. We can identify each other. "Hopefully, build or demolish any building we this meeting will allow them that want." He added, however, that chance," Galli continued."This when asking for . financial also makes it easier to call on each assistance the college must meet the reuqirements of the agency givNominations were held this past other for help when it's needed." Thursday for vacant positions in In addition, the meeting gives the ing that assistance. And, one thiog Student Government as well as three councils an opportunity to in- that any agency looks at is the enjunior class presideht and form each other of any plans they vironmental impact. This is the case with the Departtreasurer. might have for the year and forThere are four openings for SG mulate new ones. At this meeting, ment of Housing and Urban representatives- two in the senior Galli hopes to have the three bodies Development <HUD), to which the class and two in the junior class. working together to promote school college has applied for a loan to Cheryl Ann Crea was the only spirit. Other areas of discussion build the new residence hall. · Capin explained that the college person nominated for senior class will include the Colonel mascot, SG representative. Three people Stark regulations, alcohol policy, "has been advised not to raze any of were nominated for the two junior Florida trip, and Christmas carol- the buildings on the site of the planned dorm" at this time. class SG representative positions. ing locations. If the collee did raze the strucThey are Tom Farley, Pam The cost of the meeting is approxSamuelson, and Lisa Warden. imately $300. Each organization tures, it could prejudice HUD's John Keating,· Bob Lashock, and contributes an equal share to cover decision to grant financing. The college is in the process of Bruce Williams were nominated for the expenses. Galli concluded that the office of junior class president all representatives are required to trying to solve this problem and is hoping for a solution soon. and Sue P,.almer and Chuck Sherattend the meeting. Louis Czachor man were nominated for junior . Patti Sparlow · Historicaf Buildings Could Delay Dorm Originally the college had hoped to break ground this fall and have the building close to completion by next fall, but that was before these delays came up. As alreadY- stated, the building, including furnishings, would cost between $3.5 and $4 million dollars. According to Shaw, the tentative plans call for a building that is "designed to provide continuity with some of the older buildings." It would be a four-story brick building and it would be L-shaped. Delaware and Chesapeake . Halls would remain standing but could be removed If expansion of the new building was deemed necessary. The first floor of the building would contain lobbies and lounges, an office and mallroom, a television room, places for bike and luggage storage, and an apartment for housing personnel. The other three floors would house approximately 200 students in suites for three or four people. A three-bed suite includes a room for one student and a room for two students, connected by a bathroom shared by the students in both rooms. The four bed suite includes two rooms also connected by a bathroom shared by the students in both rooms. Each room would house two students in this case. It is possible that the building would be air conditioned. Also solar collectors may be installed, but the primary heating source would probably be city steam which is generated by coal. President Capin commented that the new residence hall would permit the college to maintain housing of a student body population similar to Its present numbers. Also, the college would be able to vacate the Sterling Hotel, and, " if the total student population should decrease in the 1980's, the new residence hall would provide the flexibility to phase out old, expensive dorms." Another reason given for the need for the new building is that If it is not built, the college would not only lose room and board income, but also tuition. Louis Czachor CC, BUTLER HALL - The former home of the Education Department is one of the buildings set to be demolished to make room for the new residence hall. To Fill Vacant Posts------------------_:_ _______ _ Replacement Nominations Held class treasurer. The three presidential candidates were asked to explain why they want to be president. Their answers are given below. ' John Keating, biology major from Manhattan, New York-"l'm looking forward to a prosperous 1980-81 school year. While formerly being my high school senior class president, and presently being an R.A. here at wilkes, I fel that I could help our junior class by promoting unity and encouraging·participation in planning our many activities." . Bob Lashock, accounting major from Hazelton, Pa.-"I have served on our class executive council, and have worked closely with Stu- dent Government since our freshman year, which gives me the knowledge of both class and Student Government to make our class the best on ca,mpus.My plans for our class include providing for more interesting class sponsored activities, and . a reduction in apathy among class members. I also plan on working very closely with the senior class on providing a Junior-Senior dinner dance which will be unforgettable." :J3ruce Williams, biology major from Montoursville, Pa.-"l am currently a resident hall student in Denison (Old Miner) Hall. Our class (Class of '82) is enthusiastic and we demand quality leadership Continued on page 8 �Page 2, The Beacon, September 25, 1980 New Camp~ign Rules A)Jproved Follo~ing Discussion By SG The main topic of discussion at mittee learned of materials ' used Monday night's student govern- for the campiagn, but for which no ment meeting was the proposed receipts had been turned in, they new campaign rules. These new would take action against the campaign rules had been read at nominee.· Nunez noted, however, meetings the last two weeks and that no rule is foolproof. were to be voted on at Monday As the discussion continued, Colnight's meeting. Before the voting, leen _9ries brought up a question however, SG president Joe Galli about what was wrong with the asked if there was any discussion elections the way they have been. concerning the proposed rules. Brodsky's reply was a suggestion Colleen Gries, speaking as a that in the past too few students had representative of Commuter Coun-· bothered to vote in SG sponsored cil, began the discussion by issuing elections. She reminded the body a complaint concerning proposed that in an election in a class of aprule 2 section A sub-section 1, which proximately 500 people, only about read as follows : 50 vote. Nunez backed this up by " Any candidate may use a max- pointing out that in the last Student imum of $50 on their .campaign. Government presidential election Presidents of Student Government, only about 16 percent of those eligi, CC, and IRHC shall be allowed a ble to vote did so. maximum of $100. Campaign Another point brought out conmonies must be funded by that can- cerned the appearance of posters didate and funds may not be con- and printed materials. Bob tributions from supporting groups. Lashock suggested that the ideas All receipts must be turned "into the should be to make an election more Student Government office 48 hours colorful. Bill Miller commented before the election. Receipts must that handmade posters can be just indicate phone number and · sup- as attractive and colorful as printed plier of materials.'' one. Brodsky reminded everyone Gries pointed out that CC felt that that no one has to use p~inted the $50 maximum should be material if they do not want to. stricken from the rule. The reason · However, they have that option and given was that it felt that the can use printed material to make a average Wilkes student did not semi-professional campaign. have that kind of money to spend on As the discussion neared a close, an election campaign, and, as a Maureen Morrison brought up the result, the elections would be bias- issue of the need for a maximum ed toward students who could af- dollar amount for expenditures for ford those expenditures. campaign materials. She suggested Darlene Schaffer, speaking as a that a person running for office · commuter and member of the stu- ._ should be al~owed to spend as ~uch . dent body; broiight up the fact that as he wishes. Brodsky · again CC had made a unanimous vote that disagreed and stated that the rich the section in question be stricken would be at an advantage. from the record. (See Commuter Finally, Nunez proposed that the Council story.) . rule be changed to read that camCC president Bill Miller then add- paign material shall be handmade, ed that CC felt that the proposed and students have the option of obrules encouraged students to spend taining printed material with the money for printers to prepare exception of mimeographed or ditposters, signs, bumper stickers, toed material. Also, the printed and other printed materials. He ad- material should be of one type. The ded that it was felt that students maximum a candidate may spend should make their own campaign shall be $25. Candidates for materials, and try to involve others presidential offices for SG, cc, and in the production of these IRHC can spend a maximum of $50. materials, and therefore involve Dana Schaffer announced that he students in the campaign and the would like to propose that the proactivities of the college. He noted posal suggested by Nunez be that getting people involved was amended to allow each candidate to the purpose of the new rules in the select two kinds of printed material. first place. SG parliamentarian Ana Nunez To simplify matters Schaffer proposed that the rule be amended withdrew his proposal. Nunez also so that a maximum of $25 would be withdrew her proposal, and then allowed in the general elections, she submitted a new proposal and a maximum of $50 be allowed in which took Schaffer's suggestion inpresidential elections for SG, CC, to account. and IRHC. She also suggested that The proposal was put to a vote by only one type of printed material be a show of hands and it was passed allowed for each candidate. · unanimously and added to the other At this point, senior class presi- proposed rules. dent Rob Wallace agreed with With all the proposed rules in Nunez's proposal and he clarified order, Galli called for a role call some previous statements made by vote for the entire package of camother re,resentatives by saying, "I paign rules. This resuled in the think a ceiling is necessary. It is not campaign rules being passed by a a mandate. You don't have to·spend vote ofl2-(H. this money. '' Moving on to other business, Darlene Schaffer questioned the Publicity and Elections committee body as to how they would prevent a chairrne n Rob Doty and Chris student from spending more than Fellin announced that the new the maximum in any campaign. SG voting hours for elections will be vice president Marla Brodsky from 10 a.m. to 4 p.m. in the Student responded that there are plans to NOTICE institute a governmental affairs The deadline for registration of committee which would look into each campaign, and check receipts Homecoming Parade Floats is .next for campaign materials. If the com- Wednesday, October 1. Events For Parents' Day Announced By Ralston Center, and from 4:30 p.m. to 6:30 p.m. in the Dining Hall. The 18th Annual Parents' Day at Soccer <vs. King's) at 10:30 a.m.; Al~ under the topic of voting, Wilkes College is scheduled for Field Hockey (vs. Albright) at 11 Galh announced that on Monday, Saturday, September 27. According a.m.; Cross Country (vs. September 29, SG, the faculty wives to Dean Ralston, the purpose of this Philadelphia Pharmacy) at 1 p.m.; and the League of Women Voters event is to acquaint the parents and and Football (vs. Lycoming ) at 1 :30 will sponsor a Voter registration family of Wilkes students with the p.m. All events will occur at drive from 10 a.m. to 2 p.m. in the educational experience of college. Ralston Field. Student Center and from 4:30 p.m. Several activities have been planA "Post Games Huddle," conto 7:30 p.m. in the Cafeteria. ned for this cooperative event. sisting of refreshments and visits Under fund requests, Jim Kovacs Greetings and registration from with faculty .. and friends, will be of the Ice Hockey Club made a re- 9:30 a.m. until 11 a.m. will consist held from 4 p.m. until 6 p.m. at the quest for $1,000. He pointed out that of refreshments, visits with faculty , Sterling Inn Towne. the club has anticipated expenand tickets for activities to be held . The entire campus and facilities ditures in the amount of $1,752 for in the Stark · Learning Center will be open for visitation as well as this year. Also, the group is subject Lounge. A slide presentation, "A the special events. Dean Ralston to increased fees by the Wilkes- Saga of Wilkes College" will be urges all families of Wilkes Barre Ice-A-Rama, and each club shown in the Schaffer Lecture Hall Students to attend this "family l,lfmember already has to incur a lot from 10:30 a.m. until 11 :30 a.m. fair." of expenses on his own for equipDOUG FAHRINGER The sports events will include ment. However, the club would like to see students get their money's worth if they should be granted . $1,000, and as a result,they will try to arrange skating parties for the students to be held before the hockey games. The requ~st will be voted on next week. this reporter. The speakers Al Wirkman, Chairman of the The Skills on Survival (S.O.S.) themselves, if they ever.showed up, Homecoming Committee, announcSeminar on legal services which were probably late. ed that tickets for the.Homecoming was scheduled for this past SaturThe first S.O,S. Seminar was held dinner dance will go on sale Monday from 10 A.M. to noon was not last Spring with about 15 alumni day, and students must show their held. The reason it was cancelled and ten students in attendance. ID to purchase tickets. was apathy. Hallez hoped that this time the Rob Wallace reminded everyone The program was coordinated by seminar would have been better atof the need for a strong cheering Assistant Director of Alumni Relasection for the football games. He tions Tanya April Hallez. A few at- tended. However, it was not. Hallez blamed the poor turnout on apathy. asked for the support of the student torneys who are also Wilkes alumni LOUIS CZACHOR body and everyone else associated had been scheduled to attend to with the college. He stated that he speak about legal problems would like to see everyone dressed students might encounter and to In blue and gold on _Saturday oneanswer l!ny questions students_ half hour before the game. Inmight have. However, the only peoterested persons should meet at ple to show up were Tanya Hallez, a Ralston Field below the pressbox. photographer who had been sent by As usual, few students other than the Public Relations Office, and the members of SG were in attendance at the meeting. Students Folk Rock NOTICE should be reminded that SG The Political Science Club will Guitarists & Vocalists meetings are open to all students of hold its first meeting on Thursday, ' the college. September 25 at 11 :00 a.m. in the Louis Czachor basement of Franklin Hall. • S.O.S. Selllinar Cancelled Due To Poor Turnout "JUST _US" Friday Night NOTICE There will be a mandatory student center workers meeting today, September 25 at 11: 00 in the Student Center. If you cannot attend contact Carol Benek at Waller Hall. NOTICE All upperclassmen are reminded to get their college ID's validated for the 1980-81 school year at the registrar's office as soon as possible. , Your College Student Discount Card is now available for you to pick up at Bartikowsky Jewelers Catalog Showroom 141 South Maio St. Wilkes-Barre Please show your college I.D. Card You can also have our new 1981 Catalogue upon request. • DiscCiunt cards are also available at the Beacon Office, 2nd Floor, Parrish Hall Plenty of Store Side Free-Parking Come In & See Why CORINNE & JOEY Are Packing Them In At Ji• . 1JANDYS llllrt Pllu, Edw1nlsdle 288-2235 Try one of our Giant Gourmet Burgers 21 different varieties served seven days a week. I J �Commuter Council Discusses Campaign Rules: Unanimous Objection Voiced By Representatives Adamant opm1ons were being voiced during the Monday night meeting of Commuter Council over the newly proposed election rules. On a unanimous roll call vote, it was decided to delete the sub-point 1 under general rules, "Any candidate may use a maximum of $50 on their campaign. Presidents of Student Government, CC, and IRHC shall be allowed a maximum of$100. " The reasons for this action, according to Susan Schwab, is that "it discriminates between poor kids and the rich ones." In addition, CC President Bill Miller noted, "You can get a lot of material with that money and all that campaign materials will eliminate the personal contact that the new rules are trying to reach." Miller also pointed out, "There is no way to police this system. Students may go over (the alloted sums) and never turn the receipts in." Under the new campaign rules, all receipts for purchased campaign materials must be turned in to be checked. Miller also noted that he was in .. SPECIAL DOUBLE SAVINGS on your COLLEGE. RING • $10.00 discount on an Ultrium College Ring • Fantastic trade-in values on your old 1Ok gold high school ring check it out! favor of cutting down the alloted sums and he urged all members of CC to attend SG's meeting to speak out on the subject. The action taken by CC would be brought out during that meeting. In a related note, Colleen Gries asked the purpose of increasing the amount of time during which students will be able to vote. Miller answered that this move is hoped to allow more students to have the opportunity to vote. The question then was raised as to whether or not to have on particular location for balloting. It was pointed out that the lobby of the St ark Learning Center would be an ideal location. Susan Schwab noted that SG has used the lobby to conduct its teacher evaluations in the past, and that registration and orientation to clubs and organizations were both held there. Colleen Gries explained that the area used to vote in the student center was smaller than the lobby of Stark and that Stark "seems like a more centralized area." In a vote taken by John Moffat, the group concluded that one central location, such as the lobby of Stark is a good idea. Schwab added, "We (commuters) are always 1idi1on l~ical, Jolin B. · to ORDER 11 \l\\\ :::: Janine Tucker, president of IRH<f is looking forward to sending a delegation of Wilkes College resident hall representatives to the National Association of College and University Resident Hall (NACURH) convention, which will be held November 7th Uu-.,.igh 9th at the Rochester Institute of Technology in New York. Elected to the position of IRHC treasurer is Don Burch. During the school year, the social committee of IRHC-CC will be meeting frequently to plan activities for the students. Chairpersons Dina Campbell and Marge LeBlanc will be working in cooperation with Bill Miller, Commuter Council President, to provide enjoyable events for students. All students are welcome to attend the meetings for the social committee, which are held on Thursdays in Stark Learning Center, Room 209 at 11:30 a.m. One of the upcoming events will be the Halloween Party on Friday, October 31, 1980. .Also, any maintenance problems may be reported to Jon Pliskin, Maintenance Committee Chairman, R.A. 's, or other Maintenance Committee members. JENNIFER FROHLINGER . Films shown this semester deal with the problems of scrutinizing evidence in "criminal trials, other cultures, in history, and in science." All IDA films are open to the student body. The films are shown in Stark Learning Center Room 1 on the following Mondays from2:00to4:00p.m.: ·September 29, 1980, 'Rashomon"a classic Japanese film illustrating varying reports of the same incident. November 3, 1980-"Richard III' November 24, 1980-"The Majestic Clockwork" December 1, 1980-"Knowledge or Certainty" "The Majestic Clockwork" and "Knowledge or Certainty" are excerpts from Jacob Bronowski's The Ascent of Manseries, which was shown on-PBS. • On September l, "1980, the film "Twelve Angry Men' was shown. On September 22,1980, "The Sacred Ground" and "Cows of Dolo Kem Paye" were shown. These anthropological films explore less developed societies and how they grapple'withevery-dayproblems. Reading selections · for class discussion range from Edgar Allan Poe's "The Purloined Letter," Chinua Achebe'sThings Falling Apart,and Shakespeare's "Richard III", to Jacob Bronowski's "The Jamestic Clockwork" and Knowledge or Certainty," which are essays on the philosophy of science. Besides class discussions of films and readings, there will be an ethnographic field trip to a local ..-•••--llllliiiiiiiiiiiiiiiiiiiiiiiiill' cemetary. Students will study the graveyard to gain an insight into certain cultural aspects of a society. Method of Inquiry is funded by Wilkes College and is supervised by Dr. Jean Driscoll, project director. ARMY & NAVY Dr. Robert Heaman, Associate Pro113 South Main St. fessor of English; Dr. Robert Downtown Wilkes-Borre Freysinger, Assistant Professor of HOUIS: Do11r 10..a. -5:»,.■. P olitical Science; and Dr. Judith .... ITllws. lOe.• .·•P•"' Rasson, Assistant Professor of Anthropology, are the IDA staff for the fall semester. During the spring semester, three credit seminars, which are open to all students, will be held on specific areas by these professors and possibly others. IDA staff work with upperclassmen or student felows who DINIM.a>IDUIOY may initiate argumentive discussions. -PLUS. AIMYPANIS Student fellows for the fall PAlffllPANIS semester are Tom Farley, who is working with Dr. Freysinger, 'AIMIIJIAIIS Michael Beltrami, who is working IWIA11ian with Dr. Heaman, and Don RAIIIB 1N1111 Gaetano, who is working with Dr. Rasson. · ,~1-1 w·a; iE1.-1 Place ___B_OO_KS_TOOE _ _ _ _ _ _ __ Date_SEP_T_2_S_&_2_6__ Time M ·1RHC Discusses 1i1r Many Topics lnterdiscipl~nary Adventure Classes Aids In Individual Understanding Participating in Interdisciplinary Adventure (IDA) or the Method of Inquiry class can be a fascinating experience. According to Dr. Robert Freysinger, IDA is a class which aids the student in "understanding and appreciattng the development of knowledge in various areas." Fall semester classes will concentrate on cltural, historical, scientific, and individual perceptil;m of films, documentaries, art, short stories, essays, and leetures. ..I the ones to hold our tongues, for once I am sick and tired of it! " In other business, CC passed· a motion to pay $60 as a deposit on the rock-top 40's group, the Herman James Band for the Halloween party. Subcommittees are being formed to handle this event. Commuter Council also renewed its memberships to the National Clearinghouse for Commuter Programs. Newsletters and other commuter-related materials from the Clearinghouse are available in the CC office. The Coffeefouse committee explained that on October 14, Pat Godwin will perform in the lower level of the student center during the activity period. The group is currently trying to obtain more local talent for future coffeehouses. · A food service committee is also being formed to handle any complaints about the food or service at the student center. Students were reminded that this Saturday is Parent's Day and on Sunday at 2:00 p.m. there will be a TriOrganizational meeting in the Annette Evans Alumni and Faculty House. Attendance by all representatives is mandatory. ~;~:~~~L~ffl!;!~~J!?:~~:~?.~J~~:a 10 - 4 PM Deposit Required 5 ____ 10__ • __ oo_ _ __ dOMBER STYLE JACKET In Ton or Brown '39" Color Paid Shirts orTurtle'Necks 'JO J.B. STETZ Expert Clother 66 S. Main, W~B ._.....,.._,,. .,....,,.._ Jeuifer Frolingher �Page 4, The Beacon, September 25, 1980 lass Withdrawal Period Ends This Week -? ? ? The Students' Choice??? After much discussion, debate and rev1s1on, Student Government finally passed the new campaign regulations. Although most of the regulations are consistent with previous rules, there are several new parts of the regulations. The new rules allow students to obtain printed material with the exception of mimeographed or dittoed handbills . . SG claims that this will get more students involved in the campaigning and also give the campaigns a semiprofessional look. This is absurd. Pre-printed materials such as bumper stickers, buttons, posters,_etc., will not involve any more people with the exception of the printers who will be duplicating the material. The previous rules call for hand-made materials only. This policy is what gets students involved in so far as they will be the ones who have to produce the goods for display. This campus has _seen many spirited campaigns under the old policy. (Does anyone remember last year's freshman class presidential elections? ) With SG's consistent support and enforcement of the previous rules, more students would find it worth their while to participate in the creation and production of an "original material" campaign. Moreover, the allowance ofpre-printed materials will .leave the doors wide open for candidates to obtain selfadhesive items, such as bumper stickers, and place them at various locations around campus. Several years ago, a candidate used bumper stickers as part of his campaign for office. Although he was disqualified from the election, his promotional materials can still be found decorating the ·waste baskets, walls and lockers of Stark Learning Center. Although this point was raised during S.G.'s discussion of the new rules, it was obviously disregarded. If one candidate's materials are still present after that period of time, what is to happen when four or five candidates obtain the same type of materials? This campus is not physically large enough to sustain this kind of campaigning. The buildings of Wilkes .will become political billboards. This kind of organized .vandalism will detract from the administration's attempt to improve the physical appearance of the campus. In a lame attempt to prevent this, SG has simultaneously instituted a committee to make sure that no materials are abused. How can this committee effectively enforce any rules of such a sustained effort when the present committee is almost ineffective in their attempts? At present, there are no major elections occurring and posters and handbills can still be seen on doors, walls and wherever they are not supposed to be posted. Administrative offices are just as guilty as students in this violation. Several Student Government Activity posters are located in illegal areas, also. Attempted enforcement of the new rules will be ineffective, especially if student response is as large as SG hopes it to be. The new rules also allow a candidate for office to spend up to $25 and presidential candidates for SG, CC and IRHC may spend a maximum of $50 to purchase the materials. Although this section is a modification of the original proposal, which allowed candidates to spend up to $50 and SG, CC and ffiHC presidential candidates were allotted $100, it is still a costly endeavor for most students to run for office. SG again fails to see that many students have no means of financial support other than their parents. In addition, man~students have to scrape dollars just to attend a SUB party or other campus even~. lnstead of attracting more students to office posts, SG ~c; chasing them away. How many students are willing to 1 west $25 or $50 in an office and then face the possibility o: not even being elected? Then, if elected, there is no finan\ ·ial compensation for the expenditure. Also what is to stop some stude. ,ts who can afford to spend 'more than the allotted amounL to do so? SG again cites their Governmental Affairs Committee as the enfore. ing agency. Candidates are to turn in their receipts for inspection by the committee. Are the committee members and SG officers going to comb the campus counting every To the Editor: purchased item o{ each candidate, calculate the cost, then This week ends the fourth week of contact the printer in oder to verify the candidate's claim? classes. According to the college Probably not. This would be time-consuming and withdrawal policy, as stated in the ridiculous. Again, this demonstrates the lack of planning Student H.!}ndbook, any student and forethought on the part of SG. Instead of gaining conwish1ng to withdraw from a course must do so before the end of this trol over elections, SG has, by adopting this regulation, lgst week. The purpose of withdrawal IS any control they might have had a chance to increase. NOT to get out of a course that is beBefore a candidate is nominated, he or she must obtain ing failed. The purpose IS to allow a signatures, student numbers and phone numbers from ap- student to get out of a course which proximately 10 percent of their constituents. SG, CC and is not what the student needs or expected the course to be about. If you IRHC presidential candidates must obtain 200, 100 and 100 are unclear on the Policy or think signatures respectively. Other representatives must obtain you may want to withdraw from a approximately 50 signatures before becoming a candidate. course, your time is running out. SG feels that this will get more students involved in the See The course instructor at once. elections. By adding this requirement, SG has placed an DANA C. SHAFFER extra burden on the prospective candidate and thus, in the long run, runs the risk of discouraging more people from Reggae Music running for office. Sure, it would mean that the person who did all the work in obtaining the signatures would really Added To WCLH want the office, but for every person who obtained the signatures, there are probably at least two more who would · Programming be discouraged by the increased burden. To the Editor: The remaining regulations are basically consistent with WCLH-FM radio is proud to anlast year's rules. · nounce that we are the only station Overall, it is unclear how these rules are going to change in the Wilkes-Barre, Scranton, and the attitudes of potential student officers. The adoption of Hazleton Area to provide the public these campaign rules discourages students from parwith an exclusive Soul-Disco and Reggae show. Every Friday night, ticipating, leaves room for possible long-term campus D.J.'s Jim (Dr. Time) McCabe and destruction and fails to challenge a candidate's creativity. Kendel (D.J. Mac) McNeil bring This policy is a giant step backward in Student Governthe best sounds of soul and disco ment's master plan to improve school spirit and student music to the area. They have pro-: participation. vided this musical format for the last four years on their show called the STATION EXPRESS. .., This year, Operations Manager, Stan Ray will add an exclusive Reggae Show to the WCLH format, also on Fridays from 4:30 P.M. to 5:30 P.M. The one hour long show will mark the first time in the history of radio in Wyoming Valley that an exclusive Reggae format is offered. Soul-Disco, Reggae, plus commercial free Top 40 and Country Western sets WCLH-FM above the others. JAMES MCCABE letter To The Editor Policy Letters to the editor are welcomed from all interested parties. Letters MUST be typed neatly and submitted by 3:00 p.m. on the Sunday before p~blication. Letters be delivered to the Beacon of1'n.F;o~H H , may fice, second floor of Parrish Hall, or Beacon box in the library before . Extra! Extra! Read Afl About I the this deadline. All letters MUST be signed IN INK, but names will be withheld Campaign Materials Sold Here I upon request. Class·year and-or appropriate title should be included with the signature. This status will be verified by the editors. Any letter bearing a signature and-or title deemed as fraudulant by the editors after verification will not be published. To the Editor: thus allowing your organization to Editorial discretion will be used Attention all club and class receive funds from S.G. for the in all cases, especially where quespresidents and treasurers: 1980-1981 academic year. Charters tionable language is used. All letS.G.'s charter renewal meeting of any club or ~lass not present will ters will be published as written, will be held September 25 al 11: 30 be revoked. We strongly urge you to without corrections (except for the a.m. in SLC 101. This brief meeting attend this meeting. Thank you for preceeding case), and the views exis mandatory for all club and class your cooperation. pressed in letters are those of the presidents and treasurers. At this S.G. Executive Council author and not those .of the Beacon time your charters will be renewed, or college. It S G's Charter Renewal Meeting Set For Today ,,, J ✓ - �September 25, 1980, The Beacon, Page 5 Prove Unique And D i f f e r e n t - - - - - - - - - - - - - - - - - - - - - TryOUtS For 'Midsummer Night's Dream' I sat nervously among 30 other aspiring actors and actresses filling out my casting card. Name, age, weight and any particular roles we' were interested in playing. I put down Hermia, Helena, Hippolyta, Tita~a or a fairy - the only possible role a female could play in Shakespeare's comedy, "A Midsummer Night's Dream." Suddenly, a blond-haired zany character jumped out of the wings of the stage and shouted, "OK, everybody follow me! " We scattered our cards on the stage and followed him innocently. In a matter of minutes, 35 students were jogging up and down the steps of the plush, Dorothy Dicksen Darte Center for Performing Arts. After about four laps we all collapsed in the upstairs lounge of the theatre . L. wondered if William Shakespeare ever wore running shoes. Then the blond-haired character introduced himself, "My name is Jay Siegfried and I am director for our fall production, 'A Midsummer Night's Dream'. I would like you to do some more relaxation exercises which professional actors and actresses do before they audition for shows:' In the next hour we shouted, clapped, twisted and turned our slightly out-of-shape bodies and finally filed down into the auditorium, breathing laboriously. Finally, I thought, we will do some normal speaking roles. Boy, did Jay have us fooled ! We each had to run across the stage individually and attempt to leap as gracefully as a ballerina as we shouted our names. Then he had us all line up in a straight line stretching across the stage. I felt like I was auditioning for ...A Chorus Line" on Broadway. He called our names individually and we had to recite some obscure Shakespearian line "I'll meet by moonlight, proud Titania," while standing center stage. I left auditions that first night feeling slightly embarassed and wondering if I was ever meant to be an actress. The second night things seemed slightly more normal. Each of us were called up to read certain passages from the play. Around 9:30 that night, Jay read his list of callbacks. If you were . "called back," it meant he was interested in you for a particular role, supposedly. When Jay called out my name and asked if I could. come for another night of auditions, my stomach did a double flip and I managed to choke out a weak, "Yes, I can." I happily (and gracefully ) leaped back to my dorm that night. On the third night of auditions our group had dwindled down to 20. We each read a variety of character roles and passages. There was a lot of nervous stuttering among those Shakepearian " thee's and thou's", but some true,talent shone through that night. As my fellow thespians and I continued to read, I peeked at our director, Mr. Siegfried, sitting in the back shadows of the auditorium. He reminded me of a benevolent king scribbling notes and evaluating his favorite subjects -us. Around 9:00 on that third night, Jay said, "Thank you, all of you. I will post the cast list tomorrow. Oh, and by the way, the roles that you read and didn't read tonight have absolutely nothing to do with the part you will get.'' That night, I felt like I was back in junior high school waiting to hear if I had made the cheerleading squad. When I looked at the cast list, I let out a cheerleaders yell; I had gotten a major role! . On the cast list was a note asking us to meet in the lounge at 7 p.m., the same place where we had done our crazy actors' exercises. As the whole cast gathered together that fourth night, Jay had us read through the play. Shakespeare's "A Midsummer was walking down the steps I noticed a bust of William Shakespeare, the old "bard" himself on the stair landing. A car passed by the outside of the theatre, and its headlights flashed across his face. I cquld have sworn he winked at me a!fif to say · "break a leg." ... RoyaFahmy Night's Dream" is one of his most light-hearted comedies. It centers around four major plots - the story of Theseus, Dulce of Athens and his bride-to-be, and Amazon Queen Hippolyta; two sets of lovers, Hermia, who loves Lysander, and Helena, who loves Demetrius. There is only one problem, Demetrius loves Hermia and cannot stand Helena; a group of clowns who are rehearsing a play for Theseus' and Hippolyta's wedding; and Titania and Oberon, King and Queen of the fairies, who love to cause mischief in the Athenian Exhibit at Gallery Creates Unique woods. Environment The cast will perform the play on October 24,25 and 26, so we will all have about four weeks until showtime. I left the theatre that night eager with anticipation. As I "You are in the center. Witnessing the ritual. As sulfur colors the sky. In control. Encircled by anthracite. As roundne$s helps recall. The lost miner's life." These are the words that create the atmosphere in the current exhibit at the Sordoni Art Gallery. If you have walked by the gallery witin the last week, you have probably noticed that the exhibit is set up differently than most exhibits are. Panels are set up in the gallery, forming 'three walls and shielding the interior from view from the front of the room. To experience this exhibit, you must walk around the panels to the center and sit in the chair situated · there. Upon sitting down, you will notice II that there is a pickaxe tied to the side of the plain wooden chair. Surrounding the chair in a circle are a few piles of rocks, with a bare light bulb hanging down over each pile. You barely have time to take all this in, for a tape starts to play and you will hear the words quoted above. This is perhaps the most unusual exhibit that has been at the gallery in quite a while. · What does it mean? The artist who created this experience is John Stascek, a native of Wilkes-Barre who now resides in New York. He has worked with many different kinds of media, both traditional and nonII traditional. Currently his interests are primarily in multi-media environments. The exhibit at the Sordoni Art Gallery, entitled "Miner Memories,." is an example of one of these environments. J Such environmental art allows the spectator to enter into the work and almost become part of the exhiblt. In this way the viewer or listener experiences the atmosphere of the work of art more deeply and meaningfuly, because he is involved in the art rather than being detached from it. The National Shakespeare Com- time they meet until their tragic Anyone wishing to experience pany will _perform "Romeo and death. Interwoven in the plot are this exhibit may do so at the art Juliet", one of The Bard's most the anger and hatred of the feuding gallery from '1-5 p.m. Sunday famous and best-loved plays under families of the lovers. The contrasts •through Friday, or 10 a.m.-5 p.m. the auspices of the Concert and Lec- that this presents serves to convey on Saturdays. ture Series. The performance will Shakespeare's idea that love is imMary Kay Pogar take place on Sunday, September 28 possible in an atmosphere of in the CPA at 8 p.m. rivalry and revenge. The National Shakespeare ComThe central theme. of the play is the power of love, but there are sub- . pany is the oldest professional tourNOTICE themes involved also. For instance, ing theatre company in the United Photography Student or Camera the anger and impetuousness of States. Their performance of this Buff - CAMERA FOR SALE youth is a theme that can be traced timeless drama of tragedy and romance promises to be as exc~ Yashika 35 mm camera, FRI, 1.7 throughout the tragedy. lens, all black body, brand new, The plot follows the fate of. the tional as the play itself. retail value $535, asking $220. Call two "star-crossed lovers" from the 288-2021. ,..,...._,,.~.,_,.~,.......~· .L..._.. - - -~__,,..._,.....,. ·Ronaeo and J aliet t I I II I I USPS 832-080 Editor-in-Chief Patti Sparlow News Editor Louis Czachor Managing Editor Margaret Scholl Asst. Sports Editor DaveCapin Asst. News Editor Darlene Schaffer Feature Editor David A. Clanton Copy Editor Lisa Gurka Business Manager Vanessa Martz Advertising Manager Michele Serafin Asst. Feature Editor Mary Kay Pogar Circulation Manager/ Cartoonist Michele Fidrych Sports Editor Peter Steve Photographer Frank Jeffrey Advisor Dr. Norma Schulman Reporters: Sue Beckenbaugh, Nancy Bowanko, Robert Buch_sbaum, ~isa Cobb, Elaine Czachor, Roya Fahmy, Doug Fahringer, John Fmn, Jenm_fer Frohlinger, Mark James, Candy Marshall, Daria Morris, Rich Nordheim, George Saba, Anthony Sibiya. Parrish Hall 16 S. River St. Wilkes-Barre. Pa. 18766 Published weekly during the school year from September to May except for vacation periods and semester breaks. Entered as second class postage paid in Wilkes-Barre. Send form n_umber 3579 to the Beacon, Wilkes College, Wilkes-Barre, Pa. 18766. Subscription rate to non-students: $4.00 per year. Advertising rate: $2.50 per column inch. Phone: (7l7> 824-4651 All views expressed are those of the individual writer and not necessarily of the publication or the college. '-=======::;:::==========::;::=======~ I I I I I It i I I I I I - l �' Page 6, The Beacon, September 25, 1980 Psychology Club~--~--------------------~- § Many Activities Planned For Year Wanted-enthusiastic students interested in psychology. Must be willing to work and have fun with a group of dedicated people with similar interests. Do you fit this description? If you do, then the Psychology Club is looking for you. And how can you find them? Go to the club's open house day on Thursday, October 2 from 11 a.m.-lp.m. in room 333 and get acquainted with the club members and office~ This year, under the leadership of president Paul Kanner, the club is planning many different activities. Starting on Septem»er 28, the club will have monthly paper drives every fourth Sunday, from 11 a.m. to 5 p.m. in the parking lot of Ralston Field. This activity, along with other fund raisers planned for other times during the year, will help provide funds for an end-of-the-year par- ty for the club. A camping trip is also being planned for the end of the year. The Psychology Club also will have guest speakers at some of its meetings this year. These speakers will include local people who have some training or interest in psychology. The club also plans to send some of its members to the Eastern Psychology Convention, to be held in April in New York City. At the convention, noted from different Universities and Colleges will present papers •and lead discussion groups. Students attending the convention have the opportnity learn about current developments in psychology from some of the most notable people in the field. Anyone interested in the club's , activities is invited to attend the weekly meetings, which ~re held collegiate crossword 6 7 ✓ 3.,...,....,....,..✓-r.,..o:,:Mary 8 9 11 12 13 I 8 . Kay Says.cr..000""....-~~ . ' § What's Happening . I§ §,-..r..r..r..r.....er..r..r..r..r....-..r..r....-..r..,-..,-....-.,..,...,...,.c,"'..........................,.....o""........r..r.,.c,"'..rJ"'..r..,-..r...o--..,-..,-..r--§ on Thursdays at 12 noon in room § The SG Film Committee will show the movie, "Voices," in the CPA on§ 334. Officers of the club are: ~ Friday, September 26. Shows will start at 7 and 9:30 p.m. Cost is $.25 and Ss President-Paul Kanner, Vice ~ student I.D. is required. President-Teri Hughes, Secretary-Sande Hartdagen, and Treasurer-Alvin Bauman. The cluo's adviser is Joseph Kanner. The National Shakespeare Company will present "Romeo and Juliet"§ Sunder the auspices of the Concert and · Lecture Series on Sunday,§ 8September 28. The performance will begin at 8 p.m. in the CPA. Admission S is free. I~ IVCF To Offer § Film Series I I § --------------- i ---------------- . I I § The First Presbyterian Church Film Series will present "R~pulsion," a The Wilkes ·college Chapter of § Polish film directed by Roman Polanski on Thursday, September 25, at 8 8 Inter-Varsity Christian Fellowship, ii p.m. The film will be shown at the church, which is located on South S in conjunction with the Covenant Franklin Street. Admission is $2.50. 8 Chapel of the Orthodox Presbyterian Church will be sponsoring a series of six Moody Science films. The second film, "Empty Cities," will be shown on Saturday, A~ixed~media _i~stall_ation piece, ~xperimentive Direction in the Visual September 27, in room 101 of the 8Arts, 1s bemg exh1b1ted m the Sordom Art Gallery from September 21 until 8 Dorothy Dickson Darte Center for 8October 5. Hours of the gallery are Sunday through Friday, 1-5 p.m. , and§ the Performing Arts at 7: 00 p.m. ~ Saturday 10 a.m. to 5 p.m. · 8 This film shows the futility of man's '.::r.r~..,....,..,...,....,....,..........,.....0--..........-..................✓.Y"..,..✓-rJ'"...o""✓....-....-..r..,-..r..r~..r...ocr..r..r....-..r..,-..,o,3 continual efforts to seek ultimate solutions to life's problems without God. Each film is 30 minutes long and will be'followed by a 30 minute discussion period. All films are .open to the public and a free will ofuorizon fering will be taken. The upcoming by films are: S~t. 27 "Empty Cities" Eddie Rabbit Oct. 4 "Professor and the Prophets" Making a strong comeback after his big hits "Every Which Way But 9ct. 11 "Signposts Aloft" Loose" and "Suspicions," Eddie Rabbit strums his way through a modified Oct. 25 "Stones Cry Out" country-western album without the usual twangy side-effects which typify Nov. l "To the Unknown God" country-western music. Although the album is found in the countrywestern section of the record store, it is a soft rock and country-western 3NV)I IQ 33.LS IH J3.L AV1 S 3 1 I O .L V 1 1 V hybrid. The top-ten release from the albume, "Driving My Life Away," exemplifies the mixture of styles. V I , V 1 0 N N V MV 8 I Rabbit slaps out a steady tempoihroughout the album with songs such as .L s 3 8 S M 0 N )I M 3 H .L V :I S 3 M• M V f V - )I M V - "I Love a Rainy Night," "Short Road to Love" and "747." This is not to say ■ N V .L V 8 ■ 3 .L J V M .L N 3 that the artist does not have his quieter moments, "Pretty Lady" and "So o r N V a-n 0 1 Deep in Your Love" are appropr1ae enough to enjoy on that 'Rainy Night' N0 8 V9 V Q M 3 s :I :I n d N 0 I 1 with someone special. , A3 N0 8 VN S 3 9 .L l'l Rabbit's fair mixture of musical genres is just enough to make each song J I 8 0 M J I l'l ■ s 3 Q NV ■ interesting, while still retaining some of the Grand Ole Opry flavor which - 1 0 N■ V 3 N o ■ I M .L trademarks his style - a style which is a welcome diversity from the dronN V I .L M V l'l 3 .L I M O A V :I ing disco beat and bombarding rock sound. Although you might have to HVMVSI 1Vd. O "drive your life away looking for a better way," you couldn't find a more 3 1 IM N 3 QM V S 3 3 ·1 palatable album than Eddie Rabbit's "Horizon." Q V 1 9 3 s ·1 0 8 Q JJ!_;{ § I~ - I~ ·---~----------- Album Revi~u,- "'- V91'1 55 58 61 1978 Collegiate CW78-2 41 West African nation ; 1 Mr. Guthrie 42 Theatrical interval 5 Northwestern 44 Doesn't eyecapital lash 10 Pleased 45 Genesis vessel 14 Dregs 46 Open 15 Eve or Enoch 48 judicata 16 Irritate 50 Old TV show 17 October gem (3 wds.) 18 Miles 55 Construction member 19 Miss Korbut (2 wds.) 20 "My - , " old TV 56 Invalidate · show 57 Inter ·23 Prefix for pod 58 breve 24 Draft classifi, 59 Sheer fabric ca• on (2 wds. ) 60 Eastern European 25 " - as a 61 Cal . Stranger" 62 Horse 26 Incas' milieu 63 Orson Welles role 28 Bacterial 33 Homeowners' debts (abbr.) DOWN 34 Skeletal 1 Airborne 35 Santa 2 Amends 36 Bert Lahr role 3 Omitting (2 wds.) 37 Emulates the big 4 Site of 1952 winter bad wolf olympics 38 Earth goddess ~ 5 Washbowls 39 Mr. Boudreau 6 Give a speech 40 Edd.ie Peabody's 7 Old TV show (4 wds.) instrument ACROSS 8 Fabric juncture 9 Makes more attractive 10 Picturesque cave , 11 Leslie Caron role 12 Aquarium growth 13 College VIP 21 Deer 22 Actor Calhoun 27 mother 29 Data, for short 30 Jane Fonda movie 31 Djakarta native 32 "Rollerball" star 33 French title (abbr . ) 34 Diamond sacrifice 37 Larcenous rodents (2 wds.) 38 Nibble 40 Tell all 41 Needlefishes 43 Very enthusiastic 44 Cried 47 Metric work unit 49 Ward off 50 Car or conmand 51 Competent 52 Bath powder 53 Unit of speed 54 S~ak up the sun NOTICE Theta Delta Rho Sorority will hold a fudge and brownie sale today in the Student Center from 11 a.m. tolp.m. NOTICE A get-together party for members of the Math and Computer Science clubs will be held tomorrow at 7:30 p.m. in the Alumni House. Januzzi's Pizza and Hoagies ~.,....,,..,...H4.,....,,..,...H4.,..'ff1 Stereo LP SALE All sa.98 LP's SALE s5.99 · 125 Academy StreeJ Home Delivery OPEN 7 DAYS 11-1 ~ - - Includes All Artists All Labels COVENjfNT CHAPEL Orthodox Presbyterian Church invites you to worship, pray and study with us . SUNDAYt ft4S a.m. Praise. Prayer, ■Ible Study 1htla.m. WORSHIPSEltVICI First & Third Sunday of Month', lunch and fellowship following the service - to which YOU ore invited, too. WIDNISDA Y 7:tl p.m. PWAISE, PRAYER & STUDY In the YMCA, Cor. S. Franklin & Northampton Streets. W-B .. 2nd floor. H.L. lwn.......r, Pastor. Tel.122-5556 Geriei:al Radio & Electric Co. 587 South Main St. · Wilkes-Borre, Po. Music Factory Narrows Shopping Center Edwardsville, Po. �-- --------o -------- -------•- -~ .... ..,••~••lllllliiiiPG Department To Cover 'LocalN~ws' Events WCLH, the college radio station, has something new in its news department. That new something is the new local news department. News Director Mark Thomas explained, "The idea behind college radio has always been a rip-andread idea" in which a story is ripped off the teletype and read on the air. Also, most stations write some of their own local news stories. Such was more or less the case with WCLH, until recently. Ron Labatch related how he had been working at the radio statjon WMJW on a local news beat.He pointed out that he felt that he could try to do the same thing at WCLH.He took his idea to Thomas who approved it. For the local news department to be successful, however, a staff was needed. Ron Labatch was appointed as !,,ocal News Cooldinator and assisting him are Darlene Schaffer, Bob Rushworth, Paul Kanner, and Jim Grobluskey. Thomas pointed out that the people at the station take their work serious!~• and because of that, they have been recognized and are' treated as equals among the other local news media. The members of the news staff have been given identification cards signed by the sheriff, and three staff members have received Wilkes-Barre Police Department LIVE FROM WILKES COLLEGE - Disc jockey Jim Winslow, is coming over the air waves of WCLH-FM reading the local news to the statton's 5000 listeners. ID's allowing accessabilify to certain police materials that they could not get otherwise. The local news department has reporters going out to cover specific beats such as city council meetings and school board meetings. The stories that are covered are basically the same as those stories covered by any other radio station. Thomas poted that one problem occurs if a reporter cannot get to an assigned meeting, because then there is no story. He continued, "We grab and ' scrape if we-have to. We do have limits. We cannot possibly cover everything." . They try to get as much as they can, but they have to work within the limits of time. Thomas pointed out that most colleges do not want to get involved in local news because of the time involved, the lack of training, and the fact that they do not want to take on the responsibility. "We are liable to the college and the public. We have to report the news in a responsible, journalistic style," continued Thomas. "We're limited, but we're trying. First, we're students, then we're journalists, because we cannot afford to be journalists first.'' He explained that the staff is professional in the sense that it does the same work as any professional station, but it Is not professional in the sense that the staff is not paid. The staff has a professional attitude and its members take their work seriously. They have had several exclusives including one about Macy's expressing an interest in the Lazarus Building, and one about a motion for a change of venue and a change of trial date in the Raymond Ziomeck case. Their work has not gone unnoticed. WCLH has been selected as the best college radio station in afi 18county area for the last two years as the result of a contest sponsored by the Professional News Media Association of Northeastern Pennsylvania. The contest judges college radio stations in the areas- of sports coverage, public affairs, and news. One new aspect of the local news department is a 15 minute program called "Local News in Review" which is scheduled to air every Thursday at 8:15 P.M. The initial show was supposed to air last Thursday, but the station ran into difficulties, so the premiere should be tonight. The news program will take a few important news issues" from the preceeding week and examine them in detail. Instead of just telling the facts, the news program will report on what facts are missing. In additio.p to the "Local News in Review" program, local news is presented every hour on the hour. As for the future, Thomas commented, "It looks bright in the sense that people are coming to the college to be broadcastors. As long as a professional atmosphere exists, the local news will continue to be covered; and as long as we can find dedicated people, we can continue doing what we are doing now." LOUIS CZACHOR NOTICE Act 101 and the Educational Opportunity Center need tutors in all subject areas, especially Accounting, Nursing and Math. Both white and blue card workers ian apply at the Academic Skills Center, Ross Hall, 251 S. River Street or call 8244651, extension 389. *******************************************************************************************' I * i ~ " !* -'~.,. .;,~~;/ i* ** * t t t t i t : . * * *t* ! ~ ~ NOW YOU CAN EARN OVER $6,500 WITH ARMY ROTC , * y~ Before you graduate from college! Because now, you can combine service in the Army Reserve or National Guard with Army ROTC. It's called the Simultaneous Membership Program (SMP). And, depending on your academic year when you enter, SMP can help you earn over $6,500. Here's how it works. If you qualify and a vacancy is available, you become a member of an Army Reserve or National Guard unit as an officer trainee, and, at the same time, enroll in the Army ROTC Advanced course at your college. Your Reserve or Guard membership will pay you at the minimum level of Sergeant E-5, antl you'll receive $100 a month during the regular school year as an Army ROTC advanced course cadet. At the end of your second year of advanced ROTC, you'll be commissioned a second lieutenant and, assuming there's a vacancy, serve with a Guard or Reserve u:riit while pursuing your civilian career, or you can, if you prefer, compete for active duty as an Army officer. So if you'd like to earn over $6,500 while you're still in college, get into SMP. Because SMP can help you do it. You can bank on it! For further information, contact: : : : : : i Wilkes College Students - i * i i* ** : t t t i t : : * t t t CPT. BOB KEENAN IN ROOM HC" * * *t* SHEEHY STUDENT CENTER, KING'S COLLEGE OR CALL COLLECT (717) 961-7457/7652. $ . t ** ~*****************************************************************************************• �P:1ge 8, The Beacon, September 25, 1980 Communications Major Offers Advantages And Opportunities Beacon Bits The Testing and Counseling Center will be located in the rear 34 South River Street and will be identified as the Roth Center Annex. Students needing assistance in planning their educational program and career goals, study skills techniques, test anxiety control, feelings of 'homesickness' or any other academic or personal problem may contact Professor J. Kanner at Ext. 245 or 492 or directly at his office. The confidentiality of the student will be maintained. , , ___________ ____________ The Youth Employment Service is planning another trip to New York City on Saturday, November 1. Reservations for the trip must be made by Oc, person. tober 15, by calling 829-3637. Cost of the trip is $14.00 per There will be a Senior Employment Seminar next Tuesday, September 30 at 8 p.m. in Stark Learning Center 101. · , ___________ Listen in to WCLH for Star Date - the most popular science radio feature in the United States. It tells you what to look for in the night sky, explores the history"' of astronomy and keeps yqu up-to-date on recent discoveries in this rapidly changing field of science. Star Date can help answer your questions about the universe. · ----------- Friday is the end of the fourth week of classes and is the last day to withdraw from class. It is also the last day to withdraw from school with a 60 percent tuition refund. ------------------------------___________ Replacement elections for all vacant offices and Homecoming Queen nominations are today. Former King's College cage star Dan Frascella has been signed to play pro basketball for a team in the European League. Frascella will play for a team from Grindavik, Iceland. Who's Who nomination forms are available from the Dean's offices in Weckesser Hall through October 31. , Registration deadline for all Homecoming Parade floats is October 1. Next Thursday, October 2 are nominations for Freshman Student Government and Commuter CouncU reps. Anyone interested in joining "The· Wilkes and Friends Chamber Players" should contact Dr. Herbert Garber of the Music Department. ----------- One of the world's most celebrated violinists, Aaron Rosand, will open Northeastern Pennsylvania Philharmonic's "Season of Stars" September 26 at the Masonic Temple in Scranton and September 27 at the Irem Temple in Wilkes-Barre. Concert time for both performances is 8:30 p.m. Tickets for the concerts as well as subscriptions for the orchestra's season of four classical Programs and three evenings of "pops" are on sale at the Philharmonic office in Avoca or bv calling 654-4788 or 342-0920. SCB. Purchases Alarm Communications majors have student a broader background and to, we still have time to work witn many · opportunities and ad- a larger scope and perspective on him and help him find what he realvantages here at Wilkes. The col- . the world. The department feels ly wants to do." lege offers a program in com- that too many advanced courses in Wilkes has applied for a grant munications which will make the the concentration will result in which will provide funds for new ' individual well rounded and merely the training of the in- equipment. This equipment will prepared for his c~reer, as well as dividual for his career rather than enable students to gain experience give him the opportunity to have exthe complete professional prepara- with film making and television as , perience before graduating. well as with radio. "If we get this tion for that career. An internship is also offered by equipment," said Dr. Kaska, "we • "Communications is one of the most complicated majors on camthe department. During the intern- will have the largest and best studio pus," commented Dr. Thomas ship, the communications major among all the schools in the area. '' may work at a public relations ofKaska, Chairman of the DepartDr. Kaska also commented that if fice, a radio or television studio, a the area of communications conment of Language and Literatures. "We strive to make our students newspaper office, or any other loca- tinues to grow as it has over the rewell rounded professionals instead tion that will provide efficient on- cent years, it will have to be made the-job training and experience. into a separate department. "I'm of simply narrow-minded, trained individuals. We are giving them a "We encourage our students to take so proud of our communications ' I Liberal Arts Education." , their internships during their junior program!" Dr. Kaska exclaimed. Those students majoring in comyear," said Dr. Bradford Kinney of "I'm just so proud." the department. "That way, if the munications are required to take LISACOBB 1 only fifteen to eighteen credit hours student discovers that he really in advanced courses in their condoesn't like the field he has gone incentration. They are required, however, to take nine electives in advanced courses from the following .,..disciplines : _ philosophy, politicai science, history, sociology, anthropology, and economics. These requirements are to give the A three-part senior employmenf of Careers Service wil give a detailed explanation of the registration seminar will be held on Tuesday, Replacement September 30, at 8:00 p.m. in Room procedures for job opportunities 101 of the Stark Learning Center to and for graduate school. InterviewNominations help seniors prepare for employ- ing dates for recruiting organizament opportunities by completing tions, as well as a list of recruiting Continued from page l. registration materials for organizations, will be given to those employers and graduate schools. in attendance. to see our needs met and to obtain Aquestion and answer period will ~ , Information concerning occupaour goals. If I am elected President tional trends, interviewing tips, and follow the three presentations. All of the Class of 1982, I will do my best job-hunting advice will also be a seniors are urged to attend the to meet my responsibilities in order -major part of the program. meeting. to give"our class the·'leadership it. Darlene Schaffer , An overview of the job market expects. I feel I am qualified for will be presented by Mrs. Paula - - - - - - - - - - - - - , - - - - , this office because of my involvePlacko, a representative of the SHS ment with past administrations of Employment Agency. Placko will Looking Inward the Class of '82, and because of my explain what's happening in terms active participation in the InterOff-campus, growth-oriented of openings in the job market and Residence Hall Council (as a the prospect of graduating seniors group for men & women, age 11Residence Hall Representative, filling these openings. and as Food Committee ChairThe second part of the seminar 24. Will meet weekly for 8 weeks. man) ." will be a presentation of the do's Co-leaden: The elections will take place toand don'ts of interviewing. Dr. Dennis Gold, PhD and day in the Student Center from Bradford L. Kinney of the speech 10:00 a.m. to 4:00 p.m., and in the Rebecca Osborn, MSW. division will speak on the "ABC's of Dining Hall from 4:30 p.m. to 6:30 Inerviewing Techniques," and wil For more information call: p.m. Student Identification cards explain how to "present your best Rebecca Osborn are necessary for voting. side'' during an interview. Tel. '96-1932 - Lou Czachor Eugene Domzalski of the Office Regarding future plans, Canonico At this week's Student Center Board meeting, various topics noted there is a Student were brought up for discussion. Government-Slocum Hall ClamBeginning the meeting, assistant bake scheduled for October 4. director John Moffatt presented a There were plans to use the student -PREGNANT? revised student center social center front porch for steaming policy. The policy entails regula- clams, but Dean Hoover cautioned, NEED HELP? tions concerning scheduling par- "I think you need a little more Confidential Counseling ties, selling tickets, the actual runn- thinking on this." · ing of parties and cleaning up after The last issue discussed was th~t Pregnancy Testing parties. of the alarm system for the stereos. Director Mike Canonico then , The meeting concluded with the Alientown noted that the Biolo_gical Society is Board voting unananimously to buy Women's Center sponsoring a closed party on the alarm because this would be September 27 · from 9:30 to more economical than renting it. · I (215) 264-5657 11:30.There were no objections Elaine Czachor • from the board members. An employee contract was presented by assistant director Carol Benek. The contract lists Northeast Gymnastic Center specific duties of student center workers. · ( The fact that students have been -Slim nastieswriting on the walls near the pay telephone on the second floor was Classes Nolff mentioned. On the game room walls, writing concerning game records was also noticed. It was remarked that pads of paper could 4 Week Sessions be put near the phone but nothing definite was decided. Forming Call 824-0407 Senior Employment Seminar Scheduled For September 30 I\) -..J _.. i1Jr [J(JrllJ]llflflflf~ r.fl(I ·~IJr.lflrn~ · See Bob,John,and Mike MON.-THURS. 11 A.M.-9 P.M. TUES., WED ., FRI. & SAT. 11 :00 A.M.-5:30 P .M. 288-3751 ~ ~ z G) )> ~ A z G) (I) -◄ Ci z " �~ : !t SPORTS -. ~ . .. - Former Olympic Champion1------------------ Athlete Of The Week Valerie Fre y is to Wilkes Field Hockey, what J im Craig is to the 1980 gold medal winning U.S. Hockey Team. Granted Val~rie plays on the field and J im plays on the ice, but both play goaltender for their respective teams. Playing goaltender takes nerves of steel, along with gre·a t reflex action. Valerie was under tremendous pressure in her first collegiate field hockey game on Thursday, but she came through like a seasoned veteran. Valerie's statist~s were so impressive she has been named "Athlete of the Week" by the Beacon Sports Department. Receiving recognition for her outstanding goal keeping is nothing makes more than 12 saves in a new for the freshman nursing ma- single game is doing an outstanding jor. At Penn Hills High School in job." Coach Meyers also felt Millersville, Pa., Valerie was nam- Valerie had a " cool head for a ed field hockey Most Valuable freshman" and this was a major Player of her school, and also factor in her early success. achieved All-League honors in both Valerie was very surprised to her junior and senior years. Valerie have been selected "Athlete of the said she was not originally in- Week," but attributed her success terested in field hockey, but she to the rest of the team . " We have a wanted to find some way to get in- good team this year and everyone volved in school activities. seems to be friendly, this is imporOn Thursday's game against tant if yol,! expect to do well in comElizabethtown College, Valerie had petition." 17 saves, while giving up only two If Valerie's performance is any goals with the last one coming with indication of the team ability, the just three seconds remaining in the women's field hockey team can contest. According to Coach look forward to another banner e,.....M_e.:;.ye___rs ____ , .....•~•A., . n.::..y. . ,.::;g.... oa~l-kee,..,,.;..p....e~r_w_,h~o-Ny.,,..e.....a~r.______.,,......._.,,......._....,.D_a....v.... e.,,..c.... ap....,i.,,..n...., Valerie Frey lookancl Record Mart NOTICE After much deliberation, the ''BEACON" sports department has Rudol ph Renders lnspirating Lecture If you were not at the Dorothy Dickson Darte building Monday night you really missed something special. Former Olympic Champion Wilma Rudolph gave a lecture that I will remember for rest of my life. Wilma Rudolph did not have the advantages that many athletes enjoy today. Wilma was born with polio and spent nipe years of her life in constant pain and agony. There were times when her famil y and friends thought she would die, but Wilma had too much determination to quit. When she was nine years old Wilma would secretly take off her leg brace and try to walk. During this time, the tall, 89 lb. girl could not understand why kids would not play sports with her. These kids later gave Wilma the will and incentive to compete as a world-class athlete. By the time Wilma was 10 she was competing with her friends in all sports. When she was 11 she was beating her friends in- all sports. Wilma had something extra that made her strive to be the best in anything she did. The Tennesseeborn athlete still remembers when she first tried out for her high school basketball team. The coach told her she was too skinny to play high school ball. All h~r life Wilma wa put down, laughed at, and all _she wanted was a chance to play. In her freshman year she made a deal with her coach. " If you work IO extra minutes a day with me I '.Nill become a world-class athlete." The extra work paid off and Wilma became a great basketball player. However, being great was not food enough for her; she wanted to be the best. Wilma would score up to 50 points a game but her teammate and best friend would score 55. It was the first high school basketball team to score more than 100 points in every game. Then a man by the name of Ed Temple came into the youngster's life. Temple was recruiting young hopefuls for his University of Tennessee track team. Coach Temple immediately recognized the talent of Wilma and asked her to attend a summer track program at the tfriiversity. The program meant long, hard hours of work with no guarantee of success. Wilma Rudolph met that challenge head on and became a member of the famous University of Tennessee track team. Going into the 1960 Olympics, Wilma remembered the kids who did not play with her as a child. She wanted to bring home a gold medal to show them how wrong they were. Wilma. Rudolph became the first woman athlete to win three gold medals in a single Olympics. She overcame the many problems of selected Dave Capin as assistant sports editor for the 1980-81 academic year. Capin is a junior . political science major from Wilkes-Barre with much journalism experience behind him. He was selected out of :- total of six candidates for the position and will assume his responsibilities im_mediately. Susquehanna Environmental · Advocates Presents: RaJly to Stop the Berwick ,~ . ~ ~ Jb"f □ Y NUKE her childhood and gained worldwide respect as one of the greatest women athletes of all time. After the lecture I had a chance to talk to the former Olympic Champion and get her autograph. It seemed strange standing next to a person who accomplished so much in life. I feel sorry for the people who were not able to hear Wilma Rudolph speak. She shared her experiences with us and proved that anything is possible if we try hard · enough to achieve it. Bob Buchsbaum Colon~ls Drop Opener To Aggies The season got off to a bad start this The Aggies ended the first half past Saturday for Rollie Schm1dt's with a 9-0 lead after a Tony Popple Colonels as they dropped their punt was blocked in the end zone for season opener to the Delaware a two-point safety. Delaware Valley Valley Aggies by a score of 30-8 at scored once again late in the third IOOKS-RECOROS-TAPES the Aggie home field. quarter on a one-yard run by Eric 125-4767 Numerous fumbles, intercepReynolds, pushing the score to 16--0 Cliff and Monarch Notes tions, and costly penalties held the when the pint after once again aplit Colonels scoreless until the senior the up-rights. co-captain Carmen LoPresto pushOn the first play from scrimmage eel his way over from the one-yard after Wilkes' first and only score, line with only 11 minutes left to play the Aggies' Eric Reynolds bolted 68 in the game. yards for his second touchdown of · A two-point conversion pass from the game. The PAT was good turnfreshman quarterback George Hall ing a close 16-8 game into a not;soto sophomore end Gerry O'Hara close 23-8 contest. Reynolds led all brought the game closer at 16-8 in rushers of the day with two favor of Delaware Valley. touchdowns and a total of 137 yards. Delaware built its previous.16 point Freshman quarterback Ray bulge early in the second quarter Boudreau replaced Hall as the Colwhen quarterback Tom Kenny caponels' signal-caller and was the viepeel a seven-play, 38-yard drive tim of a Mark Dobies interception • };J with an 18-yard touchdown pass to for a 38-yard T.D. scamper. A sueMike Petty. The point after attempt · cessful PAT put the icing on the ~ Join the Cause! ~ "'"' ..:;·_~7.A was good. ..._ _.... cake for the Blue and Gold, pushing the score to 30-8, which was how the . l game ended. ~ Playing quarterback for the first • Ncationally Known Speakers •R 9 ~ time since his junior year at • Public Interest Speakers SHOP · c Coughlin High School, George Hall . l ended his day three of 10 for 19 • professional Musicians 9 W. Northampton St. yards with three interceptions. He • Mime Artists Wilkes-Borre. Po. 18701 carried the ball 13 times for a total . , of 4 yards, but this totals deceptive, BouttqueeJewelryeClothes for he was sacked a · number of 11 a.m. to? Sat., Oct. _ 4 LayaW9Y Available times, dropping his total yardage. Across from the Berwick We Accept Menter Charge & Visa Ray Boudreau was one for two for a total of 13 yards with one intercepNuclear Plant Uon, while former Meyers high ll-iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiil ' - - - - - - - - - - - - - school star Jerry Goss was two of 11 S. Main St. W111c.....,.... Wilma Rudolph ~~· · ,~ru~,- -----i I six for 13 yards. Carmen "Homer" LoPresto led all Wilkes' rushers with 49 yards with Sean O'Dea second with 28 total yards. Overall, the Colonels rushed a total of 50 times for 100 yards, while Del Valley rushed the ball 48 times for a total of 124 yards. Blue and Gold quarterbacks combined for six completions out of 18 attempts for 45 yards, and lead their team to 10 first downs. The Aggies' quarterbacks hit seven of 22 passes for 79 yards and one touchdown, while moving their team for 12 first downs. In turnovers, the most important department of the day, the Colonels threw four interceptions, fumbled the ball five times, losing it .on four instances, and were penalized six times for a total of 55 yards. Delaware Valley had three interceptions for the day, coughed up the ball three times (195ing it once) and were penalized three times for 31yards. Although 30 points were scored against them, the Colonel defense led by senior Ed Mollahan was excellent.Mike Gould snatched two Aggie aerials while ·Donn Nicholas gathered in one, stal·ling potential scoring drives for the home team. Next week the Colonels are home against last year's MAC champion Lycoming College at 1:30 at Ralston Field. Pete Steve �Page IO, The Beacon, September 25, 1980 EllzalJetlatou,n Tallies Goal In Last ti Seconds K. Pascoe,E. Eppler,N. Pa~coe ~ Cross Country Record At 2-2 The Wilke11 College cross-country team started last week hot but suddenly were cooled off. Last Wednesday the Harriers swept Baptist Bible and Penn Stat~Worthington, but were swept Saturday by Delaware Valley and King's. In the season opener at Baptist Bible last Wednesday, Ken Pascoe topped all runners with a time of 29:20 as the Colonels downed Baptist Bible 17-30 and Penn StateWorthington 17-41. Captain Ed Eppler and freshman Neil Pascoe finished the 5.0 mile course tied at second with identical 29:58's. Dan Thomas finished 5th at 31 :18. Also - running for Wilkes were John - Supinski, 32:50; Joe Dill, 34:04; and Mite Tslvina, 36: 00. , On Saturday, a day Ed Eppler termed "dismal," the Colonels were stopped by host Delaware Valley, 21-38, and crosstown rival King's, 21-34. King's superman Frances Awanya copped top honors at 28:34, while Jim Parsons of Delaware Valley finished 2nd. Ken Pascoe was again the top Wilkes finisher with a 4th at 30:05. Dan Thomas finished 8th (30:46) and Ed Eppler 12th (32:00) as Neil Pascoe and John Supinski finished 16th and 17th respectively. Rounding out the Colonel finishers were Jim Bell, Joe Dill, and Mike Tsivina. Ron Righter's runners will have a week's rest before they meet Philadelphia Pharmacy this Saturday in the season's home opener at Kirby Park. RICH NORDHEIM Defense was the key in last week's 2-2 deadlock against the powerhouse Elizabethtown Bluejays. The Wilkes field hockey team opened its season with a very impressive defensive showing by locking out the potent Elizabethtown offense. Unfortunately, when the Lady Colonels almost had the game secured, the Bluejays opened up a tremendous attack, stealing away a Wilkes victory with just 3 seconds remaining in the game. Today the Colonelettes will host the University of Scranton at Ralston Field in a very important northern division matchup. Although the Lady Royals aren't as strong as the tough Elisabethtown team, they are in the same division as Wilkes. The 4:00 p.m. game will play an important role in determining who is tops among the local teams. This Saturday, Parents Day, the Wilkes hurlers will host Albright at 11:00 a.m. If this weeks games are anywhere as exciting as the Elizabethtown game, they shoud provide two enjoyable afternoons for those in attendance. The Elizabethtown fans certainly had their share of excitement in last Thursday's game. According to Coach Myers, the lady Colonels were a little rusty as the game opened. She attributed this to the typical first game tensions, not to mention that the Wilkes bus was late, which further complicated matters. The Lady Colonels didn't stay stiff and sluggish for long, however, and soon began to play up to their ability. The defense became better organized allowing the offense to mount an attack. Megan Ward In the closing minutes of the game, the Bluejays entered Wilkes side of the field for their final offensive push. As the clock ticked down, Elizabethtown drilled three very hard shots at the Wilkes net. All were blocked, but, as the third shot bounced off Frey's shin pads, an Elizabethtown player knocked the ball into the Wilkes net to tie the score. Only three seconds remained on the clock. "We held and held, but not quite long enough, " Meyers noted'. "Elizabethtown outplayed us on attack with 33 shots to our 9, but we capitalized on what opportunites we had." In the junior varsity game, Elizabethtown won by a score of 3 to 1. Wilkes' lone goal was made by Karen Bove, who usually plays defense. Because of illness and injury, the JV team was short several players, and some of the varsity girls filled in the gaps. Unfortunately, they didn't play in their usual positions so Wilkes had a difficult time in keeping a continuous offensive threat. The importance of the JV game was to give the second team more practice and playing experience. Freshman Sandy Mccarroll and Tracy Day each did well in the second game. Although the Lady Colonel defense had a good day protecting the net, the team as a whole will have to be a little more successful offensively. In this week's games, the Colonelettes will probably try to open up their attack. Coach Meyers will be looking for better execution and more controlled passing within the scoring circle. If all works out as planned, the offense should open up this afternoon against the University of Scranton. Approximately ten minutes after the Elizabethtown score, senior cocaptain Megan Ward slipped a good shot off to fellow co-captain Pam Snyder, who c~ove to the Bluejay goal. Her shot was blockeds, but left wing Geri McAfee who recovered the ball off the opposing goalie's pads and slapped it in for Wilkes first goal of the afteroon. For the remainder of the first half, Elizabethtow.n put tremendous pressure on the Wilkes defense, but failed to break in for a score. The game remained tied at 1 pointJor each team. In the beginning of the second half, neither team could take the lead nor mount a serious attack. Throughout the half, there was a great amount of midfield play, and Wilkes. had a lot more trouble getting into scoring position. With about 12 minutes remaining in the game, Wilkes broke into a nifMARK JAMES ty fast break, taking the lead, 2 to 1. NOTICE Right wing Diane McGovern hit a Theta Delta Rho Sorority will cross pass to the waiting stick of hold a fudge and brownie sale today Diane Hall, who in turn, snatched in the Student Center from II a .m. the ball and slipped it into the to I p.m. Elizabethtown net. retrieves although, as in tennis, . "Elizabethtown came back like every good play does not result in a gang-busters." coach Meyers compoint for the team. mented, but the Wilkes defense conThe Blue and Gold shook off tinually locked them out. Thursday's loss and displayed their "Freshman goalie, Valerie Frey Across from Bishop Hoban talents on Friday, September 19, as was clearing and stopping they defeated Penn State Lehman beautifully," Meyers explained. Ph. 822-7045 15-1, 15-5, 15-2. Team Captains She had a total of seventeen saves -Imported Cathy Dudick and Mary Kay Price for the day." Another freshman, -Cold . . .r kept the spirit high as they led their Karen Bove, also had a fine defenCall in Advance team to victory. The team played sive day from the sweeper position. lat Kegs and Quartets as a unit with every member conUnfortunately, the girls' efforts . _(Must have LCB Cord) tributing to the win. Sara ·Farley were not enough to lock -out the had the most successful spikes with Elizabethtown offense completely. five, but she was closely followed in number by many other team members. Debbie Kramer and Cathy Dudick again had excellent serves which added to the momentum that led the team to victory. New York Style Pizza · 0 Coach Saracino said that if the t"We feature Sicilian style pizza squares, team works hard on their small ~ mistakes and remains as dedicated serve salads, hot platters and ~ and spirited as they have been so cold or hot hoagies. 0 far, they will continue winning and -~ We have specialties such as: will have a successful. season. t"- Volleyball Team Defeats Penn·St.; Loses To ~lizabetlatqwn College r DECKOUR'S BEER -r•- ;,,,.:·=:: A Getting Instructions From the Coach Wilkes College Volleyball Team is looking forward to a successful year. This past week gave the team a one win, one loss standing, but they also gained the spirit they will need for a winning season. On Thursday, September 18, the team travelled to Elizabethtown where they were downed in three very close games. "I'm proud of the team;" said Coach Saracino," every single one ·of them. Each girl contributes something invaluable to the team. Our only problem at Elizabethtown was that the girls weren't moving enough. Other than that, I feel we played well." Elizabethtown presented more of a challange than the teams the Colonettes had been facing beforehand. Even though Wilkes lo.;t to Elizabethtown, the Wilkes team was much more organized and efficient. Cathy Dudick, Mary Kay Price. and Debbie Kramer each had ace serves and all players had no-return serves. There were also many successful spikes and ·z MIDTOWN PIZZA < > ~- > -~ ·------- 1 = ~ Sports Correction The tennis ,tory in last week's "BEACON" contained a factual er- ror. The story reported about the victory of freshman Debbie Solowe when in fact, the victory was that of sophomore Sheryl Slough. The sports department apologizes for this error! < ;) ~ > Stromboli, Calzone, Sausage Roll and Parmigiana Turnovers Buy a large pie for $4.35 and receive a with this coupon small pie FREE. Hours: 10:00 a.m. to9:00 p.m. Sat. 10:00 a.m. to 6:00 p.m. = ttj ~ 0 ~ --c, 0 41 South Main Street PHONE 829-7740 , Expiration Date 10-1-80. z �RECOGNIZE THOSE FACES? - Response to the memory photographs published the past two weeks in the "BEACON" has not been -good. In fact, it has been town-right terrible. Apparently, there is not one pe"rson, on or off campus, who reads the "BEACON" who recognizes the old photos which have been published. The sports department can understand why students MAY not be able ta' identify the photos, but what about alumni, faculty and administration? Surely these photographs must jar the mind in some way, shape or form. Can the problem of apathy discussed in previous issues of the " BEACON" pertain to the upper ranks of Wilkes College as well? The sports department doesn't think so for we have have attributed the lack of response to a temporary lapse of recall . To correct this problem, a clue about this week's photo has been provided in an attempt to stimulate everyone's memory. The picture was taken in 1951 and like all other memory photos in the "BEACON," it's identity will not be revealed until someone sends in the answer! ! ! ! 1. 23-0 (England defeated France on Feb. 3, 1923 at Merton, England.) 2. 458 3. Julie Brown 4. 271 (by Hollis Stacy in 1977 at Rail Golf Club, Springfield, Illinois.) 5. Barbara Krause, East Germany, July 5, 1978. 6. Shirley Muldowney, 1975. 7. Surfing - she won 2 titles, one in 1965 and the other in 1966. 8. Sheila Young, 27.49 m.p.h. 9. She is the highest-paid woman athlete in the world. In 1974, she signed a 3-year contract with Shipstad and Johnson Ice . Follies for a record $1,500,000. 10. First woman to sail singlehanded across the Atlantic Ocean. She left Plymouth, England, on May 18, 1952, and landed in Miami, Florida, on August 13, 1953. The phrase "You've come a long way baby" no longer 'applies only to cigarette ads and perfume commercials. This pop,ular slogan has come to be the fighting theme of women in every city, state, country, profession and pastime. One of the areas that this phrase most evidently applies to is women's athletics. Women's athletics have certainly come a long way since the earliest dated ball game (c. 2450 B.C.> in which women participated, depicted on Middle Kingdom. murals at Beni Hasan, Egypt. It's astomishing to think that women were not even allowed to watch, let along participate in, the ancient Olympic Games. And it is mind boggling to realize that not until 1919 were women allowed to wear uniforms that exposed more than an ankle. Imagine what it was like to play nine holes of golf in attire similar to today's evening gowns! Similar to the vast changes that have-occurred in men' s sports, women's sports have progressed along the same lines, but at a slower pace. While the men were shooting to the top in regards to media coverage, high salaries, and overall popularity, the women were just getting " their feet on the ground." But in the last fifteen years, women's athletics have caught up to the standards men's sports have established and are presently challenging for the "number one ranking." The days when women 'were allowed to play sports only when the men were through are becoming greatly fading memories. A female athlete today is receiving the same amount of public exposure, the same amount _of professional privileges, and is rapidly approaching the same salary level as a male athlete. Women's athletics are no longer in the shad6ws of men's sports, and in fact, they are quickly winning the public's favor. Although the progress of women's sports can best be seen in the professional realms, amateur athletics are undergoing a change in much the same way. A perfect example of this is an examination of the progress women's sports have made right here on campus.· Starting from · the days when an athletic program for women was unheard of, women on the Wilkes campus now participate intercollegiately in six sports including basketball, field hockey, tennis;·swimming, volleyball and softball. Add to this list golf and cross country in which many women participate, and you have a total of eight sports that women are involved in. .With only 20 years of competition, the six intercollegiate sports have won 11 Northeastern Pennsylvania Women's Athletic Association titles, a second place in the Middle Atlantic Conference Northeast division, 2 MAC Northwest championships, and have qualified numerous times for MAC playoff tournaments. Individual achievements include an MAC MVP and a first-team AllAmerican won by Diane Kendig, Pam Snyder and Jerry Ann Smith being selected two years in a row to participate in the United State Field Hockey National Tournament, and Cindy Glawe, Peggy Butchkavitz and Michele Maguire capturing medals in the MAC Swimming Championships. Even though there are many men's records which are equally if not more impressive, the amount of recognition Wilkes' women's sports have acquired in their brief history is outstanding. The next time you see a tennis match, field hockey game, or any_ women's sporting event on your schedule, drop by and show some support for very deserving athletes. Wh knows, you might just be watching a future Babe Didrikson or Billie Jea King in action! · MEN 'S CROSS COUNTRY Nov. 1 - Wilkes, Kings, Scranton,, September 26 Triangular Meet Volleyball- Upsala - (Home) September 27 (Parent's Day) WOMEN'S TENNIS Football - Lycoming - (Home) Sept. 13 - K-ings at Wilkes , WOMEN'S VOLLEYBALL Soccer-Kings' - (Home) Sept. 16 - Scranton at Kings Sept. 18 - Wilkes at Scranton \i'ield Hockey- Albright - (Home) Sept. 23 - Scranton at Wilkes Sept. 19 - Scranton at Kings September 30 Oct. 2 - Wilkes at Kings Sept. 23 - Kings at Scranton Volleyball- Dickinson (Away) Oct. 6 - Kings at Scranton Oct. 2 - Scranton at Wilkes October 1 Oct. 25 Wilkes at Scranton Oct. 23 - Wilkes at Kings Soccer-Muhlenberg - (Away ) Oct. 27 - Kings at Wilkes Cross Country - Muhlenberg and WOMEN'S BASKETBALL Scranton - (Home) : MEN'S BASKETBALL Dec. 9 - Kings at Scranton Field Hockey - Misericordia - : Dec. 15 - Kings at Wilkes (Away) • Dec. 11 - Wilkes at Kings Jan. 24 Scranton at Wilkes Jan.17 - Wilkes at Kings Women's Tennis - Bloomsburg Jan. 26 - Scranton at Kings J~n. 28 - Kings at Wilkes (Away) - Feb. 11 - Wilkes at Scranton Jan. 31- Scranton at Kings October2 Feb. 9 Kings at Scnntou Feb. 19 - Scranton at Wilkes Volleyball - Kings' - (Away ) Feb. 11 - Wilkes at Scranton Women's Tennis - Scranton (Home) This is the third year for WBRE TV's Metro Intercollegiate Conference: NOTICE (M.I.C.) and the third year for Joe Gries as coordinator. For the past two: White card workers are needed to years, the final standings in the M.I.C. have been the same, with Scranton: work in Registrar's, Recorder's finishing fi rst, Kings second and the Colonels third. Hopefully, this year,: and Duplicating Offices. Freshmen Wilkes will be able to capture a number of winning trophies which are: and sophomores are preferred. Inpresented to the championship team in each sport, and possibly garner the: terested students should see Mrs. overall championship school award. : Barker on the second floor of Par: rish Hall in the Registrar's Office. '· • • • • • • • • • • • • • • • • • • • •· • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • .. RIPRIPRIPRIPRIPRIPRIPRIPRIPRIPRI PRIPRIPI ! ■ THE '9 .. • GREAT RIP OFF - -. .ii& .. THIS COUPON PERMITS BEARER TO PURCHA,SE ANY LP OR,TAPE ON ANY LABEL IN OUR HUGE INVENTORY i ! • -. $ I VO id A f te r 1 O• 1'• 8 O _ & i th;:;ghlet~!u~et:n°Je:=k SALE ITEMS NOT IN CL UDED. ...---• schedule. Most teams to come into focus now,are butstarting there's still room for more bowlers. For . - . anyone interested in bowling, simply show up at Chacko's East Bowl• - ing Lanes at 4:00 p.rn. on FrJ~~ ■ I ... AV.e:I S ;.I ---------------------------- - '9 ■: GALLERY OF SOUND MIDTOWNVILLAIEONLY ; l■IPRIPRIPRIPRIPRIPRIPRIPRIPRIPRIPRIPRII ! : onatOOD ~~l~~~ 'AV EJ ; , Chuck Robbins... .. ____ 00 ~~~!:~:~~;!~:~ !I ;.• SP:~?£:~:~S ~--------·VALUABLE COUPON:------~ Bowling Results - ~ Charge and Visa 39 West Market Street Wilkes-Barre, Pa. 19701 Phone: 822-1333 FreePar~?a::k:?::' sterling · Proprietor 1 September 26. The lanes are located on the comer of South and South Main Streets. If there any questions, phone Robbie Bale at ext. 422 or call Doug Williams at 832-2406 - everyone's w~lcome. There were some impressive scores shot this week : Chris Kosakowksi443, George Saba-197-446, John Yudichak-234-588, Jon Pliskin-561, Gary Michael-570, Ed Salley-528, Tim Page-225-618, Greg Pypiuk-471, Rich Niklowski-492. The results for the first two w~ks are not yet available. NOTICE SENIORS! IT'S THAT TIME ONCE AGAIN ! There is a meeting of the class of 1981 today at noon in Stark room 1 (or if we're not there, try room 166.) �'\ / . TijGIR~i0ef They were from separate worlds but you'll always remember them together. Wilkes College Wilkes-Barre, Pa. September 25, 1980 Vol. XXXIII, No. 4 • ices,, ' METRO-G OLOWYN-MAYER presents" VOi CES" MICHAEL ONTKEAN . AMY IRVING. ALEX ROCCO starnng Wrotten Dy JOHN HERZFELD · Songs & Score Dy JIMMY WEBB · Produceo Dy JOE WIZAN OorecteO Dy ROBER T MARKOWITZ · AJOE WIZAN Production - METROCOLOR " G. ""cicl LF!!ad r~e. ~B~~ R ~~~ lOflgtnal soundtrack album available_pn ~~E!Berords ano T~ <'.,,~ ,.. =~·--·· ·~ MGM Friday,September 26 7 & 9:30 p.m. in the CPA Admission: $.25 with College ID $.50 without College ID No Eating,Drinking or Smoking Allowed! •· ON THE WAY UP !The cast of Shakespeare's "Midsummer Night's Dream" is enthusiastically 11 preparing for the college's first theatrical performance. The show is set for October 24, 25 and 26. Look "for more information and photos in future Beacons. <Photo by Virginia Baloga l ' J I . l • � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 September 25th Date A point or period of time associated with an event in the lifecycle of the resource 1980 September 25 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/c576709ed5d594a8b525d7d39bbf69a4.pdf 3d3664b92ddd8d01d90e9d937981c6f4 PDF Text Text TljG New Telephone System Designed To lmprove Commu·n icatio.ns @,1 ,, IT TURNS WILKES UPSIDE DOWN - The second annual Wilkes Day at Hershey Park was held on Sunday, September 14. Here Wilkes student take advantage of the thrills offered by the HersheyPark "Sooper Dooper Looper." Approximately 170 students attended the event. (Photo by Larry Corona ). _ h _k • · _ Hers eypar Tr•P---------------,, · · The switch-ov.er to ttie new telephone system schedule(! for Friday, September 19, has been postponed until the end of next week. According to Mr, James Berg, "It doesn;t look like all the work is done." Berg went on to explain that the work probably won't be completed until somewhere around September 18 or 19, This new system is designed to improve both internal and external communications, Internally, the system will generally "speed things up," For example, if you place a call to an office and the line is busy, you can "mechanically leave a message to call back." When the line is not busy, the phone will call back. Externally, there will be no Students Enioy R_!des,Shows ~~:~\~~e~!;;J1 ~~~~ ~r;ti;: when the call is completed, and ' j The day began very dismal and gray as students gathered in front of Stark Learning Center waiting to leave for the second annual "Wilkes Day" atHERSHEYPARK. Approximately 200 students participated in the venture to "Chocolate Town, U.S.A." Three buses were utilized arid they left Wilkes at about 8:30 a.m. Most students went on tour through the Chocolate World to see just how those famous candy bars are made and also to begin munching out on chocolate chip cookies. As the students made their way to the park the sun shone brightly. They wasted nQ_time getting involved. Some headed straight for "The Comet" or the "Super Dooper Looper" while other less courageous participants settled for the Carousel or the MonoRail. One of Hershey's newest rides seemed to become an instant favorite, "The Pirat" was rarely without a Wilkes student riding on board; to some there will be more trunks. (Trunks are the devices an operator uses to "The Trabant" seemed unsettling. A number of familiar Wilkes make the connection between faces were seen at the educated calls.) Overall, this system will cut dolphin and sea lions shows. What down 'on the amount of work an amazing things animals can be operator has to do. Berg stated that trained to do! The shows were a he doesn't know yet how many good way to rest up a bit for the operators will be needed when this next surge on more and more rides; system becomes operational. ' One of the benefits of this new most people made it at the right hour for the shows but some must system is that more people will be able to get through on their calls. have gotten confused. Most other activities included: Transferring of calls will be easier. visiting ZooAmerica, speeding If you dial a wrong number, you can around in the bumper cars or tak- just ''plug in'' the correct one. ing it easy in the antique cars, getAll of the extensions and numbers ting a smooch in the "Kissing have been changed except for the Tower" and eating plenty of great two of the ROTC office. This is due junk food. to the fact that so much of their By the time the buses arrived printed material has their extenback at Good Ole Wilkes everyone sion listed in it. was quite exhausted and really The new system was bought from looked it on Monday. Everyone Commonwealth · Telephone seems to be recovered and ready to Technologies on the basis of a comjoin in again this weekend. - petitive bid, of _which Bell Margaret Scholl Telephone also took part in. Berg Olympic Gold M e d a l i s t - - - - - - - - - - - - - - - - Rudo Iph To Lecftire Qn Sept. 22 The athlete's struggle for excellence has been the topic of many fascinating stories of .dedication and self-discipline. But few stories are as inspirational as that of Olympic gold medalist Wilma Rudolph, who will present a lecture in the CPA under the auspices of the Concert and Lecture Series. Wilma Rudolph was the first woman to win three Olympic gold medals in one Olympiad. She earned the honor of being named United States Woman Athlete of the Year two years in a row, and was the first woman to be named Sports Woman of the Year by the European Sports 'Writers. However, Wilma was able to · acheive those honors and win the gold medals only through a great pies, Wilma can give]ier·audiences deal of hard work. She was born the an inside view of the Games. Her 20th child in a family of 22. While lecture will deal with such topics as still an infant, she was stricken with how the Olympics are run, how polio, and was unable to walk coaches are selected, and how without braces until she was nine athletes get involved. Wilma also years old. But she overcame her offers insight into several issues handicap and went on to qualify for concerning the Olmpics. She, the 1956 Olympics at the age of 15. discuses the debte concerning That year-, she won a bronze medal amateur vs. professionatathletes in in track. Four years later, in the the Games, and deals with the com1960 Olympics, she brought home mercialization of Olympic chamthree gold medals in one Olympiad. pions. In an Olympic year which Wilma has been actively.involved was clouded by the US boycott of in many aspects of the Olympic the summer Games, these should r.ames since she first qualified for · be interesting topics. Wilma will p~nt her lecture at the games in 1956. For instance, she was on the US Olympic committee the college on Monday, September for the 1976'Games. Because of her 22, at 8p.m. in the CPA. Admission deep involvement with the Olym- is free. explained that the college bought the system because "Bell was pricing itself out of the market and not because of any dissatisfaction." Primarily bought in order to save money, this system cost "approximately over $200,000. Over a number of years, there is an expected $300,000 cost save," related Berg. When asked if, in the long run, this change will be beneficial, Berg replied, "Definitely, there is no doubt in my_mind." Berg went on to say that he foresees no major problems with the system, provided people take the time to learn to operate the phones. Training sessions have been going on all week to familarize personnel with the different techniques of this system. "I hope people will take the time to learn how to use them," Berg commented, "and if there are any mistakes, give us the chance to correct them." Lisa Gurka Hon1eco~ing Plans Announced At SG Plans for Homecoming Weekend were discussed at Student Government's meeting. The weekend will consist of a bonfire, Thursday night, October 9; dinner-dance and judging of displays on Friday, October- 10; parade to the Trenton State-Wilkes game at Ralston Field, Saturday, October 11, and an arts and crafts show on Sund.ay, October 12. Chairman of the Homecoming Committee, Al Wirkman, .announced that single dinner tickets will be sold at a cost of $15.00 each and will be available two weeks before the event. The menu choices for the dinner include: chicken, veal, roast beef, or turkey. Plans for the menu will be finalized at the committee meeting this Thursday. Wirkrnan continued that clubs and organizations planning to construct a float or display should submit the information to him by Tuesday, September 23. President Joe Galli then added that -this year a new addition to the parade is being planned. Each club ·and organization will make a flag and lead the parade to Ralston Field. "We have a lot of students on campus and this will hopefully produce good representation of them," he said. Details on this project will be available at a later date. Vice President Marla Brodsky then raised a question concerning the possibility of a Homecoming King in addition to the traditional Queen. The general opinion of the representatives was favorable. Rob Wallace, Class of 1981 President stated, ''It would help increase enthusiasm, especially at this time of year." Further discussion on the issue was tabled until next week .. Nominations for Homecoming Queen are Thursday, September 25. In other business, Jim Makowski, President of the Outdoor Adventure Club made a second request for $135 to purchase equipment for the club. The request passed by a vote of 160-0. . Another fund request came from Colleen Gries, representing the Women's Activities Association to rent buses for away games. This request was for $185 for a bus to this Saturday's game. She explained . that without the funds from SG, the cheerleaders, majorettes and strutters would not be ·able to attend away games. Because the money was needed by Saturday, Galli closed the meeting and reopened it in order to vote on the request. The question was raised why the association was not funded by athletics, administration or the band. Mrs. Doris Barker, SG advisor, explained that the Association is a club and not part of athletics or the band. The marching units are allowed · approximately $600 for uniform cleaning and other expenses during the year. The motion was passed by a unanimous vote. The new campaign regulations under consideration were to be . voted on this week, but because the Inter-Residence Hall Council did not have the opportunity to discuss them, they will be voted upon next week. It was then suggested to cen- tralize the· voting location and extend voting hours in order to give more students a chance to participate. Stark lobby was the area menti~ed as a possible location. After much ·discussion, it was decided that moving all voting to Stark lobby would -congest student traffic considerably more than at the present time. A vote of confidence was taken to keep the Student Center and cafeteria as voting locations, but extend the hours. The matter is now up to Rob Doty and Chris Fellin, Chairmen of the Publicity and Elections Committee. They ·will present their decision at next week's meeting. Elaine Kerchusky, Film Committee Chairperson announced that SG made $118 at Friday night's movie, Continued on page 8 �fa e Z, The Beacon, Se tember ·1s; 1980 Three-Fold Tenllre Document Adopted By TREC Comm.i ttee The Teacher Recognition and Effectiveness Committee (TREC) has adopted a new three-fold tenure document which will go into effect begining this year. "It speaks to the Issue of the criterion which will be used henceforth in assessing the wuality of pel,'SOnnel," stated Dr: John Natzke, Committee Chairman. Three different types of evaluations are included, including peer evaluation, student evaluation, and self evaluation. · Each department wille stablish a "Department Review i;ommittee' which will consist of three tenured persons. When up for promotion or tenure, the instructor will be evaluated, in class, by a committee of his peers. ID addition, instructors will have a chance to evaluate themselves. Under the ICES (Instruction and Course Evaluation System) System, there .is room for twentysix items of evaluation. Three of these items, called global items, are pre-printed ·on teb questionnaire. Teo core items are selected, from the catelog, by the faculty as a whole. The individual instructor can then select the remaining thirteen items, or vote as a department for a departmental core. Dr. Natzke commented, "We are not out to get the instructor; this is not a kangaroo court." He went on to say thet the ICES System serves two different purposes. "First of all, information or feedback is provided to the instructor who wants to improve or monitor his instruction. Secondly, the student evaluation provides information to other people, such as the department chairman." Dr. Natzke explained that the information will be used by the department chairman and people on the Tenure and Promotion Committee in making their decisions. ID preparing for student evaluations, plans were made to sample classes for students to evaluate. The procedure is to evaluate one out of every three classes taught by a tenured professor, and one out of every two taught by a non-tenured professor. · When asked about TREC's goals for the upcoming year, Dr. Natzke replied that there are a few major issues they hope to address. The most important issue is to set up some system to recognize outstanding faculty members. According to·Dr. Natzke, "There has to be better ways of recognizing outstanding instruction in the classroom.'! Dr. Natzke would like to develop guidelines for assisting candidates "The actions of a few students have once again hurt all of the . students. '' This is how CC President Bill Miller responded to the recent act of vandalism that occured to the property of Chacko's Bowling Lanes. "I have to question the maturity level of those students who did this," Miller noted. For the past several days, Miller -has been negotiating with Chacko's to allow students to use that property as a walkway to Park and Lock South. "The Red Cross Building has locked its gates preventing students from using its facilities to get to Park and Lock. We have been trying to establish another way students could get to Park and Lock and we were almosf successful." Miller pointed out that Commuter Council had made agreements with area residents to use their property as well as the Elks Club. Students were to cut through Holleback Hall then through the Elks parking lot and then Chacko's to get to the parking facilities. "We talked to Mr. Chacko who owns the bowling lanes and explained that if he allowed us to use his property we would help pay for a gate to the fence that will be surrounding his property, but that was before this situation.'' Miller said that recently planted shrubs were ripped out of Chacko's property and because onhis there will be no walkway for students through his property. Also at the CC meeting the new election rules were discussed. A question was made by Colleen Gries as to how the new election rules will be policed. SG President Joe Galli said that a random sampling of the signatures on the petitions will be called to verify the matter. Another suggestion was made to remove voting facilities from the student center and the cafeteria to one centralized location such as the lobby of the Stark Learning Center. Dean ·Hoover express· ed his opinion that he was in favor of such a move, as did many of the other people there. ID new business, students were reminded that September 28 is the · Tri-Organizational meeting and that the day before is Parent's Day at the College. It was also brought . out that there will be a Colonel Mascot meeting this Thursday ,a t 9:30 a.m. in the gym. So far four people have applied for this position. Finally, there will be a Leadership Conference for all ·elected campus officials sometime in November. No date has been set at this time. The meeting concluded with a " spirit meeting" as the group sang their rendition of the Wilkes DrinkingSong. Ho~ecoming Acti.,ities Sl(lted _ForWeekend0/0ctol,er9-J2· "Wilkes Colonels versus ·Trenton State Lions," is the theme for the 33rd annual Wilkes College Homecoming. Many activities have been planned for this event scheduled for October 9-12. The activities begin .Thursday with a bonfire and pep rally at 10 p.m. on Ralston Field. . The homecoming queen, elected by the student body, will be announced. On Friday, club and dorm displays will be judged at 7 p.m. The deadline for e~tering is September 23 in the student govern- ment office. Trophies will be p.m., Wilkes will battle Trenton awarded to the winners. State. A party scheduled for SaturA dinner dance will be held at Gus · day night is still in the planning Genetti's on Friday night from 7- stages, and further information will p.m. until 1 a.m. Music will be probe forthcoming. vided by "The Ticket Band" .and Sunday will include "Arts and admission will be 15 dollars for Crafts Day" at 1 p.m. Students and single tickets. · Alumni are invited to attend this The Homecoming parade, with leisurely affair. Local artists and bands, marching units, and floats art students are encouraged to will be Saturday at 11 :30 a.m: Winndisplay and sell their art work. ing floats will receive trophies. Al Wirkman, student chairman of Pre-game activities will be the homecoming, announced that there presentation of the homecoming will be a meeting every Thursday queen and her court. Then at 1:30 prior to Homecoming for all interested students. Wirkman also urges students fo become involved and to build up the homecoming spirit. DOUG FAHRINGER an Revised Payment Schedule Annqanced For BEOG Grant• ,,. Secretary of Education Shirley M. Hufstedler has announced a newly revised Basic Education Opportunity Grant (BEOG ) payment schedule that schools will use in calculating the amount of - individual student grants in the 1980. 81 academic year. This schedule supersedes an earlier version sent to schools in June. NOTICE The payment schedule takes into Due to scheduling problems, Senior Weekend bas been postpon- account the $140 million reduction in funds that will be available for ed until a later~ate. BEOG for the year which began on Division 01 Continuing _Education Adds SeveralNon-Degree Courses Wilkes College's Division of Continuing Education will be adding to its fall curriculum several nondegree courses. Among the courses are Acting Technique, Scene Study, Ukranian Embroidery, Quilting, Arts and Crafts, World Masterpieces, Estate and Financial Planning, Public Personnel Administration and Career Planning. Another non-degree course that is being offered is Introduction to Genealogy-a Basic Course in tracing Family History. Bill Lewis, a 1980 political science graduate of Wilkes will teach the six two hour lip for promotion and-or tenure in gathering and presenting appropriate materials to the Tenure and Promotion Committee, At this time, there are no guidelines for just exactly what an instructor should present to the committee. Finally, Dr. Natzke would like to institute a · follow-up evaluation of this evaluation process and monitor the three evaluation systems in order to see how they are functioning. Dr. Natzke pointed out that these systems are not fixed - if they don't work the way they should, they should be changed. · Lisa Gurka Damage To Bowling Lanes' Property Upsets Commuter Council President classes. The course is designed to help students review, organize and trace data and learn the necessary techniques that-will enable them to do research into their family's history. Lewis will also be teaching two genealogy courses . at Luzerne County Community College. Anyone interested in any of the courses listed above should contact Dr. Mahmoud Fahmy, ·rnrector of · the Division of Continuing Education. Courses are free to senior citizens 65 years or older. Darlene Schaffer NOTICE July 1. Under this reduction each All upperclassmen are reminded student's 1980-81 award will be to get their college ID's validated $50.00 less than he or she would for the 1980-81 school year at the receive if the program were fully registrar's office as soon as possifunded. BEOGs may be used by students to help pay the cost of education at more than 6,000 colleges, universities and postsecondary vocational schools. All of these education institutions have been sent copies of the new payment schedule. The Department of Education also is revising the 1980-81 formula for assessing the earnings of dependent students who apply for BEOGs. Such students are from families whose incomes are so low that student earnings are necessary to sustain the family . Under existing formula, approximately 50,000 applicants in this low-income category were. found · either ineligible for grants or eligi- . ble only for small ;imounts. To ..correct this situation before the beginning of the fall term, the Department will send these students new See Bob,John,and Mike eligibility reports that reflect the revised income assessment forMON .-THURS. 11 A.M .-9 P./li. mula. TUES., WED., The Basic Educational OpFRI. & SAT. portunity Grant program 1s authorized under Title IV of the , 11:00A.M.-5:30P.M. Higher Education Act of 1965, as / a!Jlended. hk~f) SlfJJf)(] • r.(]U~Ii"tt i·1Jr []IJllll]IJflflfllS ~fl[I SIJSlfllllS 288-3751 .,. ) ...., �September 18, 1980, The Beacon, Pa Alumni S.O.S Seminar Scheduled For Saturday S.0 .S. S.O.S. ! The Alumni Relations people are sending out an S.O.S. But the S.O.S. is no distress call, and the Alurnni Relations people are not shipwrecked. S.O.S. stands for "Skills on Survival, " andthat is the title fo a program of seminars developed by Assistant Director of Alumni Relations Tanya April Hallez. The Skills on Survival program allows alumni to return to the college in order to answer questions regarding their line of work, and help students in need of the services their businesses provide. The first S.0 .S. seminar of this academic year will take place on Saturday, September 20 from 10 a.m. until noon in Room 1 of the Stark Learning Center. It will deal with the topic of legal serxices, and torneys will 'come to the program. Tanya Hallez explained that through the S.O.S. program the alumni are helping students by passing on their expertise in their chosen fields . She pointed out that the alumni are giving up their time to help the students, and they are offering their time and services for all the attorneys will be Wilkes alumni. The alumni will be talking about things that are geared to the interests of the students such as leases, contracts, legalities in renting, and common law marriage. Students can also learn how to choose an attorney, what kind of attorney to look for, problems with consumer products, and legal problems involving automobile accidents. As of this writing, at least two attorneys have indicated that they will be present for the seminar. They are,At_torney Paula Quinn and Attorney ~jfford.Cappellini Jr. who is nationdlly famo~s for his role in deprogramrping members of certain religiinJS groups. Also, it is possible ~t several other· at- free. The summer issue of the alumni magazine, The Wilkes College Quarterly, states, " Not only does this type of program. assist the students with their futures, but it also allows alumni to have a meaningful part in the growth of students of Wilkes College." Plans are being made for two or three more seminars in the S.0.S. series for this academic year. On November 1, there will be a seminar on Money Management and Finances, and on January 24, a semin.a r dealing with women and careers will be held Louis Czachor Biology Dialogue Day Slated For Sunday Biology majors--How often have Bio- Dialogue Day was started you complained about some four years ago to improve comcourses. you've had to take? Maybe munication between students and you've felt that there is not enough between students and faculty. The variety among the upper-level many purposes of the day are to courses in the department. Or identify issues and problems conmaybe, you think some are a waste cerning . the biology department, of time. Either way, you've proand to receive feedback from bably done most of your complainstudents about these issues. In addiing to other students, possibly tion to discussing the bio departbecause you didn't feel comfortable ment, faculty and students will also telling your professors about your learn about improving their comdissatisfaction. munication skills to facilitate inIf you are a junior or senior teraction between them . biology major, however, you have This year, bio dialogue day will the unique opportunity of letting be held at Camp Kresge on your professors and fellow students September 21. Busses will leave know what you think about the from the parking lot behind Stark department in a very receptive atLearning Center at 10:30 a.m., and mosphere. The day for you to take will return around 10 :30 or 11 p.m. advantage of this opportunity is Bio at night. Lunch and supper will be Dialogue Day, which is on Sunday, provided. September 21 this year. MARY KAY POGAR - -------------------------, choose your color . . . choose your style .. . it's sculptured chenille terry cloth by Career Club in a carefree acrylic blend. choose from a rainbow range of colors in the "V ' neck pullover, or the four button set-in placket either way you're a sure winner! · select yours today! All Sizes 5 19'i Special College Charge Plan ,.l JOHN •• STETZ Expert Clothier H South Main St. Headquarters for Big and Toll Guys. Wilkes-Barre Phone 129-1914 Student ·c enter Board Discusses Purchase Of Two New Stereos . would rent the alarm for one year, and after that time, if it worked out they would buy it. There are also tentative plans to purchase a large screen television, with home box; for one of the second floor rooms. During a debate over using one pf the front lounges for the TV, Dean Hoover discouraged this use at first, by stating, "If people need a place to sit down and talk, they have to have it." John Moffatt, assistant director, later countered that the students have a " big interest in that TV." Following a brief discussion concerning the funding of the television, the issue was closed. · The next matter of business was the SCB's party, which was decided to be held on September 26, 1980, 1~-..~,..~~~~,..-..~~~Pjfrom 9-11. The Board set the ticket price at $1.50. . One of the final issues was the condition of the Student Center itself. Canonico reported that there was a leaky roof on the second floor, and he had contacted CAREER CLUB® terrific "terry" tops PLAYING CATCH?? Bob Rushworth, Chas Boyer and whoever is hidin eally seem like they got into the action Saturday afternoon at the All ollege Picnic sponsored by Student Government, Commuter Council ter-Residence Hall Council. The pii;nic was held at Konefal's Grove i hase and approximately 200 students were in attendance. It was probabl he last "picnic type day" for a while now that cooler winds are blowing. When the Student Center Board met in Dean· Hoover's office this · week, one of the most prominent topics of discussion was the stereo for the student center. Director Mike Canonico pointed out that two stereos are available to be purchased through funds from CC, IRHC, SG, SCB and the administration. One stereo will be placed on thesecond floor, while the other will provide the first floor and basement with music. Canonico added that the problem now was to find a way of securing the stereos against theft. He then related that he had been in touch with an alarm company which could furnish them with an alarm at a reasonable price. After a lengthy debate, it was decided that the SCB Stereo LP SALE All sa.98 LP's SALE .,. ss.99 Includes All Artists All Labels General Radio & Electric Co. 587 South Main St. Wilkes-Barre, Pa. Music Factory Narrows Shopping Center Edwardsville, Pa. Business Manager Charles R. Abate, ABM, and maintenance, but as of the date of the SCB meeting, nothing had been done about it. Carol Benek, assistant director, also noted other damages in the building. Lisa .Prokarym, assistant director, revealed that she has requisitioned ash trays for the center. Canonico also announced that there will be a new bulletin board for the office. Joe Galli, Student Government President, brought up the idea of organizing a central ticket agency on campus. He said that SG had discussed the idea, and he thought that the Student Center would be a good location for the agency. During analyzation of the topic, Dean Hoover explained that he thought the agency would be a good idea, and that any problems connected with it " can be worked out." This note concluded this week's meeting ofSCB. ELAINE CZACHOR ·c olonel J:ryout ·Meeting Today In The Gymnasium Do you want to promote school SP.irit and enthusiasm? If so, you may want to try out for the Traditional Wilkes Colonel position. The Traditional Colonel attends all college events, such as the All College Assembly, the Homecoming Parade, and athletic events. The Colonel works with the cheerleaders and other squads to stimulate the Wilkes Spirit. In order to become the Colonel, a student must display personality, athletic ability, and energy, which will be judged on a point system during auditions. Candidates must a give brief presentation of their background and tell why he or she wants to be the Colonel. Each candidate- must perform a cheer that emphasizes tradition, spirit, and enthusiasm. A meeting for all interested students will be held in the gym, Thursday, September 18, 1980 at 9:30 p.m. Soon after this meeting candidates will be contacted for auditions. Student Government will provide a costume for the Colonel except for the shirt, cane, and shoes. JENNIFER FROHLINGER �Page 4, The Beacon, September 18, 1980 · · Executive Director of COPUS Welcomes S-t udent Members Students of Wilkes: First of all, let me take this opportunity to welcome all of you back of another exciting year o_f independent (private) postsecondary education. This year there seems to be a sense of excitement and expectation on campus. The anxiety is hlgb and students are eagerly watching to see what is going to happen. As the executive director of the Wilkes College chapter of the Coalition of Independent College and University Students (COPUSWilkes), I would like to introduce to you an organization that is going to make things happen. COPUS operates on the chapter, state and national levels. All three levels are interrelated and important as the decisions made on any one level have a great impact on atT students attending independent institutions. Because of the great financial burden placed on independent college students, COPUS is primarily concerned and involved with financial aid issues. This does not mean, however, that we are limited to these Jypes of issues. On the contrary, COPUS is interested in all issues affecting students ranging from registratiop for the draft to energy conservation on campus. This is the second year COPUS has been in existence here at Wilkes. In one year's time we have become the second most active chapter in the state and we now have real input on the national level, since I was nominated and accepted on the National Board of Directors over the summer. This year promises to make us one of the most active organizations on campus. At our first meeting (today at 11 :00 a.m.) we will be planning activities, objectives and goals at all three major levels. A convenient meeting time and date will also be selected. Our weekly meeting will be moved to late afternoon or early evening in order to give more active students, those often ' tied up during activity -periods, the opportunity to join COPUS. All interested students are urged to get involved. The chapter will be divided up functionally to isolate specialized activity areas such as communications, research, lobbying, organizing, etc. This will allow members to . concentrate on ac: tivities in the areas they are most interested in. Finally, COPUS ·is an organization in which members can control their own destinies. The actual amount of personal input is up to each member. The more active a member is, the greater the satisfa::tion will be. Personal advancement all the way up to the national level is limited only by a member's own iniative. Please try to attend our first meeting today (September 18) at 11 :00 a.m. in the basement of Franklin Hall (located across the street from Weckesser) . For more information contact Richard Meyers, our Communications Director, Carl . Kadke, our Legislative Director, or myself at the COPUS office located on the second floor of Weckesser Hall. Together, we can make things hap- pen. Joe Knox Executive Diredor COPUS-Wilkes NOTICE Wilkes College Id's must be shown at all athletic events. ·c C President Miller Requests Cooperation From ·c ominuters · To the Editor: To All Commuting Students: Since the start of school, we have , received complaints about the closing of the Red Cross gate which blocks free access to Park and Lock South. Over the summer, we spoke to ijle people at the Red Cross who informed us that their decision to close the gat~ was forced upon them by their iDSurance company. Several cars were stolen and other damage was done to the property and in order to keep their insurance coverage, the gate must remain closed. At Commuter Council, we began looking for another route to Park and Lock. With the agreement of the administration, we began to negotiate with the neighbors , USPS 832-080 Editor-in-Chief Patti Sparlow News Editor Louis Czachor Managing Editor Margaret Scholl Asst. News Editor Darlene Schaffer Feature Editor David A. Clanton Asst. Sports Editor Copy Editor Lisa Gurka Asst. Feature Editor Mary Kay Pogar Circulation Manager/ Cartoonist Michele Fidrych Sports Editor Peter Steve Business Manager Vanessa Martz Advertising Manager Michele Serafin Photographer Frank Jeffrey Advisor Dr. Norma Schulman Parrish Hall 16 S. River St. Wilkes-Barre, Pa. 18766 Published weekly during the school year from September to May except for vacation periods and semester breaks. Entered as second class postage paid in Wilkes-Barre. Send form number 3579 to the Beacon, Wilkes College, Wilkes-Barre, Pa. 18766. Subscription rate to nen-students: $4.00 per year. Advertising rate: $2.50 per column inch. Phone: (717) 824-4651 All views expressed are those of the individual writer and not necessarily of the publication or the college. around Hollenback Hall, so that we could use the Holleback yard as a walkway. We had agreements from Mr. Oscar Jones, the neighbor on one side, and the Elks Club and were about to get an agreement from the owners of Chacko's Bowling Lanes. The day before this agreement was about to become a -reality, providing a walkway to Park ~.,d Lock, some students went through this walkway and ripped up the new shrubbery and flowers Chacko's ~ad just finished planting. As a direct result of this action, ther will be no walkway through this area. THIS ACTION OF A FEW STUDENTS HAS HURT ALL WILKES COMMUTING STUDENTS. If anyone know.s the identity of these students, please get in touch with a member of Commuter Council or myself. Commuter Council will begin work on another route to ·be taken, If one can be found . We are asking for your cooperation and patience, because if we work against one another, as this incident shows, nothing will be accomplished. Sincerely yours, William R. Miller President Commuter Council 1n, ~ IIJ~Y::.H "Please check your directory and dial again ... " NOTICE There will be a meeting -of all students interested in trying out for the Colonel Mascot Thursday, September 18 at 9:30 p.m. at the gym. Get out and show some spirit ! Clanton's Article Appreciated By Reader To the Editor: I would like to thank David A. Clanton for his article about 'old people.' I . enjoyed it so much because there were so many true statements in it which should be said, especially by a youngster. , Also I enjoyed the Review of Krapp's Last Tape. The Beacon really came through on some very good articles about the Theatre. Keep up the good work and thanks. Annonymous Charter Meeting Sla_ted To the Editor: Attention all club and class presidents and treasurers: S.G. 's charter renewal meeting will be held September 25 at 11 :30 a.m. in SLC 101. This brief meeting is mandatory for all club ...,d class , presidents and treasurers. At this time your charters will be rf;newed, thus allowing your organizatio~ to receive funds from S.G. for the 19fN>-1981 academic year. Charters of any club or class not present will be revoked. We strongly urge you to attend this meeting.-Thank you for your cooperation. S.G. Executive Council Ana Nunez EDITOR'S NOTE; Because of the importance of this meeting, this annoucement will be published again next week to avoid any confusion as to time, location or date. Criticism And Comment Policy Valid criticisms of articles published in the Beacon will be accepted by the editors ... The criticism must concern the most recent issue of the Beacon. Typed complaints or comments and suggestions of how to alter the situation will be taken into consideration by the editors. These must be put in a sealed envelope along with a copy of the article in question and delivered to the Beacon office on the second floor of Parrish Hall or in the Beacon box in the library by 3:00 p.m. on the Sunday after publication. The appropriate editors will gladly meet with the author of the comment at a mutually convenient time to discuss the nature of the criticism or comment, if deemed necessary by the editors. All letters must be signed in ink along with the class year or approprh1te title, and phone number where the author can be reached. This information will be kept confidential. Any comment bearing a signature or title deemed as fraudulent by the editors after verification will be disregarded immediately. �September 18, 1980, The Beacon, Page 5 -New Sociology Professor Brings . . s: ~thasiasm, Positive Attitude ' • t ' , . ~-.-C:,,---=---.✓.,0r...,CO:,Mary Kay Says ,~✓-= Ir What's HOppening ~..,....,....,.....,.....,c.,-..ococ:ioc::cc,o.::io:ioc:icccoc>Ol::iol)OCICCCO::IOCIOC,,V Sometimes the most momentous study done through actual observa- dialogue, which would involve Olympic gold medalist Wilma Rudolph will present a lecture on the happenings' of our lives come about tion of the family in the home, and teaching through a series of ques' tions and answers by which each Olympic Games on Monday, September 22 at 8 p.m. in'the CPA. This leebecause of chance occurrences. An is not just a statistical study. ture is the first of this year's Concert and Lecture Series. Dr. Goode hopes to continue do- person tries to prove his point. "I unexpected meeting, a sudden phone call or just being in the right ing research while at Wilkes. He would like to use lots of different ·----------------place at the right time can become also wishes to promote research in way of teaching," states Dr. Goode, ·R important. So it was for Dr. David tbe sociology department for he "but it all depends on the studepts" ~ Goode, new Asistant Professor of feels that "researchers are better He feels the quality of the relation- K Starting September 21 and continuing through Octobei'S, the Sordoni Art Gallery will exhibit the work of John Stascek, a native of Wilkes-Barre. Sociology at Wilkes, who first teachers.'' He recognizes, however, ship between the student:; and the Hours of the gallery are Sunday through Friday, 1 to 5 p.m., and Saturdays, began working with tbe mentally that· Wilkes has one of the better professor falls on the students' . 10 a.m. to 5 p.m. retarded because he happened to small departments in sociology, shoulders. However, Dr. Goode is making an walk down the right corridor and and that the department may even look at the right bulletin board. His rival those of some of the Ivy effort to meet the students halfway. One thing he likes most about the research concerning tbe mentally League schools. college is that 1t is the kind of school An alumni sponsored "Skills on Survival" seminar will be presented on retarded eventually led to his docwhere students can go to a proSaturday, September 20. The seminar will start at 10 a.m. in SLC Room 1. toral dissertation. fessor for private consultation. He Dr. Goode received his B.A. and would like to encourage students to M.A. degrees from Queen's College come to see him, and wishes to in New York. His work there was become more- involved with both The First Presbyterian Church will begin its foreign film series with largely statistical, involving mostly residence hall and commuter "Love and Anarchy," an Italian film directed by Lina Wertmuller. The quantitative research. Soon after students. . film will be shown at the First Presbyterian Church, South Franklin Street, t,ie earned his M.A., he heard of an Dr. Goode also stresses that he is on Thursday, September 18 at 8 p.m. Cost is $2.50. unusually gifted professor at UCLA • J happy to be in the faculty. He hopes named Harold Garfinkel...,What he to become a pervasive influence, knew of this professor interested not only in the sociology departhim greatly, so Dr. Goode ventured ment, but also in the school. With On September 19, the Manuscript Society will present "Streetcar Named out to California where he began to his enthusiastic attitude and his Desire". This classic film starring Vivien Leigh and Marlon Brando will be study under Dr. Garfinkel. Arid it plans for the department, Dr. hown at 7:30 p.m. in the Center for the l>erforming Arts. Admission is was in California that he started his Goode should become a very research with tbe mentally retardree. ·• positive influence. ed. ~...oooocr~..r...o"" ✓ .:r. ✓ .,OOCOOOCCOC~ MARY KAY POGAR • After arriving at UCLA, Dr. Goode reported to a job that had Advice to Freshmen .... ~ ........... .. ........................... ........................... . been promised him, only to find that the offer was no longer available. Feeling very dejected, he wandered around the building for awhile. He happened to wander Dr. Day id Goode you In, Do you wanna be just in the right place a~ the right time, . Helloooooooo ...... Frrreshthen ! not the same thing as high school. friends, and When can I see you for as he was walking down one corDr. Goode has many ideas for Glad to have you aboard. No doubt In college no one will tell you when again. ridor, he noticed a small sign on a possible sociology courses. Fot inmemoljies of graduation, summer to take out the garbage (or when to Do not separate your clothes bulletin board which stated that stance, he would like to start a proms, and being told to take out change your underwear ' for that when washing them: In a ruling by research assistants were needed to course about the sociology of the garbage or wash the dishes still matter) . As you can see, there is a the Pa. Supreme Court (5-2) this is work with the mentally retarded. embodiment-to study the physical linger fresh in your mind, but high BIG difference. now illegal. Colored, white, and Dr. Goode saw this as an opportuni- attributes of people and relate them school is a thing ·of the past. You . Do not wear a three-piece suit permanent press articles must all ty to replace tbe job that had been to sociology. This course might inare in college now (as if ¥OU didn't (with matching tie) to lectures be washed in the same machine deniedhim,andheapplied. volve studying images of the body know), several thousand dollars unless you plan to get married imbecause separating them is a violaAlthough he had never worked through the history of art and poorer, and eagerly anticipating mediately following the class, have tion of their right to equal opwith the mentally retarded before, discerning the sociological concepnew challenges, headaches, and .amnesia and think you are the proportunity cleanliness. You do have it was only because he had never tions of the body at that time in social traumas. To help you fessor, or sell used cars at the option of busing the permanent really considered this option. But history from the works of art. This through these first crisis-ridden Calhoun's Lot in Dallas, Pa. press to another machine, provided once he started his research, Dr. ties in with Dr. Goode's belief in a weeks, I have prepared a short, but Do not ask embarassing, unyou do not use a fabric softener Goode felt he had found his niche. direct relationship between the by no means complete, list of don'ts necessary question_s in class such from which the whitener has been Or, as he states, " I felt as if they biology and the sociology of a per(no one pays attention to the do's) as 1'Do you want us to hand in our removed. were my people. I felt as if I were son. ,. which might make your transition homework?", " Can't we take the At parties, never, never, drink comingbome." Along with his ideas for new smoother. These are not rigid, test now? " , or " Can't we all stay more than you can comfortably Continuing his research· with .the courses, Dr. Goode has also thought unyielding rules and will require after class?" throw-up without discomfort or emmentally retarded, Dr. Goode soon of some unique ways of teaching the your input and creative touch to Freshmen, in a sincere attempt barrassment. Many freshmen imrealized that, the only material courses he has now.-He states that make them work. to blend in with the area and cammediately reveal their class rank available on these people involved h~ would _!ike_to set up a Socratic Above all, reali~ that college is p_us life, often reveal their own class when this happens. If this does hapstatistics and quantitative data. He ,-~~;;;;;;;;;;;;;;:;;.;;;;;:;.;;;;;;;;;;_;;;;;;;;;;;.;;;;.;;,;;;;;;;;;;;;;.;;;;;;;;;.;;;;;.;;;;;;;:;;.;;;;;:;.;;;;;;;;;;_;.;;;;;;;.;;;;.;;,;;;;;;~ status. You want to avoid this, if at pen, apologize to the host and tell began to feel that there was a real · all possible, and one good way is by him these are side-effects of your need for more personal studies of not introducing yourself, on a first repressive childhood. When asked the effect of these people on their name basis of course, to the local to leave, do not stumble into stafamilies. trees surrounding the campus. I As a result, he began to study the Bored with contemplating the meaning of life? Then try these winners of know you want to be friendly, but I tionary objects, accidentally fall on actual experiences of families with a recent magazine contest to select the questions most likely to lead to proassure you these trees do not like the record player, or tell the host mentally retarded members by go- longed head scratching: strangers. Wait until you have been . what a wonderful time you had. In1 here a few months and then strike ing to their homes and actually be1. Why can't you tickle yourself? stead, just tell him that the cheese ing with them for several hours 2. A spring is compressed, tied and dropped into acid. Where does the .1 up a conversation. Do not ask them dip needed a pinch more salt. Never be heard saying out loud, every week. During his visits, Dr. potential energy go? what's up, how's the weather, or Goode closely observed all the in3. Why are so many more right-handed than left-handed? would they care for a cigarette, "There's nothing to do," "This teractions betw~n the parents and 4. If a person shaves the hair on his forearm, why will it grow back just to Once they know you, you will see place is boring," "Do you have any tbe retarded child. 1 its original length and no longer? · . . I how much more responsive and money?" Such exclamations will be The result of his observations was 5. A compass needle rests .on a table. A magnetized ball rolls..,around it, talkative they are. dead giveaways that you are a his dissertation on behavioral I tbe compass needle pointing to the ball at all times. When me ball has· 1 When in the cafeteria, do not atfreshman. sculpturing. In it, Dr. Goode gives I traveled completely around the compass, has it gone around the big nee- 1 tempt to eat tapioca by placing Do not skinny-dip · in the Susquehanna. what he feels is an adequate die? spoonfuls, at intermittent intervals, description of tbe family and of 6. Light trav.els at different speeds in di(ferent media. It slows down in your left ear. Use your fork . And lastly, of course, do not use their interactions with each other. when it leaves air and goes into water;. it speeds up when it leaves water French fries and omlettes are not to the Beacon to line your bird cage or Dr. Goode contends that members and goes back into air. But where does the energy come from to speed up be sucked through a straw (excepfish tank. of this family, especially tbe again? (In contrast, a hockey puck slows down when it enters rough ice but lions can be made for students from Freshmen - Have a good year! 1 Philadelphia and utah) . mother, spend so much time with does not speed back up when it enters a smooth region.) David A. Clanton the retarded child that they become 7. If tbe tides are caused by the moon's gravitational p-ull, why ate there I When asked questions by upintimately involved with him or two high tides in 24 hours? · . perclassmen, respond only by givher. Thus, they can predict the 8. Why does the shower certain insist on blowing up against the force of I Ing them your shoe size, I.Q., and NOTICE child's actions with an accuracy tbewatershootingdownandout? I.D. number. Giving out any more that is almost uncanny. What is 1 9. Where does the light go when turned on in a seeled, mirror-lined room? information leave you at the Needed: White card students. most significant about Dr. Goode's 10. What color does a chameleon turn when placed on a mirror? mercy of further embarrassing Please call Ext. 201 or 202 at The Centeffor the Performing Arts. dissertation is that it represents a ,_ questions such as : What dorm are 8 8 8 S I§ ·----------------- ----------------- ~ ~ Living and Eatitlg Well at Wilkes Iers : M,·n d B ong D , 1 will §· �Page 6, The Beacon, September 18, 1980 Gene~ic Enginee~ing: Dream or Nightmare? · A scientist _unites specially selected gametes in a petri dish, then transfers the fertilized eggs to an incubator, and artificial womb, where it will remain for nine months, under 24 hour intensive care. During its development into a human being, the egg and embryo will be given small amounts of new steroid-like drugs to build up its muscles, and the process will continue until the resulting human being reaches adolescence. At age 14, that being breaks three Olympic records. In another laboratory, the same process is duplicated, this time with an aim in creating a super genius. At age 12, that being is solving problems which only two decades before doctorates battled over for days and nights armed orily with brains, coffee, and calculators, unending curiosity and the zest of born again zealots. Fantasy? Perhaps - or at least in our generation - but this is becoming increasingly possibfe -with many religious, moral, political, and other implicatiions. The world when George Orwell wrote his novel 1984' after World War One, had just entered the new age of high technology and scientists all over the world were unlocking time-honored secrets of nature. At that time, Verne's trip to the moon had become a forseeable reality with von Braun and others making significant advances in rocketry. For Neil Armstrong, stepping on the moon "was one small step" but for mankind it was a "giant step." The even more gigantic step of controlling the developmednt of the human e!Dbryo to produce super humans is now at hand. After creating overpopulation, increasing the incidence of cancer, heart disease, and other disorders of modern man, after creating weapons of mass destruction and after setting up social, economic, and political orders which led to strife for some with his technology and desire to change the world, man still remains unsatisfied with non-interference in those areas of nature which thus far have eluded his creations, probes, and controls. True, no sane man purposely laid the groundwork for the problems . created by modern living with an express aim in producing these problems. These men were just not visionary and far-sighted enough. But having made the atom bomb and other things, we _as human beings surely have enough sense to learn from the lessons of our immediate and distant past. While believing in progress, to laud that kind which has potential abuses and obvious deplorable implications for all, seems just as insane as creating it. Genetic engineering (as it has been called) · stands -to better the quality of life if applied only to amoebas and -bacteria, but an extension of this to humans can only lead to untold suffering. Indeed, it is reminescent of Herr Adolf Hitler's desire to create a super - Herrenvolk. This particular gentleman's dreams engulfed the world in war because those who could have stopped him allowed themselves to be led like blind sheep in the belief that they could bring "peace in our times." To blindly watch science - in the name of progress and knowledge create artificial man makes our generation like that of Chamberlain's and Hitler's. Antony I. Sibiya "l))cL(-- - THATIS "TIIE LAST_ "TIME I G-o ·OIJT 12EfbfaTEA 41 42 44 46 47 48 50 Commit a faux pas Judge Drew cl ose Those who shun Other: Sp. River to t he Rhone "Vive le !" Words on a memo pad Lennon's mate Genna n r ul ing house of the Middle Ages Speck of dust Last but Ran out Doubleday or Yokum Boxing great Serum-holding vial Bruce Wayne, to Batman (2 wds.) 2 First unit in a resi dent ial bu ildi ng (2 wds.) 3 "TV Gui de" word for tale 4 Knig ht's cloak 5 Mount Hood ' s state {abbr.) 6 Sky phenomenoh (2 wds . ) 7 Emitter (abbr.) 8 Word for Pennsylvan i a or second base 9 Way to address an English nobleman 10 Half of radio pair 11 Ho Chi 12. Football position 14 Football play · 33 Drunkard _ 36 Regi on en rou te to Hades 37 Newborn goa t 38 Based on experi ence 43 South Pacific loincloth 44 Potato pancakes 45 Toward shelter 48 Long, long time 49 XXXII times XXXIII 51 Speech flaw 52 And others: Lat . 53 monster 54 Christiania, today 55 Large weights {a bbr.) 56 "Ode Nightingale" A~ INVfSTT6'-AT111£ - D ra ft·--- .--------.Lo-------:--------------· Sum mer --- A Nation Prepares Its Youth for War Twenty years old: old enough to vote, too young to drink alcoholic _ beverages (in Pennsylvania ) and, of course, old enough to be drafted. Imagine that, being drafted before I (legally) taste my first draft. Doesn't seem to make much sense, 13 does it? But in the real world of crass materialism and subliminal 1 rape, sense is hard to find, and making change even harder. This summer - amidst riots, hostages, and boycotts - President Carter reinstituted the draft. Patriotism was at its peak and Carter used that crest of ignorance 32 to persuade youth to enlist. I peacefully stomped down to the 35 Post Office and voluntarily registered; failure to register is 39 punishable by up to five years in prison and a $10,000 fine. But, of 42 course, this fact had no effect on my decision. None at all. War seems like a lot of fun. I mean, I've certainly watched enough on television to know what it's all about. The next time you 55 56 witness a movie death, execution, · or massacre, listen carefully. You 58 57 will hear portions of the audience laugh and giggle as the blood 61 60 spurts, heads roll, or bodies con~ Edward Julius Coll egi a~t.:il.e~~-~•---tort. I laughed all the way home ----x•c•R~OS!'ll'll§'"""'.""""55 Wha t Cronkite does ln lS me from the Post Office. (5 wds .) 19 Rocky of the Though I have never fired a gun 1 Food f or Mr. Ed 57 Star ' s demise Steel ers nor killed anyone, I thought, here is 4 What "pri er" means 58 Racket 24 States wi th (2 wds .) 59 Opposite of put, convi ction my big chance to be ~ hero, to bomb 9 Luci lle Ba ll rol e in fina nce 25 From some villages, or, if I'm lucky, to 13 Bi r t hstone 60 Scissor (hereafter) throw my body over a grenade. I 15 In f or 61 Oohs and ahs 26 Prefix: people can't wait, I really can't. awa kening 62 "The Seven Faces of 27 Without control or I suppose, war isn't that much 16 "the Mood f or Dr . " restraint Love" 29 Suff ixes used by fun : but then again, I wouldn't real17 Hair col or (2 wds.) DOWN . Cosell ly know. America has the decency 20 Capi ta l of Chile 30 Road map word (Thank God !) to fight for her 21 Wa l k in wat er 1 Adam 's brother 31 Selected a location 22 23 25 28 32 33 34 35 39 40 wrrn !" r--~....~~~~-----..,.~~ i · i NUMBER9 ,,§ SHOP . i 9 W. Northampton St. i Wilkes-Barre, f>o. 1870 1 i Boutique•Jewelry•Clothes i Layaway Available J We Accept Master Charge & Visa I ! ~ i freedom overseas, on foreign soil. No country (save America herself) has launched a direct attack on Pennsylvania, imprisoned, maimed, or shot my people. America has always had the good sense to fight for her freedom and defend justice for all, thousands of miles away. · As I hav.e gotten to know some foreign students here at Wilkes College, I see that they are good people, much like my native-born 'friends. And, for me, war is no longer a personal decision which affects the lives of a few individuals, but like a cancerous growth has mushroomed into a cloud of dis•aster with the potential to effect everyone on this planet. When you slaughter my oppressed brothers in South Africa - ydu kill me; when you decimate my Muslin brothers inAfghanistan - you kill me; when you murder my Chinese and Indian brothers in the Middle East - you kill me; and finally, when hungry minds go unfed - we all die a little bit inside. America has wounds to heal within her own nation; one need only glance as far as the headlines to Illustrate this point. The rebellions and insurrections during this hot summer of '80 - '- in Miami, Philadelphia, Detroit, North Carolina, California, and New York - are proof positive that all is not well h~re at home. This country· is sick, badly in need of a' cure, or, perhaps, a taste of its own medicine : which indeed would certainly be a bitter pill to swallow. Funny, but here in America, "the free world," I feel very much like a prisoner in my own house. Forgive me, but I do not want to fight ; call me a dastard, traitor, coward, or whatever else your little mind can think of - it certainly doesn't matter. With today's thermonuclear, chemical and biological warfare, I don't stand much of a chance with my rifle and bayonet. It's hard to stab a moving tank and make much of an impression. But then again, as we all know, history has a short memory. Wouldn't it be wonderful if they planned a war and no one showed up? Will the herd instinct, or followthe-crowd mentality, ever be an endangered species on our planet? Unfortunately, this is the land where the Buffalo (once) roamed and, of course, the Home of the Brave so, I doubt it. I seriously doubt it. And yet. .. · David A. Clanton -Puzzle Answers ◄k On Pg. 10 SHAI■ allC SALON Men'• and Women.'• hair 1tyli"11 monlcurN and per!"• Januzzi's-Pizza and Hoagie~ ~ l 25 Ac a d emy Street i ~ i Home Delivery OPEN 7 DAYS 11 -1 l__~ -~-=----J . ,... �September 18, 1980, The Beacon, Page 7 Nursing Department Starts Ninth Yeai-; McHenry Notes Its Purpose And Progress "We go from the simple to the complex, " stated Ruth McHenry, Nursing Department Chairman. Back in June of 1971, she came to Wilkes at the request of the president Francis J . Michelini to initiate and operate Nursing. In a little over a year, McHenry organized the department and in September 1972, 37 students entered the pr:ogram and eventually 25 graduated. McHenry noted " We are in our ninth year of operation, and we have roughly 400 students, 30 fulltime and three part-time faculty members in the Nursing department. " • The nursing program at Wilkes College leads to a Bachelor of Science degree with a major in nursing and reflects a curriculum design that is responsive to the changing needs of society for health care. The purposes of the department are to prepare a beginning selfdirected practitioner capable of initiating and implementing the nursing process on behalf of clients in a variety of circumstances; provide SPECIAL ...DOUBLE SAVINGS on your COLLEGE RING • $10.00 discount on an Ultrium College Ring • Fantastic trade-in values on your old 10k gold high school ring check it out!' a foundation for graduate study in nursing ; and promote the utilization of new knowledge through the provision of continuing educational experiences for . nursing practitioners. The curriculum pattern enables the student to integrate the ,arts, sciences, and humanities with nursing and to choose electives in areas related to personal interests and career goals. It covers a four-year period, totaling 127 credits of which 47 or one-third are in nursing. According to McHenry, the difference between the Bachelor of Science degree with a major in nursing (B.S.N.) is that "a BSN is a watered down course meeting special needs. Special courses are designed for the. nursing students." She added that the ~.S. program is "much stronger" than a BSN. " Our B.S. degree with a major in nursing leads our students to nurse practitioners. This means our students can do complete physicals from head to toe." McHenry warns that you do have to watch the term "Nurse Practitioners" because it can have many meanings. She noted that our program was established in accordance with the rules set down by Health, Education, and Welfare at the time the • program began. Since then, a oneyear nurse practitioner program · has been established for registered nurses. With the new cross registration program with Kings' nursing students may wonder if they can take classes over at Kings for Wilkes credtt. McHenry notes, "that at this time, there are _no plans for any cross-registrations of nursing students with King's college.'' This is because " I am unaware that they have such a (nursing) program." As an integral part of the curriculum, the nursing department also has a Learning Center which gives students the opportunity to ·self.learn with the latest electronic study carrels and audio-visual instructional materials. A simulated hospital environment facilitates independent practice and study. The center is staffed with three faculty members who assist the students to progress at their own · pace. The Center is open from 8:30 a.m. to 8:30 p.m. and is opeh to all nursing students, nursing graduates of Wilkes and registered nurses in the program. McHenry said that other disclipines can use the center if they want to and if it is free. It is estimated that over 1,000 students use .the center, using over 3;300 pieces a month and returning 8 to 900 demonstrations a month. McHenry also noted that over $100,000 has been invested in the center. The nursing program is approved by the Pennsylvania State Board of Nurse Examiners which is the legal body that governs all state programs and is accrediated by the National League for Nursing. . Wilkes was nationally accredited in ~ember of 1978, two years after it graduated its first nursing class. Wilkes accreditation will come up again in six years, but McHenry noted that "the state board can come in at any time to review us." She also pointed out that if "we were to ever lose our state approval, we would automatically lose our national accreditation." McHenry commented that 13 new faculty have joined the nursing department, and of these 13, three are replacing faculty members who have left permanently. As for her own position, McHenry pointed out that she was supposed to retire, but a suitable replace- . ment could not be fopnd. The new department -chairperson would have to have a PhD, but there is a shortage of people with PhD's in .· nursing. McHenry added, " I will not be here after May 31, 1981. After nine years of growth, the department is now as big as the col- . lege wants it to get. In fact, there is a waiting list of people with a desire to get into nursing, because as McHenry said, ' 1We don't want a nursing college with all other . departments subservant to it. '' McHenry talked of expansion, and she pointed out "WI) have been invited by the Hazelton Area to extend our program to the Hazleton Area utilizing the facilities of the Hazleton State Hospital. Louis Czachor Darlene Schaffer -Earth And Environmental Science Dept.--~~--;_ ___ , To Test Contents Of Mine Water The Earth and Environmental Sciences Department of Wilkes College has been contracted by the Pittsburgh office of the United States Bureau of Mines to analyze · samples of mine water in the Wyoming Valley, according to Mike Case, assistant professor of Environmental Science. Mr. Case will supervise the analyses which will be conducted by five students Carolyn Miletta, Bill Petrick, Ed Plesnar, Mike Stapleton, and Eric Johnson. Under the Bureau's contract, Case and the five students will be employed to analyze approximately 650 samples of water taken by the Bureau from flooded mine shafts in the valley. The testing, which is to be conducted on a seasonal basis for one year, is to determine as accurately as possible the levels' of iron, manganeSJ!, aluminum, sulphate, acidity, and eholiform organisms (organisms resulting from underground sewage Pollu- to ORDER I ....... _... Ii! ft PU=A=:,ITH e&:I I Place 10% DISC()UNJ BOOKS'l'CRE s & 26 Date SEPT 2 tion), ·which ·eventually cause acid mine drainage problems. According to Mr. Case, the objective of the testing " is to find out what the composition of the water is in the flooded mine shafts. The Wyoming Valley has many acid drainage problems, and if a solution is ever to be found, the initial look at the problem must start here." This project is not an attempt to solve, but to learn more about the problem. Some of the a~ lyses will be conducted in the field at the site of the mine, as the nature of some of the elements require they be tested.immediately after extraction from the earth. In these cases, by the time the sample reaches the laboratory on campus, the results would not be accurate. The college offers ample facilities to accomodate the testing. Located on the fourth floor of the s iark Learning Center are the analytical water quality lab and the atomic absorption spec- Time 10 - 4 PM Deposit Required $_10__._oo _ _ __ _ I II I I THIS COUPON . I "9KIC . .UA•OII trophometer, the major ,piece of equipment used for metal analysis. These and other facilities are also used to teach routine water quality analysis, examining soils, biological materials, pollution problems and sediments. In addition to providing a unique opportunity for students to receive practical experience in the lab and the field (in a sense their first job) , the contracted analyses will also add an element that fits in with Mr. Case's philosophy of a good education. He believes that a four year Bachelor of Science program, with a major in earth and environmental sciences, should teach a student to . design a sample project, take the sample, analyze it, and interpret and report this data clearly and concisely. This should prepare the student for either graduate studies or entry into the job market, such as technical laboratory supervisory positions. The B.S. degree also w . quires a rigorous curriculum in chemistry, physics, . biology, and mathematics. A student seeking a Bachelor of Arts degree with a primary or secondary major in environmental sciences would find his knowledge valuable in careers such as social work, political science and government, urban development, or communications. JOHN FINN I �Page 8, The Beacon, September 18, 1980 lf~won't readthese · Government ofCIDCP,?... Continued from page I . You probably have the 8tJi. . 1, Change in bowel or bladder habits. . I. A sore that does not 1 heaJ. S. Unusual bleecllilg or discharge. 4 •Thickening or lump in breast or elsewhere. 8. Indigestion or difficulty in swallowing. 8,0bVious change in wart or mole. 7. Naumg cough or hoarseness. 8. A fear of cancer that can prevent you from • detecting cancer at an early stage. A stage when it is highly cur- able. Everyone's afraid of cancer, but don't let it sea.re you to death. . ' ).American Cancer Society Beacon Bits. Student ?signals Ha-rry S. Truman Scholarship Dr. James J . Bohning, professor and chairman of the chemistry department is on leave. During this time, Francis J. Salley will be acting as chairman of the chemi~try <!epartment. Made Available Replacement Elections for all officers will be next Thursday, September 25. Also on the 25th, there will be nominations for Homecoming Queen. "Blazing Saddles." Approximately 474 students attended the film. She reported that student conduct was basically-good, but some debris was found after the movies. Galli stated, "Students should be responsible enough to respect college_ bulldlngs." He continued, " If the conduct becomes a problem, I would not feel guilty about cancelling all SG movies.'' Although a complete report on the All-College Picnic and HersheyPark was not available, Galli reported that approximately 200 people attended the picnic and 170 went to HersheyPark. Galli closed the meeting stating that he was pleased with the student turnout this past weekend and hopes that it will continue throughout the year. ···························· If you are looking for fresh, homegrown produce don't forget the Farmer's Market on Public Square. The Market opens at 10:45 a.m. every Thw'sday and will continue until mid November. · . ...................... .... . Blue Oyster Cult is coming to the Kingston Armory September 25. Tickets are $8.75 each and can be obtained from Joe Nardone's Gallery of Sound. Want a good time? Why not go to the Bloomsburg Fair at the Fairgrounds in Bloomsburg. The Fair will be September 22-27. The John Long Center of the University of Scranton will be the pl~ce where the Dirt Band (formerly the Nitty Gritty Dirt Band) will perform on Sept.ember 19. Tickets are $8.50 and can be purchased at Joe Nardone's Gallery of Sound at the Wyoming Valley Mall. _ A recipient of the Ha,-ry Truman Scholarship may receive up to $5,000 per year for four years of education. To qualify, the student must be a sopholl}.ore in the 1980-81 school year and a j~or in the 198182 school year because the scholarship covers two years at Wilkes College and two years at a graduate school. Candidates may be from any state and have preferably a 3.0 average or better. Students must major in a field which will involve some kind of government service or: study. Law, political science, economics, sociology, business administration, commerce and finance, , anthropology, environmental science, biology, chemistry, and psychology are a few of the majors that would qualify. ~ Interested students contact Dr. Pat.ti Sparlow Robert Freysinger-in the basement ···························· of Franklin Hall, room 10, extension The internationally famous Harlem Globetrotters will be coming to 224 for more information as soon as . King's College on Tuesday, December 2. possible. ·························· ~ -A Wilkes College facultyNOTICE King's College Office of Continuing Education will be offering a series of • administrative committee will be Because of the HersheyPark trip, communication wol'kshops and seminars entitled, "Improving Managemeeting in mid to late October to Inter-Residence Hall Council did , ment Through Effective Communication." The program will be presented select a candidate(s). These cannot hold its regular meeting 9n Sunby Dr. Donald W. Farmer, Director of Administrative Planning. Enrolldidates will~ evaluated by a comday. Meetings will resume this Sun; ment is limited and a free brochure explaining the program is available by mittee in Princeton, which selects day at 6 p.m. in the lower level of contacting Ruth Hosey, Coordinator of Continuing Education at King's Colthe qualified individuals. the library. · lege. • Jennifer Fn>hlinger ;-:.-=====================.J - - - -NOTICE -----. NOTICE .Rules And llegu-l ations Governing Stark Hall HOMEBAKED GOODS. The Ac-- counting and Business Club will hold a bake sale today on the Square · in conjunction with Farmer's Market Day. The-sale will run from 11 a.m. u11t!!} p.m. The Homecoming Committee will meet Thursday, September 18 at noon in SLC Room I. All interested' students are welcome. The menu for the dinner-dance will be discussed at this time. ll·Horse Ale... The following policies will govern security offjce with a list of has been provided with a list signed the use of Stark Hall and Stark students authorized to use these by the Department Chairman LearnlngCenter: , rooms after i :oo a.m. on a which.gives the room, date(sl, and names of students authorized to use 1. All persons using the building · semester-by-semester basis. Each during night time hours who are not student must also have a signed this room. in a regwarly scheduled class must permission slip containing the 7. The building closes at 1:00 a.m. check in at the security station and signature of the Chairman of the and must be vacated except by leave their I.D. cards with the Department of Mathematics and -members of the faculty. No student guard on duty. I.D. cards- may be Computer Science. will be allowed in any part of the picked up when leaving the 4. Students may use the various building after 1:00 a.m_ without a building. Individuals will not be adclub rooms_ Smoking and the. con- permission slip signed by a Departmitted withouf a current Wilkes sumption of food or drinks are not ment Chairman, This slip shall inCollege IJ!· card. Persons found in permitted in any area with the ex- dicate date, purpose, and location the bulldilig without authorization ception of the club rooms. of the student Club rooms and will be ejected and their names 5_ Laboratories will be locked and study rooms may not be used after reported to the Dean.of Student Af. students may have access only if l: OOa.m. fairs and the Dean of Academic Af. with instructor or if they have 8. Two security persons will be on fairs. Faculty may sign in and out received permission on a standard duty; one will man the security staand are responsible for any guests form signed by the Department tion while the other patrols the they bring to the building. UnacChairman. Faculty should be building. Security personnel have he companied guests will only be adaware of the dangers and potential full authority to enforce the regulaorse Ale mitted if their names have been liability from allowing unsupervis- tions governing building use; they given to the security office in aded students to use the labs. Students will forward the names of students Ir,, Adventurer's vance by a member of the faculty. with signed permission slips will who violate the regulations to the ,. h Award ... 2. Classrooms 160, 207, 380, and sign in and q_ut at the security sta- Dean of Student Affairs and the · ~/'• To llomt•nHning (Ju1·t• 11 Jo~· 412 are designated as study rooms. tion but will keep the slips in their Dean of Academic Affairs. . / Nobh•. who: a ul ,·rnll'a)!t· mHI k1ml1k.,._.., ;14:n•ph-d ,111:ik They will be clearly identified and possession while in the building. wi1h Sn~I .. lli).!h\\";llrr- «;r;l\:--1111. Cl:i~, the hours for study will be posted. 6. Any room, other than ,those ~, ·n l Jlt\ h:1111,il~· :-•1q1ri~'< I lint! lh,tl S,:ntt had h,·.irt of ~ohl . J!nud AnyWilkesstudentwithavalidl.D. listed above, may be used by d . ...... ,...11:-t• ul humor anti a f:ttlk·r who u,,·m"fl ~h-~;1 .Hud,:- .~lo\'i1· S1 uc:fo i,:-. Jtl\··, 1i,..._1 mon«: card may use these rooms for students only if th~~l:lritY of!ice "illl1t:1tt1t iutlwfoll . . study; the rooms may not be\l-.,.q,,,q,,t#l.q,'4#"4~~~"'<l~~•.•••••••••••••••••♦ · i' Tiu~ s 1lt1h' pn·:-,(.·111nl h\· t lw :\ dn·•1tmut1!' ,\It·. l.:!•ll1M':-t• .\Ir . reserved by one student or . by a . ♦ ♦ .,_.=. Ex p1:ri1·m·«· t;i!'-lt- h,:~·cMkl tlw group of students. All other PREGNANT? ♦ ast nm11111111ph1n·. Explort• tlk· pl,·,,~nn -:,, 11( l.:!-ll11r!it• ,\Ir h~· «;t"lk.-:-t'\· . • hn·w,·r:,.ol classrooms will be closed and lock?. 4JS. MoinSt., W-B . _ _-~- -:--- . __.""!14"1,.,._ .-\mc·nn•·~ h,..._. :,dlint,!. ;11,· ed. Anyone found in a classroom Without authorization will be Conf1'dent1'al Counse11·ng : dian We have a great selection of Ind- ♦ f ejected, and their names will be tops , skirts, dresses an reported to the Dean of Student AfPregnancy Testing ♦ bedspreads. ♦ · fairs and the Dean of Academic Af: Also leather ~~~dbags : fairs. Alientown ♦ ♦ 3. Rooms 413 and 425 (Computer W , C t ♦ landlubber Jeans. ♦ YourGeneseeMas1erDistributorinWilkes-11arre1s Terminals) areopenaslateasthey omens en er ♦ Allatreasonableprices ♦· Arrow Beer Dist. Co. are needed. The Chairman of the I ( 2 5) 264 5657 ♦ C • d I ♦ Department of Mathematics and . •I • • .... ♦ . ~me In an See US. ♦ Rte. 315, Wilkes-Borre Twp. •the adventurous ale. Ill NEED HELP i **************** s.. E w· 1ng (~ ··::--- · .,. = \\;1~ ,1 · ·· · (;t'llt ':-1.'t ' ll Horse ~ · from Genesee ,.................. Computer Science ~hall provide.the ..,.q..q..,~o.,~~~~""4~,- ll H I\Hl'III Brewers of822-4219 America's best selling ale. In ;1 �September 18, 1980, The Beacon, Page 9 SPORTS Team Seeks lmproi,enient ·······················~···················································· Lopez _R eadies 'Booters' For 1980 MAC Soccer Season -week ... The coach was pleased that his players had practiced on their own over the weekend ... The team will have an alumni game on Sept. 13... Their first match will be away against Scranton on Sept. 13... BOB BUCHSBAUM Cro•• Country Schedule Change �Page 10, The Beacon, September 18, 1980 Volleyball Team Defeats Exhibit. Opponents Before the volleyball team walked on the gym floor, head coach Doris Saracino said she would try different combinations, give everybody a chance to play and get ready for the 1980 season. The Colonelettes did all that and at the same time destroyed every team \hey faced in an exhibition volleyball tournament held recently at the Wilkes College gym. The team could do no wrong as they swept eight straight games from Hazleton, Penn State University at Lehman, and Penn State University at Scranton. The first Wilkes victim was a fairly strong team from Hazleton. The blue and gold had to come from behind in both games because of a few serving mistakes. However, in the middle of the second game they really turned on their after-burners and breezed through the rest of the way. Coach Saracino took"a chance by putting her new players in right at the start. The moved turned out really well as all four underclassmen did a fine job. The team was really off to a fast start when they greeted the Penn State-Lehman campus in their first game. Lehman took an early 4-1 lead and then Wilkes scored eleven straight points on some fine playing by Cathy Dudick and Ellen Doty. Wilkes continued to play well and went on to win 15-5. In the second game Wilkes took an early 5--0 lead. The team made a few errors ll.nd led by only one point 10-9. The Colonelettes then broke away with some excellent sen;es by Freshman Deborah Kramer to win 15-9. When it looked as though Scranton would win the game, Wilkes seemed to change the momentum in their favor. The Colonelettes were a much more organized team than Scranton and the other teams in the tournament. Although Wilkes beat every team twice, they decided to play two more games against Hazleton and Penn State-Scranton. The team had trouble against Hazleton in their first meeting, but things were different this time. Hazleton didn't last long when the blue and gold crushed them 15-3. If you thought that score was one-sided, the team only gave up two points in their next game against Scranton. The Wilkes team really put on an It Can't Be Tllat Bad Coaclll • Dori • S araci DO · Wilkes was really flying high when they met Penn StateScranton. Wilkes struck first by taking a 4-1 lead and the team never let up as they went on l;o win the first game 15-4. It seemed as though the squad was invincible. They made some unbelievable saves and were in excellent condition throughout the tourney. Coach Saracino says that her assistant coach Nancy Roberts deserves the credit for getting her team in shape for the season. The second game was a little closer but Wilkes managed to pull out a 15-12 victory. They played better as the game went on and they were upder control at all times. Cathy Dadick awesome display of talent in their first action of the season. Both coaches will have a tough time trying to pick a starting team for their first regular season game. Every combination used by the coaches did a great job. "They're really playing as a team and starting to take pride in themselves," Saracino said after watching her team win eight straight games. The coach said the team will have to cut down on their mistakes if they are to have a good season. "We started off slow but a strong team effort brought us back together." Two and a half hour practices a day didn't hurt either. The veteran coach was also happy her new players adapted to the college level so easily. Freshman Deborah Kramer was serving like she was playing against a team from the Peoples Republic of China. Freshmen Ellen Doty and Sally Fisher and sophomores Ellen Van Riper and Carol Cigarski also played excellent throughout the tournament. The head coach was reluctant to say how good her team really is, stating "We will have to take one game at a time." The team outscored their opponents 120~1 in the tourney. If they play half as good as they did last Saturday they will be winning one game at a time! Bob Buchsbaum Answers From Pg. 6 H Tennis Team Gains Experience In First Loss Imagine the score tied in the bottom of the ninth, bases loaded and _ two outs. It was that kind of a day when the Wilkes women's tennis team met head on against King's College. A large crowd was in attendance for the match which lasted four and a half hours. Both teams gave everything they had and after the dust had cleared Wilkes suffered a heartbreaking 5-4 loss. "I really thought we had a chance to win," Coach Nancy Snee said after watching her team lose a tough, "down the wire" match. "We had an excellent week of practice and the girls really seemed to be looking forward to it.'' Freshman and first seeded Cathy Price gave Wilkes an early lead by blasting a strong King's player 6-3, 6-1. It was unusual that a freshman was able to beat a senior in her first college match. Price played a well balanced game by attacking the net and hitting hard baseline shots. In the second singles match, Deb Welliver was up against a tough, stubborn opponent. Both players were like two prize fighters trading hard and well balanced pUnches. Although the Wilkes co-captain lost 6-3, 6-2, it was a long match and was not an easy point for King's. With the team score tied at 1-1, Freshman Terry Monseur Jost a marathon 6-3, o-6, 4-6 match. Both players were equal in ability but the Wilkes freshman was unable to regain the momentum she had in Def, Wc.llleer the first set. In fourth singles Beth Groarke was defeated 6-3, 6-2. The King's player managed to win the big points and was able to keep Groarke off balance throughout the match. Down 3-1 after four matches Wilkes avoided trouble by winning their final two singles games. In her first match for Wilkes, freshman Debbie Solowe used speed and determination to outlast her opponent 6-4, 5-7, 6-1. The Wilkes starter won points on speed alone as she forced errors by keeping the ball in play longer. Wilkes evened the match at 3-3 with the help of senior co-captain Peggy Mascelli. Mascelli came out smoking and destroyed the King's player 6-1, 6-2. She hit winners everywhere and was off the court before her opponent knew what hit her. With the team score tied at three, the excitement started to build going into the doubles matches. Coach Snee was worried because the team only spent a few days working on doubles strategy. A short meeting of the coaches and the matches were underway. \ The team of Price and Welliver overcame the constant lobbing tactics of their opponents to win 6-4, 26, 6-3. The King's team lobbed on almost every point and it was tough for the Wilkes duo to get their rhythm. Wilkes needed only one of the two remaining matches to win but Charlotte Fees and Jackie Harney were unable to beat a strong third seeded team, losing 46, 2-6. The stage was set for the final match of the day. The teams were deadlocked at 4-4 and the large crowd of thirteen people packed the stands at Ralston Field to see if Wilkes could upset long-time rival King's. The team of Monseur and Solowe won the first set rather easily 6-4. Then the King's team battled back to win the second set 5-7. At this point the audience was really going wild after every point. The · third set saw the King's squad take an early 4-1 lead. The Colonelettes made a valiant comeback and needed only one point to even the match at 4-4. However the King's team won the ·next two games and their first victory of the season 4-6, 7-5, 6- a - The Wilkes women's tennis team surprised a lot of people in their first match of the .season. Last year's squad did not win a single match all year. The blue and gold gained some important experience in their loss to King's. If anything, the Colonelettes will have an added incentive in their future matches. Peg Mascelli DROP SHOTS ... The large crowd I mentioned before was more than the boys team had all season .. . The team was not upset over their tough loss and will be ready for their riext match .. . King's scored a total of 97 games to 95 for Wilkes ... Wilkes will take to the road against Scranton University today at 4:00... Bob Buchsbaum 0 l1lWOOll ARMY & NAVY 113 South Main St. Downtown Wilkes-Barre ll0WS: Dolly 100.-.-uo,.... - -• ""'"· 10......, , .• aJiµa.~ ... w,-_, Bookancl Record Mart 11 S. Main St • . Wllk.....rre IOOKS-RECOltOS-TAPES 125-4717 Oiff and Monarch Notes DBIIM-C'OIDUIOY -PLUS- . AIMYPANTI PAlffll PANTI fu.l•ANS SWUTSlal'S ~SNalS ._..,._.At -,--,rr.. �Athlete Of The Week Her serve is faster than a speeding bullet, she is able to dive and · makes saves never thought possible. Is it Superman? No, it's Debbie Kramer, star member of the Wilkes women's volleyball team. The former Pittston Area standout was playing a scrimmage game when she was told of her being named· Wilkes · Athlete. of the Week. " I thought I had done something wrong when the coach took me out of the game." Debbie had just finished serving out ~ complete game 05 straight points) against LCCC. The stellar performer had just put on a remarkable show in a tournament held at the Wilkes gym last Satur day. Debbie is a naturaneader on the court and is well liked by her coaches and teammates. The most remarkable attribute of the Wilkes nursing major is that she is only a freshman. In her first college playing action, she was able to put aside the pressure and lead her team to eigbt straight wins in last Saturday's tournament. Debbie was very surprised at being named athlete of the week. " I didn't think I had played that well." The modest freshman added, "I was just glad I was able to help the team. '' Deborah Kramer lettered three Anawer• NextWeek · DebKramer years for the Pittston Volleyball Team and was selected as a most valuable .player of the month. Debbie said she loves playing for Wilkes amf really thinks the team will have an excellent season. The Wilkes team will have a good year with players like Kramer who show so much determination and drive on the court. Congratulations Deb~ bie Kramer for being named the BEACON'S first athlete of the week. Bob Buchsbaum Sports SPORTS NOTICE There will be a meeting· of the Women's basketball team today at , 12:00 in the gymnasium. Anyone interested in playing basketball on this year's team is invited to attend. Those who are unable to attend the meeting but wish to . participate may contact coach Nancy Roberts at Ext. 355 for more information. Chuck Robbins... SPORTING GOODS COMfANY We Accept Master· Charge and Visa Calendar September 18 Field P.ockey Elizabethtown (Home) Volleyball Elizabethtown (Away ) Women's Tennis Scranton (Away) September 19 Volleyball P.S.U. Lehman (Home) September 20 ' Football Delaware Valley (Away ) Upsala (Home) Soccer Delaware Valley Cross j::ountry 39 West Market Street Wilkes-lbrre, Pa. 19701 Phone: 822-1333 Free Parlcing al Hotel Sterling PJ.lurfce'H Proprietor (Away) September '22 Women' s Tennis Lock Haven (Home) September 23 VolleyballScranton (I{ome) MIDTOWN PIZZA . New York Style Pizza We feature Sicilian style pizza squares, serve salads, hot platters and · · cold or hot hoagies. We have speelaltln such as: Hours : 10:00 a .m . to 9: 00 p.m. Sat. 10:00 a.m. to 6:00 p.m . . Last Friday night the Bowling Club had its first league play for this year. To start the year off with a bang, there were a couple of 200's · shot. Tim Page bias ed the pins with 235. Jack Kijek fired a 202. Both Jon Pliskin and Bill Petrick fired a 200. Karl Blight started the season right with an impressive 547 series. For the girls, Robbie Bale rolled a 178 and Kathy KQlp fired a . 174. We are asking for new members. Don't let these high scores fool you. You don't n~ a high average to join. In f act, you really don't have to know how to bowl. For the most part, we're only out for a g~ time. So, join today. For more information call Robbie Bale at ext. 422. STANDINGS: Doug's Misfits Poky's No Names The Aristocrats 752Crew The Force Avengers Decaying Human Flesh Dr. Driscoll'sDiplomats Genni Cream Ale Across from Bishop Hoban Ph. 822-7045 coupon ' -Imported . . .rs- -Cold...,._ - 4fSouth Main Street PHONE 829-7740 , Bou,llnfl Results SXr~A t>'f ~£,1tt ~\)£, ~ ·· - ~ - One of the most over-worked sports topics t hat always seems to arouse everyone's interest is the question of whether or not moder_n-day athletes are better than their colleagues of yesteryear. How many times have you. heard people comparing Brooks Robinson to Craig Nettles, Walter Payton to Gale S~ri. or more recently the Pittsburgh Steelers' Dynasty to that of the old Grei~ay Packers? , . . Whether you are an avid sports fan or not, you can t help gettmg mvo!ved in one of these "old-new" comparison arguments. Those of you who believe in "the good ole' days" fight till death for the honor of your idols, while the "new-breed" of sports fans cherish the ground their millionaire athletes walk on. · Knowing very well that there are many people out there who love " the good ole' days," I still must follow my better judgement and defend the side of the modern athlete. . Although I agree that the "older" atb.l etes had more quality as far as specific players are concerned, the average quality of mode~ ~thletes is much better than it was in the past. This may account for the difficulty one has when be tries to compare the performance of, for example, Muhammad Ali to Joe Lewis or Jim Thorpe to Bruce Jenner. E'ven though these comparisons may be valid, the defense of the old-timers alway~ seems unbeatable. How can someone argue against " they had more guts m those days" or ".they were playing for more than money back then?" See what• mean? The irony of this type of defense is that, in all probabi~ty, it is true. Sports bas beeome more sophisticated through the years, with technology playing a greater' part year after y~ar. Back in the old,day~, Cy Young. didn't have a speed machine to tell him how fast he was throwing as Nolan Ryan does today. Added to this luxury, the baseball Young threw was probably of a lesser quality than the one Ryan uses today. game after game. Differences like.these occur in all sports varying from the size of the play~ ing fields, to the type of material the athletes uniforms are mad~ of. ~hen looked at from the technical aspect, modern athletes sure have 1t easier to excel in their sport than the old-timers did. So why do I still consider modern athletes better than the idols of the past? As I mentioned earlier, the key is in the, word " quality." To make it to the top in any sport today takes a lot of talent, but more ~o. it takes a lot o~ luck. Think how many times you have seen one team beat another simply beeause of the bounce of a ball, a shift in the wind, or a bad decision ?o the part of a coach. Although these things also occurred in the past,. their frequency bas increased greatly with each year we progress into the futu re. This is partly due to technology, but more so to the over-all improved quality of the athletes. Tbs distinction between your star athlete and your average athlete today is far less notable than it was in the past. A person bas to be a sort of "Star" just to make a professional team, proof being the1ocal baseball tryouts held this summer by the Cincinati Reds. Many fine athletes fell by the side when the dust cleared that sunny day. One can't help but wonder how many of those same baseball players would have "made the team" back in 1932 ! I must say before I end that I do have a place for the old-timers in my heart, a place reserved for those who play the sport for the sport's sake. I honestly believe that back then, the thrill_of victor!, m~ant _mor~ !o them than the paychecks they received for their "work. It is this spmt that I feel our sports lack today, and we can only hope for-its return in the fut~re . But with all loyalties aside, when it comes to one of those comparison arguments, my money will be on the guys and gals we are presently watching and those who have et to arrive ! DECKOU R'S BEER Stromboli, Calzone, Sausage Roll and Parmigiana Turnovers . Buy a large pie for with this $4.35 and receive a small pie FREE. OK, · guys, the girls have been stumbling over male-dominated quizes in the " BEACON" for the last couple of years. Now let's see what you men can do with an allfemale quiz. I. What was the highest score in a women's international field hockey match? 2. Jan Todd holds the two-handed dead lift record. At wl\;lt weight did she set the record? 3. Who won the 1975 Individual International Cross Country Championship? · 4. What is the lowest score shot in a L.P.G.A. tournament for 72 boles? 5. Who holds the official world record for the 100 meter freestyle swimming event? · 6. Who was the first woman to qualify to drive top fuel dragsters and in what year did she qualify? 7. In what sport is Joyce Hoffman the only woman to win more than one world championship? 8. Who is the fastest speed skater and at what speed was she clocked? 9. What distinction does ice skater Janet Lynn hold over all · other female athletes? IO. Anne Davison of Great Britain was the first woman to achieve what astonishing task? ij~T~Wo Explratlon Date UH -80. Call in Advance lot Kegs and Quarlets (Must have LCB Card) IT'S ALMOST GATE TIME - After numerous weeks of pre-season practices and scrimmages, the Blue and Gold will finally open the 1980 football season this Saturday against Delaware Valley at the "Aggies" home field . Delawai:e Valley lost both of its previous games, first t~ Washington and Lee by the score of 12-8, and then this past Saturday to Widener College by the score of 23-0. Last season, the Colonels beat Delaware Valley by a score of 13-3 at Ralston Field. Kickoff time for this Saturday's game is I :30. The Colonels return home on the .27th of September for their home opener against Lycoming College. �.............................. ............. .... .. ................................ ~ ~ ·I ~ Date _ . Voices · , House Calls ~ Alien Kentucky Fried Movie- I j· J: ~ C a _g. u j ~ ~ = ! ~ i ~ ~ 1981 First Semester ~ Illbt : ~ Stu-d ent Government Film Series Schedule 1980 ~- f~ ~ TheOnionField Cartoon Nite -9/26/80 10/3/80 11/1/80 11 /7 /80 Times 7& 9:30 p.m. 7 & 9:30 p.m. 7& 9:30 p.m. 7 & 9 p.m. 11/21/80 . 12/ 13/80 7&9:30p.m. 7 & 9 :30 p.m. - ~ Location ~ I~ ~ ~ CPA ~ CPA SLC 101 ' CPA ~ I , ·cPA ~ SLC 101 g ~ Secon d Semest•c c,, a The Champ 1/23/8 l 8 p.m. CPA - : Kramer vs. Kramer 1/30/81 7 & 9:30 p.m. CPA ;!" Family Plot 2/6/81 7 & 9 :30 p.m. SLC 101 ~~ The China Syndrome 3/13/81 7 & 9:30 p.m. CPA ' The Kids Are Alright 3/27/81 7 & 9:30 p.m. CPA ~ J•~-us Christ Supe_rstar 10/81 7 & 9 :30 p.m. SL_ C 1O1 ALittleRomance 4/24/81 --' 7&9:30p.m. SLC101 ~ Admission $.25 with Wi'lk_e ! ID $.50 with.out ~ilkes ID ~ No Food,Drinks or Smokmg Allowed Du rang Films ~ I 4L .............................................................................. ................. ~ ·"- t ~ � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 September 18th Date A point or period of time associated with an event in the lifecycle of the resource 1980 September 18 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/62b64629a2b79cbe8f409f9f871d97f2.pdf c76709e85581bef17e516fc2f77950ae PDF Text Text College Undergoes Benoa,atiOns During The Summer Montlas ban Development) funding for a ed for a parking area and some landscaping will be done. new dorm. The most appropriate Ramps to accomodate the hanlocation for thfs dorm is in the area dicapped were installed at Chase of Butler, Susquehannek, and Hall and the Gymnasium. Darte Shawnee Halls. These, buildings Hall, Pickering Hall, and the Gymwere scheduled for demolition, but because of decisions still pending at · nasium received new roofing. The ' Gymnasium · also had new state and national levels, the colbleachers and lighting installed, lege will hold off on demolition for and was painted. Restrooms in the near future. Renovations and Pickering Hall were.renovated. changs are being made in order to make the college more cost effec- · A major change which occurred was the transformation of the YMtive. CA into Minor Hall. The rooms The move of the Educ-ation were insulated and new furniture Department to Stark Hall set the was moved in. On a whole, the YMstage for the demolition of Butler BLAZING NEW TRAIL! Since the demolition of the old Com·mons, the CA was renovated into a dorm Hall. ROTC, in the near future, will lawn area behind Chase has been landscaped and new sidewalks added. facility. follow the move of the Philosophy Also seen are the ramps constructed on the side of Chase Hall. Landscaping Is being done in the Department. Dean Shaw stated, "It area where the old Commons was is very likely Koycan Hall will be located, but is not, at this time, taken out of service." Another hall completed. This location will · that has been taken out of service is become · the new courtyard. Dennison, and it is scheduled for Sidewalks were laid, and shrubbery demolition. This area will be utilizand benches will be placed in this area. Also coming soon will be the installation of a bulletin board, which will be placed in the most apthe sale of single tickets for the New campaign regulations are propriate location. This location under consideration by Student Homecoming Dinner-Dance. This will be determined in the next few Government. Presented by Vice sparked some discussion among the weeks. _ members of SG. Selling single President Marla Brodsky, the rules Dean Shaw estimates that the allow tickets breaks tradition by allowing pre-printed . campaign total cost of these renovations will materials to be used for elections undergraduates to attend the affair be "approximately in the excess of supervised by Student Governwithout an escort. Galli felt this was one-half million dollars." Opera- . ment. a good move for two reasons. First, tional money, which is set aside The rules also force a candidate since the money to subsidize the each year, will go toward the finan- to obtain 50 signatures for nomina- dinner-dance came from student cing of these renovations. Other tion. Candidates for the SG fees, each student should be allowmoney comes from grants from ·presidency must obtain \ 200 ed an opportunity to attend. Second, foundations. signatures; CC andIRHC presidenhopefully, this would alleviate Lisa Gurka tial candidates must obtain 100 crashers. He added that no crasher signatures. CC President Bill Miller would be admitted to the dinnerNOTICE stated that many attendents of the dance. A vote of confidence was Anyone interested in working on CC meeting felt that this would taken and the matter is now up to this year's Homecoming Commitdiscourage students from running the Homecoming Committee. FACELIFT FOR KIRBY - Refurnishment of, Kirby Hall over the sumtee should meet Thursday, for an elected office. SG President It was decided by unanimous vote mer included roof repairs, replacemenf of windows, and hydrocleaning the September 11 in SLC ~oom I at Joe Galli hopes that this move will to institute an official Student exterior. · noon. get more students involved in the Government newsletter. This would election process and result in peopublished periodically contain.All-College Assembly- - _..; _ ....,- - - - ----- ----- - - - - - - - - - - --- ple who really want the office. The be ing policies and happenings within proposal was tabled until next week SG. Marla Brodsky feels that many when class representatives would things happen in SG that students present input brought back from are unaware of. The representerested students, Galli mentioned class meetings. tatives generally Jelt that a Apathy, the all-college picnic, in the gym included repainting and eight important items; 1) the In other business, James newsletter would inform the and the second annual HER- the installation of a new lighting Adopted Bill of Student Rights, 2) Makowski, president of the Outdoor students of events, policies and proSHEYP~K trip were just a few of system. There are also new bandissatisfaction with Stark regula- Adventure Club requested $135 to cedures utilized by SG. Galli stated, the topics discussed at the first All- ners and bleachers. tions, 3) the importance of atten- purchase outdoor supplies for ·the "Anything Is worth a try on this ,The president concluded by urgCollege AS§embly for the academic ding the Concert apd Lecture Series club. He stated the total cost of the campus." year. Rot>,ert S. Capin, president, ing people to take pride in their inevents 4) the Colonel Mascot selec- supplies is $220, but the club intends The Student Government Used was the first to express his disap- stitution and to be enthusiastic tion this Friday in the gym 5) stu- to raise the remainder through Bookstore will be closing Friday, pointment that there was not a al'Out Wilkes. "Avoid walking on dent representation on faculty com- various projects. The request will September 12 at 4 p.m. Students larger crowd present. "I am here the grass and littering. Participate mittees 6) the initiation of a chering be voted on next week. may pick up thier books at the SG for two reasons, " the president in extracurricular activities. Let's section.at football games and 8) the Another fund request came from office beginning Monday. stated. "First, to try to bring some make this a great year at Wilkes.'' theme that the student leaders have SG Treasurer To_m Rooney, who reGalli stressed the necessity of Joe Galli, president of Student spirit and enthusiasm to this camadopted for the year -- "Mutual quested $100 to help subsidize the student adherence to the alcohol pus, and second to develop more Government, then took the time to Support and Cooperation." co.st of the band for the All-College policy. Violations of this policy communication between ad- · explain upcoming activities such as In a further attempt to spark picnic Saturday. CC and IRHC con- could lead to the forbidding of the All-College Picnic sponsored by ministration and people. " some enthusiasm and spirit, the tributed $100 each. The total cost of alcohol on campus for all events. President Capin encouraged SG, Commuter Council and Interacademic deans and housing office the band is $300. Since the money He called for support from the SG everyone to take part and par- Residence Hall Council at Konefal 's personnel joined the s~udent ..yas needed by this weekend, a vote representatives in assisting to enticipate in extra-curricular ac- Grove in Chase this Saturday. To leaders on the stage for some rous- could not be tabled until next week. force this rule. tivities. "We must begin the year add to the action-packed weekend ing Wilkes songs. Participation was Galli closed and reopened the In an attempt to begin an enwith great enthusiasm, " he con- the second annual Wikes Day at shaky at first, but by the time Dean meeting so a vote could be taken on thusiastic sports season, Galli clostinued . ..'We can work together to HERSHEYPARK will be held on Ralston did his "GOOO Wilkes" the request. It passed by a vote of ed the · meeting by having all better the institution." Capin then ' Sunday. At this point the crowd of 16-0-0. cheer, the crowd was receptive and representatives in attendance sing explained some of the renovations students were visited by two furry The Homecoming Committee, all participated in the Alma Mater. the Alma Mater and other college that took place on camus over the characters from HERSHEYPARK. chaired to Al Wirkman proposed son1gs. In an attempt to inform inPatti Sparlow Margaret Scholl summer months. The renovations Wilkes College has undergone some changes this past summer, and some of these char.ges are still continuing. "There were lots of significant changes made - some visi!)le and some not so visible," commented Dr. Andsew Shaw, Dean of !'danagement. According to Dean Shaw, the most important of these chantes is a new digital telephone system which "modernizes the communication system." This system will become oeprational this month. During the course of tilt summer, five or six separate contractors were at work on various phases of programs in order to get most of the work finished before sc;hool opened. All of this work is being dong in conjunction with long-range plans to restore college buildings. In addition, the college has submitted a proposal for HUD (Housing and Ur- Apathy, Hers heypa rk and Picnic Discussed -N ew Campaign Regulations Under Considecation By S G �Page 2, The Beacon, September 11, 1980 IRHCTreasurer Nominations Being Accepted Unfil ~pt. 2 J Working under the mutual cooperation and support motto, the Inter-Residence Hall Council members discussed projects and changes for this year. One of the changes is the establishment of apartment residents. Another change is the initiation of a lunchtime coffeehouse starting October 14, 1980. A coffeehouse will be held once a month at the Student Union Building with the-objective of bringing commuters and resident hall students together. There will also- be an Outstanding Residence Hall Award, which will be given to the most well-rounded and enthusiastic resident hall. The goals of the award are jnteraction between resident halls and stimulation of more enthusiasm between residents halls. A Student Advisory Program has .... t!.:-- IIUEScotW<oN,-.TIIS· GET l'NVOLVEI! GET INVOLVED- Commuter Council's sign says it all at Club Orientation Day held last week as part of the New Student Government Orientation Program. This day gave each club. or organization a chance to --Show "shopped around" on the lawn ·next to the Student Center where clubs set up tables containing promotional and informative materiais. Approximately 30 organizations participated in the orientation. (Photo WP Wk Your .;;:;;;;_;;:~;~=; Be~in i N-. been set~up in cooperation with Dr. Gerafa Hartdagen. If a student has a legitimate complaint he may go to Dean Hartdagen in order to change or enforce school policies to remedy the complaint. · N~minations for the position of IRHC treasurer are open due to Andy Harluk's resignation from the position as of September 21, 1980. Don Burch was nominated. The nominations for the position will be open until September 21 , the next meeting of the IRHC. . It was announced that the roller skating party held last Thursday was a success with over 200 people attending. The meeting ended with the singing of a short cheer for Wilkes which brought out the spirit of council members. Colonel Spiritlll wu~~'!_'!•~~ ~J!,.'!!!la_'!~fil~'f!~'!, n have been selected for admission in September to Hahnemann Medical . .College in Philadelphia, according to Dr. Ralph Rozelle, dean of health· sciencesatWilkes. This group is the seventh class to be chosen since the initiation of the program in 1972. The students will now spend three . years at Hahnemann Medical College studying the basic and clinical sciences. The final year will be spent at Wilkes and at Wilkes-BarreScranton area hospitals. The students who will be going to Hahnemann are: Richard J. Cassidy, son of Mr. and Mrs. Richard J . Cassidy, Endicott, N.Y., is a graduate of Union Endicott High School. At Wilkes, he was a member of the Human Services Committee. ' Daniel J. Glunk, son of Mr. and Mrs. Robert Glunk, Salladasburg, Pa., is a graduate of Jersey Shore Area Senior High School. He most recently served as president of the sophomore class and was a member of the Human Services Committee. PauI-J. Hughes, Scranton, is the son of Mr. and Mrs. David Hughes. He graduated in 1969 from Scranton Central High School. He has worked at the Fr(endship House Children's Center and at Moses Taylor Hospital. • E. Mark Johnson, son of Mr. and Mrs. Edwin Johnson, Dallas, graduated from Dallas Senior High School. He was a member of the Human Services Committee and theBiology Club. Kimberly Kresovich, daughter of Danville,. is a graduate of Danville High School. She participated in the Freshmen Studies Program and worked in the biology department.. Diane Kushner, daughter of Mr. arid Mrs. Joseh Kushnmer, Plains, graduated from Bishop Hoban High School. At Wilkes, she was a member of the Human Services Committee. Gerald Levandoski, Jr., son of Mr. and Mrs. Gerald Levandoski, · Danville, is a graduate of Danville Senior High School. She was a member of the Human Services Committee and worked as a . teacher's assistant in the chemistry · department. Patrick Murnin, son ·of Mr. and Mrs:- Michael Murnin, Vandling, Pa., graduated from Forest City Regional High School. He participated in the Human Services Committee and · served on the Freshmen-Sophomore Dinner Dance Committee. Frank C. Olshemski, son of Mr. and Mrs. Charles Olshemski, Wilkes-Barre, is a graduate of Coughlin High School. He was a member of the Human Services Committee and the Biology Club. Timothy Palmer, son of Mr~ and Mrs ..Thomas Palmer, Montrose, is a graduate of Vestal Senior High School. He was a student Government Represent;itive and treasurer for the Human Services Committee. John Perry, son of Mr. and Mrs. Gene Perry, Endwell, N.Y. graduated from Maine-Endwell Senior High School. He was vice- u~ Tryoat fort~• Off lclal Committee and a squad leader for the emergency Alert Team. · Joseph Sabadish, son of Mr, and ,, · · Mrs: John Sabadish, swoyersville, graduated from Bishop O'Reilly ~ High School. He was a member of the Biology Club and · the Photography Club. Thomas Talkowski, son of Mr. ~ and Mrs. Thomas Talkowski, t 51 Hazleton, is a graduate of Hazleton 'P •• •: High School. He participated in the Emergency Alert Team and the ~ Human Services Committee. · I!:>---__ Mary Torporcer, daughter of Mr. and Mrs. John Torporcer, Edwardsville, graduated from Wyoming NOTICE Valley West High School. She was a Girls! Take this great opportuniNUMBER 9 member of the Biology Club and the ty to get involved! Find out exactly SHOP Human Services Committee. 9 w. Nortl)ompton St. Stephen 'v.eyce, son of Mr. and what the oldest organization on THETA DELTA RHO · Mrs. Stephen Voyce, Simpson, Pa., campus, SORORITY, is all about. Attend the Wilkes-Borre, Po. 18701 is a graduate of Carbondale Area Member - Get-Together, Boutique•Jewelry•Clothes High School. He was the sophomore New 12, Friday evening at class treasurer and a teacher's September the Annette Evans Alumni House - r Layaway Aval/able assistant. between the Student Center' ,and J We Accept Master Charge & Visa Susan Wenslow, daughter of Mr. and , Mrs. Robert Wenslow, Stark Learning Center, at 7:30 p.m. Plymo!lth, graduated from Wyoniing Valley West Hign School. She was a member of the Biology Club and chorus. Jill Winslow, daughter of Mr. and Mrs. Wa!ter Winslow, Blanchard, Pa., is a graduate of Lock Haven Senior High School. She was Human Services Committee. 125 Academy St reet John Ziminski, son of Mr. and Home Delivery Mrs. Henry Ziminski, Shavertown, graduated from Lake-Lehman High OPEN 7 DAYS 11-1 School. He was a· member of the Biology Club and a teacher's assistantinchemistry. " Wilkes Mascot. Friday, Sept.12: a In the Gy• -- -- -·.--:fil r-------~------i I ! i i I i I ! I ~ L ______ _l · Januzzi's Pizza and Hoagies er....,_,,__._,...,~..o-..r..r~~.,~..o-.,-...,.....,....,.--e,-..r...o'"'..r..r..r.....-.✓.,,.-.....-..,.-...,....,.-..,....,....,...,....,.....,..~..,.....,.....,....,.....,....,...,...,.._,.....,...;-~..r~.✓.:-~...00""".r..r.r.-oor~...or.r...or.r.r.r..r~~~....-~Q,""'_,..-4' J•lffl. . Just Us Friday Night , Folk Rock-Guitarists & Vocalists The college crowd loves them• come and see why Corinne and •Joey are packing them In at JIM DANDY'S Try one of our Giant Gourmet Burgers 21 dlff Jim . erent varieties served Dan Y 5 _ seven days a week. -. - - --~ ~ - ·: . c,-..c,_ _ :;r.,r..r...co--...o--...o'"'.r..O-..,,C,,-~.,......co"'~..0-~...0--..r~~....co"'.r~~....-....-...........J""JCr..000,-...CO,,-J.:>OOrJCY~.r..r...ooer~.,,.,,-.,...,or..,-...,o,_ Dandy's . . Mark P1aza, • Edwardsv1 11 e d' · §Si\ �September 11, 1980, The Beacon, Page 3 Debate Union Awarded Honorable Mention members in the form of an official Over the summer, the Debate resolution. City Council, President Union received notification that it received honorable mention and an .Robert Prawzik, made the motion to •honor Wilkes and the motion engraved plaque for its proposal received complete support from the submitted to the 12th Annual Phillip entire Council Chamber. The Morris Marketing-Communications resolution in the form of a proCompetition. clamation stated in part " ... that CiThe team of Norm Witko, Patti ty Council extends the heartiest Sparlow, Michele Fidrych and congratulations to the Wilkes ColDarlene Schaffer, under the superlege Debate Union also known as vision of Dr. Bradford L. Kinney of 'Kinney's Kids' for their excepthe Speech Division entered the tional records in the field of debate competition this past academic and for the recognition received school year. Competition officials through their knowledge and reported that more than 250 schools abilities." The resolution marked of higher learning entered the nathe first time that the city governtionwide contests and that Wilkes ment of Wilkes-Barre has honored a finished in the upper percentage of Wilkes organization for bringing those that entered. recognition to the city as well as to The Philip Morris ·competition is the institution. designed to provide an opportunity Darlene Schaffer for students nationwide to sharpen their marketing and communication skills. The program is aimed at , establishing an informative channel for students to recei~ the opportunity for realistic and practical experience by being in direct contact with the business community. The focus of the project was for the If you have a problem or school to pick one area from corporate responsibility, marketing, grievance with a traffic violation, promotion, college relations and there is now a committee to which governm~nt regulations and to you can turn. The newly formed relate it to the Philip Morris In- Traffic Council has been establishcorporated Industries. Philip Mor- ed " .. .for the purpose of serving as ris is one of the world's largest the mediator and the original tobacco industries and producers of disciplinary committee which deals with parking and traffic violations beverages. In addition, as a direct result of on campus and in campus controlltheir past accomplishments and na- ed lots." According to Joe Galli, SG Presitional recognition, the members of the Debate Union were honored by dent, "This is a type of grievance the city government of Wilkes- committee. Now the students can Barre. The City Council saw fit to talk to a committee on which other honor Dr. Kinney and the Union students, not just administrators, serve. This is a first." "There was no set pattern of where you were able to park when you had exNOTICE MEMBERS OF THE CLASS OF cessive traffic violations," remark1981 ! This is your last chance to ed Bill Miller, CC President. "This speak up and let your opinion be is a uniform way of handling these heard concerning senior activities, problems." Janine Tucker, IRHC the Junior-Senior Dinner Dance, President, commented, "Everyone Senior Week and of course gradua- supports everyone else ; everyqne is tion! Luckily there is a class working together.'' This committee will cover both meeting today at which you can express your ideas. The meeting is at resident and · commuter students NOON in Stark Learning Center who have any parking or traffic violations on campus lots. Parking Room I. See you there! ! ! garages, such as the Park and Theater Offices Move To CPA: Seigfried Notes Other Changes ' ' ' "We have the potential of being the best liberal arts program in the country," stated Jay Siegfried, the new Director of Theater, explaining the changes happening to the theater department. Back in April of 1979, Siegfried was hired and assigned the task of developing the theater program. Within a year's time, Siegfried has developed the program from a theater arts concentration to a theater arts major. In addition, enrollment has grown from three students to over 20 students. "It is a crucial year, '' noted Siegfried, "but with the talents of our students and the experience of our faculty, we can go a lot farther than any other school in the area." The major in theater arts introduceS' the student to the fun- damentals of theater and provides opportunities for the development of skills in performance, production, design and criticism. It also prepares students for teaching and for graduate study and it may lead to a career in professional theater. Siegfried points out that the theater program also offers students methods of self-expression while giving students practical experience. "We show students that they must be responsible to someone or some group rather than just themselves and we encourage their creativity. We also give the student l'!lal world experience by working with real people in real settings and with real problems.'' Serving both the community and the students, the theater program is in its second planning stage. Newly Formed · Traffic Council To Act As Grievance Conaaaittee Bookancl Record Mart 11S. Main St • . Wllk...larre BOOKS-RECORDS-TAPES 125-4717 diff ond Monarch Notes Lock, will come under Traffic Council jurisdiction only in extreme affairs. The Traffic Council was formecl. by Dean Lampe, Joe Galli, Bill Miller, Janine Tucker, and Fred Daniele. It will be made up of five members -- three students and two administrators. The students are appointed by the Presidents of Student Government, Commuter Coun- cil and IRHC. Thus far, two st~dents, Maurita Gries and Fred Daniele, have been appointed. A third student has yet to be appointed. The two administrators will be appointed by the Dean of Management, Dr. Andrew Shaw, and Dean of Student Affairs, Dean Ralston. They will be appointed in the near future. Lisa Gurka t Traffic Council Purpose : Traffic Council exists for the purpose of serving as the mediator and the original disciplinary committee which deal with parking and traffic violations on campus and in campus controlled lots. Membership: Membership of the Traffic Council shall include: 1. the Parking Committee Chairman of Inter-Residence Hall Council; 2. the P{lrking Committee Chairman of Commuter-Council; 3. a member of the student body who is a full-time student in good academic standing and is appointed by the President of ~tudent Government ; 4. a Student Affairs Council member appointed by the Dean of Student Affairs; 5. an administrator appointed by the Dean of Management. Referrals: Referrals to the Traffic Council may be made by authorized personnel of the Park and Lock garages with whom the student organizations of the College have come to an agreement. The Council may meet at the request of: A student who is charged with a violation and feels that it is an unwarranted accusation. B. The representative of the Dean of Management. C. The authorized personnel of a Park and Lock garage. NOTICE D. The Dean of Student Affairs. SG Social Committee ApplicaSuch meetings will be held.at the earliest opportunity after the request , tions are out in the bookstore and has been submitted to the Personnel Office. library. The last day to apply is Written notification will be retained by the Traffic Council, and a copy Sunday, September 14. Get involvwill be placed in the appropriate counseling Dean's file. . : ed in Student Government and find The Traffic Council shall determine the times of regular meetings. It will out what's happening on campus also be concerned with traffic and parking regularions of the College. Furbefore it happens. Interested thermore the Traffic Council is obligated to make recommendations yearstudents should return the applicaly to the ~ppropriate administrative officers regarding policies governing tion to Corinna Bender or Leigh Major in Sterling Hall or call 829-9754. · traffic and parking. In no instance does the Traffic Council have jurisdiction over complaints with regard to : 1. meter parking; 2. city ordinam:es governing parking : . 3. Special parking arrangements. Appeals of decisions of the Traffic Council are to be made to the Student Holiday Services Affairs Council. Best Wishes lor a New Year! All students are welcome for Rosh Hashanah Thurs. & Friday, Sept. 11 & 12 7:30 a.m. Yom Kippur Eve Friday, Sept. 19 6:45 p.m. For Home Saturday, Sept. 20 1:31 a.m. Hospitality 12S-Mlt OhavZeclelcSynagogue please call 122-5737 242 S. Franklin St. NOTICE Due to the HersheyPark trip on Sunday, the BEACON staff will meet GD Saturday at2:00p.m. in the Beac• office, Parrish Rm. 27. New reperien are invited to attend. NOTICE All upperclassmen are reminded t& get their college ID's validated for the 1980-81 school year at the registrar's office as soon as possible. Already the theater department under the supervision of the Language and Literature depart- ment has acquired a separate budget and has moved all but one of the faculty offices from Kirby Hall back to the CPA. "We have all of our offices in the CPA except for one," noted Siegfried. "Klaus Holm's office is located back near the stage, Bruce Phair's office is in the reading room and both the department secretary's and my office are located on the first iloor of the CPA. We haven'tfound an office over here for Michael O'Neil yet, but until that time, students can go to his office on the second floor of Kirby." . Siegfried pointed out that Phair and O'Neil are new people who have been added to help improve the program. "Michael O'Neil teaches three theater courses and one English couse and has a good background in dramatic literatre, while Bruce Phair serves as our program and production coordinator. The new director of theater pointed out that although he is in charge of the theater program and all that it implies, "Klaus Holmes is in charge of the scene design and is technical consultant." Confident with the faculty and the students of his department, Siegfried began to thank all the people who are supporting the theater program, especially the Department of Language and Literature and Dr. Thomas Kaska. "Jay" as his students call him, ex- . plained that "Dr. Kaska was instrumental in the formation of the theater program.'' Looking to the future, Siegfried forsees the theater becoming a separate deparment that will hopefully be offering scholarships to its studenls. Currently the department gives out two awards; the Myvanwy Williams Theater Scholarship which is presented · each year to a student who has demonstrated outstanding interest and ability in drama and the Wilkes College Theater Award presented annually to the senior who has contributed significantly to the development of the theater. In addition to the scholarships, Siegfried hopes to offer students from one to four credits for participation in the theater and its productions in a course called Rehearsale and Performance. "We are · also hoping to offer season tickets to all our performances and to advertise in advance all of the performances we plan to do throughout the year." The theater department will be sponsoring several plays through the year. "Although there won't be a joint Wilkes-King's play this year, we will be doing a Shakespearean play, a play by Philip Bosakowski who is our writer in residence, a musical and still yet another play." The next scheduled play is Shakespeare's "A Mid Summer Night's Dream." Overall Siegfried notes that he is very happy with the progress the program has made in just one year and he feels that "with the talent of our students and the experience of our faculty, we will develop even more." Darlene Schaffer �Page 4, The Beacon, September 11. 1980 ••••••••••••••·•••·••···•••••·•••••H••••••• Wake Up! ,\t,\'f~ :J: LUC~~ \-"1~£5- ,h~r~ 's N rt~i. "When you wake up, get up. And when you get up, do something!'' is the slogan of Morehouse College, Dr. Mar- Acu'tT\hKG Claairpersons Titanic Staff To the Editor: To all the staff members and · workers who helped in the new Student Orientation, thank you for your participation and cooperation. Your efforts were greatly appreciated and played a great role in the success of the program. Thank you and good luck, Fred Daniele and Sheri Crea, Co-Chairmen, new student orientation Lefter To The _EditorPoliq Letters to the editor • :e welcomed from all interested parties. Letters MUST be typed neatly and submitted by 3:00 p.m. on the Sunday before publication. . Letters may be delivered to the Beacon office, second floor of Parrish Hall, or the Beacon box in the library before this deadline. All letters MUST be signed IN INK, but names will be withheld upon request. Class year and-or appropriate title should he included -~Ith the signature. This status will be verified by the editors. Any letter bearing a signature and-or title deemed as fraudulant by the editors after verification will not be published. Editorial discretion will be used in all cases, especially where questionable language Is usea. All letters will be published as written, without corrections (except for the preceeding case), and the views expressed in letters are those of the author and not those of the Beacon or college. Criticism And News Editor Louis Czachor USPS 832-880 Comment Editor-in-Chief Patti Sparlow Policy Managing Editor Margaret Scholl Asst. Sports Editor Asst. News Editor Darlene Schaffer Feature Editor David A. Clanton Copy Editor Lisa Gurka Business Manager Vanessa Martz Advertising Manager Michele Serafin Asst. F~ature Editor Mary Kay Pogar Circulation Manager/ Cartoonist Michele Fidrych Sports Editor Peter Steve Photographer Frank Jeffrey Advisor Dr. Norma Schulman Parrish Hall 16 S. River St. Wilkes-Barre, Pa. 18766 Published weekly during the school year from September to May except for vacation periods and semester breaks. Entered as second class postage paid in Wilkes-Barre. Send form number 3579 to the Beacon, Wilkes College, Wilkes-Barre, Pa. 18766. Subscription rate to non-students: $4.00 per year. Advertising rate: $2.50 per column inch. Phone: (717) 824-4651 All views expressed are those of the individual writer and not necessarily of the publication or the college. Valld criticisms of articles published in the Beacon will be accepted by the editors. The criticism must concern the most recent·issue of the Beacon. Typed complaints or comments and suggestions of how to alter the situation will be taken into consideration by the editors. These must be put in a sealed envelope along with a copy of the article in question and delivered to the Beacon office on the second floor of Parrish Hall or in the Beacon box in the library by 3: 00 p.m . on the Sunday after publication. The appropriate editors will gladly meet with the author of the comment at a mutually convenient time to distuss the nature of the criticism or comment, if deemed necessary by the editors. All letters must be signed in ink along with the class year or appropriate title, and phone number where the author can be reached. This information will be kept confidential. Any comment bearing a signature or title deemed as fraudulent by the editors after verification will be disregard- ed immediately. tin Luther King, Jr. 's alma mater. Although Morehouse College is geographically removed from Wilkes College, th~ basic philosophy of its motto is not. Recently, club day was held, giving each student a chance to join the particular organization which interested them. The day was an overall success for the clubs. Afterwards, each organization could sport a long list of new ·members to add to their rosters. But how successful was it for the students'? How many students actually took advantage of the opportunities afforded them on that day? Taking into account the total student population of the school in proportion to the population to each club - our guess is not that many. This is despite the fact that every club from A to Z participated in the event. Almost every group, hobby and special interest was-represented that day. Extra-curricular activities are what add the extra Hfe to the college. Not participating in an activity not only detracts from what could be a spotless academic record, but also leaves a void which might have been filled with a meaningful activity that would not only brighten college days, but give you a chance to explor.e horizons not available in the classroom. It is very unfortunate for the students as well as the college that scores of students go through four years of college without ever really knowing what is available to them. Apathy only breeds more apathy. This is damaging both to · the students and the school. The school loses out on potential talent; input, and possible improvements. The student misses the opportunity" to find his or her forte and channel it in a constructive direction. Initial student input determines what dividends the activity can return to the student. In the end, benefits far outweight the investment of time and energy, more than two to one. The next time you see something that you don't like, or wish there was something to do - stop and think what efforts you made lately to improve the situation. If you're unable to answer the question, you can still join the organization that is right for you. But you better wake up and do it fast. It's not only later than you think - it's sooner than you expect. Submitted Material Policy Campus club and organization officers take note: The following standards will apply when submitting material for publication in the Beacon. 1. Include the type of affair being conducted. Give complete details regarding admission ..fees, entertainment, refreshments, etc. 2. State the time, day, date and location of the affair. 3. c List names of committee members responsible for organizing the affair with proper titles, if applicable. 4. All information for publication MUST BE PRESENTED TO THE BEACON BY THE SCHEDULED DEADLINE IN ITS FINAL FORM ! Material should be in the Beacon Office, second floor of parrish Hall or in the Beacon box in the library no later than 3 p.m. on the Sunday before publication. It should be typed in double spaced format on 8'fl x 11 white paper. This rule will be enforced and the editors reser ve the right not to include any information received after this deadline or not in the specified format. Adverlising Poli~y 1. Advertiser and advertising agency tisement accepted by tlie publisher is contained if failure is due to acts of God or government, accidents, lack of newsprint or . other circumstances publisher, including · text, representabeyond the control of the Beacon. tions and Illustrations of advertisements 3. The Beacon shall not be liable for erprinted, and for any claims arising from · rors Qr omissions in, or failure to insert, · contents including, but not limited to, any advertisement, for which it may be defamation, invasion of privacy, responsible, beyond cost of actual space copyright infringement, plagiarism, and, occupied or to have been occupied by In the case of a preprinted insert, defi- . item in which error or omission or failure cient postage. to Insert occurred. Advertiser will be en2. 'The Beacon shall not be liable for titled to refund of advertisement price or failure to print, publish or circulate all or Insertion In next Issue, at advertiser's opany part of any Issue in which an advertion. will indemnify and hold harmless the Beacon,.its editors, officers, contractors, and agents for all contents supplied to �...,...,....................... . ••califomia Suite" Features Comedy and Fine Acting What would we see if we could whole play.,,.She seemed to totally watch the guests staying in a L.A. become her . character, perhaps hotel, without being noticed. Sup- more so than any other performer pose we observed the people in a in the comedy. She captured the ausuite in the hotel on three different dience's hearts and won their adnights - would the people we saw mira~ion with her amusing, yet senlead interesting lives? Or would sitive portrayal of the vulnerable watching the guests be boring? Diana. Tue final act featured two visitors Since most of us can not fly out to California, walk into a hotel room from Philadelphia staying in the and just watch the occupants suite the morning before a without being arrested, we might relative's bar mitzvah. Scott Clarke played the husband, Marvin never know what it would be like. Fortunately for us, however, a Michaels, who wakes up in the morgroup called Showcase Theatre and ning to find himself next to a young a play by Neil Simon called and pretty but unconscious woman, "California Suite" have made it . played by Dianne Klein. The possible for those of us iri Wilkes- woman is a prostitute with whom - Barre to watch what happens in Marvin has spent the night. Since rooms 203 and 204 of a posh hotel in she had consumed six marguaritas and a bottle of vodka the night L.A., on three separate nights. "California Suite" is a three act before. Marvin realizes she wili comedy about three difft!tent sets probably not wake up before his of people who occupy the hotel suite wife arrives from . Philadelphia on separate nights. The audience later that morning. Marvin goes shares in the seriousness and in the about·trying to wake the woman up silliness of the personal problems or hide her so his wife will not know which the characters face during he had spent the night with a prostitute. However, his wife does their stay. The comedy is the first Showcase come in before he can move the Theatre production ·this season. girl, and hls atteinptsto conceal her Directed by Joe Kelly, and featur- from his wife are hilarious. Scott portrays the frantic Marvin ing a fine cast of local actors and actresses, the production proves with a great deal of humor, thus adthat quality entertainment is ding to the audience's enjoyment of the situation. His wife, played by available not only in large cities. Contributing a great deal to the Sheila Saidman in the second of her audience's obvious enjoyment of two roles in the play, reacts to. the the play, were the performances of discovery of the prostitute with exSheila Saidman. Sheila had two pected shock and anger. Sheila's roles; that of Hannah Warren and portrayal of the righteously angry Millie Michaels. In the first act, wife was exceptional. Overall, the play provided some Sheila portrayed a sophisticated, intelligent woman who traveled to excellent entertainment. Many of California to bring her daughter the situations that come up are inback to New York. The girl had run herently funny, but the most enaway from home to her father in joyable aspect of the comedy is the California. The scene in the play in- ever-present wit in the dialogue. volves Hannah's meeting with her This is what makes "California ex-husband, Bill, to discuss Suite'' a play worth seeing. Two performances of the play whether Hannah should force their daughter to return to New York will be presented this weekend at Church Hall. Shows start at 8 p.m. with her mother. Sheila handled her role as Han- and will be presented on Friday and nah well, and played the snide, sar- Saturday, September 12 and_ 13. castic career woman convincingly. Ticket are $3.50 each. Convincing, however, is not the word for Mel Evans, who played Art Gallery Displays Bill Warren. He seemed to have a • little difficulty relaxing . with his Work of A Ivar Aalto · part - he did not come across as the laid-back Californian he was . Currently on display at the Sorsupposed to portry. However, this doni Art Gallery is a photographic was his first appearance with survey of the work of Alvar Aalto, Showcase. With a little more ex- an architectural designer from perience, Mel could become a fine 'Finland. The exhibit is at the actor. gallery on loan from the Smithso· Playing the visitors from London nian Institute. in the second and most enjoyable Mr. Aalto's work is significant in act were Duane Engelhardt as that his architecture seems to~w Sidney Nichols and Mary Ellen from a site and become an integral Evans as Diane Nichols. The couple part of the natural surroundings. was staying at the hotel the night of His use of natural materials like the Academy Awards. Diana had wood and copper help to create this been nominated for an award, and effect. He was the first of the this act of the play takes place just modern European masters to use prior to and then just after the natural materials in his architecawards ceremony. Although this ture. Among the factors which have inpart of the play was not quite as humorous as the first part, it was fluenced his style are the harsh more entertaining, due to the per- weather of his country which formances of the two actors, par- demands firmness and durability, ticularly of the vibrant Mary Ellen. and economy, resulting in his attenThis performance marked tion to practicality. The exhibit has been on display at Duane's initial appearance with. Showcase, but this was not evident - the art gallery since August 23. It from his acting. He played the calm will continue until September 17. and supportive Sidney with ease. The hours of the gallery are Sunday However it was Mary 'Ellen who through Friday from 1-5 p.m., and dominated this · seene, if not the Saturday 10 a.m. to 5 p.m. · Sep&emlller 11, JM, TIie Beacon, Page 5 =me~ r;;;:.~:;,~n7"~7 ROTC <Reserve Officer Training Corps) has a new Pr,>fessor of Aerospace Studies - Lieutenant Colonel Bruce L. Burke. An ROTC graduate · 'of the University .of Akron, Akron, Ohio, Colonel Burke has been serving the United States AirForceforseventeenyears. Colonel Burke began his duties inthe Air F(jrce as a student of Aerospace Munitions at Lowry Air Force Base. His teaching experiences include courses in Electronic Data Processing, Computer Techniques, and Chemistry. I ________________ _ 1--~.ocr..r..r..r~...ocooooccr.AOCOOOCoc:IOC~.ci I T_ Tsi;her fkirst film of the Student Government film series, "Blazing Saddles,., ~ will be shown on Friday Night, September 12 in the C.P .A. Shows will start ~ at 7 p.m. and 9 p.m. • · The Wilkes and Friends Ch~mber Players will have its firs! rehearsal of the season on Thw'sday evenmg, September 11, at 7:00 p.m. m the Chorus Room (Room 2) of Darte Hall at Wilkes College. ' String players who are interested in joining the _Chamber Players are in2 vited to call Dr. Herbert Garber at the Music Department of Wilkes College (824-4651, ext. 343) . . §' §R ________________ _ ~ . . _ . 8 An all-college p1cmc, sponsored by SG, CC, and IRHC, '.Ntl! be_held at Konefal's.Grove on Saturday, September 13. Busses to the p1cmc will leave Sfrom the front of Stark Learning Center at 12 noon and 1:30 p.m., and will return to the college at 5 and 5:30 p.m. Tickets for the picnics are $4.50, and § § I I § § The Second Annual Wilkes College Day at HersheyPark will take place § areonsaleatthe~~~~oo~:o~~---------- ~ on Sunday, September 14. Busses will leave from the Stark Learning ~ Center at 8: 15 a.m., and will leave HersheyPark at 9:30 p.m. Tickets for ad8mission to the park are $7.75 for the first 500 students, and $9.75 for others. Bus tickets cost $5.00. Tickets are on sale in the SG Used Bookstore. I IiI The New Album Spotlight on WCLH for September 17 is Get Out ~live by Iron City Houserockers, and the Golden Rock Album Spotlight for September 18 is Go For What You Know by Pat Travers. Starting time for bothalbumspotlightsisl0:05p.m. / . i Lt. Col. Bruce L. Burke, PAS. The colonel commented that he sees the cadet corps growing. Before being assigned to Wilkes, Colonel Burke noted that the cadet corps was a squadron, but now with 120 members the squadron has grown into a Group. Colonel BUrke hopes the corps can become a Wing, which require:; 220 members. There is only one major difference between the Air Force and the civilian world, according to Colonel Burke, and that is the fact that Air Force people wear the same suit every day. Everyone in the Air Force is given teh same treatment and pay, both of which are based on grade or rank. ROTC is open to all Wilkes students. Feel free to visit the ROTC office, located in Koycan Hall. NOTICE WCLH will hold its first annual GENERAL MEETING on September 11, 1980. It will be held at a.m. The location of the meeting will be Darte Hall, room 201. All members are asked to attend. 11:15 NOTICE / The CC, IRHC, SG AH-College Picnic will be held September 13 at Konefal's Grove in Chase. Tickets are $4.50 and may be obtained from the SG Used Bookstore from 10 a.m. to 4 p.m. Buses will provide transportation to and froQl the grove. The buses will leave for the grove from Stark Learning Center at noon at 1:30 p.m. and will depart from the grove at 5:00 p.m. and 5:30 P:m. t §ll ~~r:;~ A photographic ;e-:Or~~::;A~l~.~ ~e~ign architect, is n display at the Sordoni Art Gallery through September 17. Hours of the allery are Sunday through Friday; 1-5 p.m., and Saturday, 10 a.m.-5 p.m. ::cr..r..-ocr....o----=---.,.o,---=---..o-...oor..r..r..r.-o""..r.-oc,o,-.,c,---ocoo--...o=ocococol "I Tell 11ae• l',n aLIIJercalAru Major" And then, of course, they say : how quaint; and what are you going to do with that? What am I going to do with it? as though these four phenomenal years were an object I could cart away from collegea bachelor's degree across my back like an ermine jacket, or my education hung from a ceiling on a string. What am I going to do with it? Well, I thought perhaps !'d put it in a cage to see if it multiplies or does tricks or something so I could enter it in a circus and realize a sound dollar-for-dollar return on my investment. Then, too, I am exploring the possibility of whipping it out like a folding chair .at V.F.W. parades and Kiwanis picnics. I might have it shipped and drive it through Italy. 1 Or sand it down and sail it. What am I going to do with it? I'll tell you for one thing: I'm probably never going to plant sod around it. Yousee, I'm making it a definitJve.work: repapering parts of my soul that can never be toured by my friends; wine glass balanced In one hand, warning guests to watch the beam that hits people on the head when they go downstairs to see the den. ' You don't understand I'm using every breath to tread water in all-night swimming competitions with Hegel, Marx, and Wittgenstein; I am a reckless diver fondling the bottom of civilization for ropes of pearsl; I am whispering late into the night on a river bank with Zola; I am stopping often soaking wet and exhausted, to weep at the Bastille. What am I going to do with it? I'm going to sneak it away from my family gathered for my commencement . and roam the high desert making love to it. Carol Jin Evans (Appeared originally in The Chronicle of Higher Education. Reprinted with permission. Copyright 1980 by The Chronicle of Higher Education, Inc.) · �Page 6, The Beacon, September 11, 1980 SadYou·ng Men A-re Growi_ng Old ing at least five breathless miles away from the scene of a crime, I sion, and retirement .checks add up thought I was going to die. Age to one month's rent with enough seems to sneak up on us in a momoney left over to feed myself and ment when we least expect it and, my dog? Will I drink away the catching us off guard, stuns us with its ability to adapt to unfamiliar exnostalgia and painful memories? In this plastic, consumer, ob- periences. This is the challenge of solete, throw-away society, grow- growing old: finding life in reality ing old frightens me. Our old people which is no longer new and holds are choking, starving, and- dying · few, if any, surprises. Old people from a lack of love and much need- never die, they just get bored to ed attention - attention which this death. "KRAPP'S LAST TAPE"-Cllris Lonstrup listens intently to an iliAnd what is old? Perhaps old is society seems unable to give and teresting part of the tape. unwilling to provide because many knowing how precious life is. That's feel that one outlives their probably why old people aren't usefulness after reaching a certain - drafted. Perhaps we are born old age. Growing old ca.Ii indeed be and youth is a state of temporary 11 insanity. Perhaps old is the balance hazardous to your health. What is old? A state of mind or to birth. I suppose, we would be body? Once last year, during finals perfect if we lived forever, and yet, some feel living for the moment can week, I felt old. I remember back in high school, immediately after be a perfection. Perhaps perfection "Krapp's Last Tape" was viously felt at ease with his role. wrecking the family car, I'felt very is a protection used by those to live replayed Friday night by Chris Categorizing the play is difficult. old. A~ut six years ago, after runn- forever in a moment. To look at the sun and feel old; to touch the Earth Lonstrup for a special encore per- One can call it neither a comedy nor and feel old: to smell the flowers . formance at the C.P.A. The Samuel a tragedy. Very simply, it is about a and feel old; to taste the sweetness Beckett . play was originally man's life, or maybe lack of life. of honey and feel old; to talk to an presented as a summer theatre pro- Krapp bas not allowed himself to duction earlier this year. Assistant live fully, but rather than regretold person and feel life. Professor of Theatre Arts Jay ting this, he seems satisfied, or at · There is so much life, energy, and love in the lives of the old. Maybe Siegfried directed the play, witti least reconciled to it. As Krapp great success. himself says, as a younger man, we young people are supposed to The play involves an 80 year-old- "Perhaps my best years are gone cherish and care for the old, to protect the old, protect the ways of the · man who listens to tape recordings - but I wouldn't want them back." Whether rich nations should or should not supporf poor nations in their he made 30 years earlier. Chris Although the play can not be old. We have difficulty understanendeavors to cast the yoke of their poverty away is a question which has gave a convincing,performance as termed a comedy, there are some ding the old because we really come to be increasingly discussed in international circles, especially in the both characters - the 80-year-old comic elements in it. Chris carried weren't there and they really aren't United Nations. The questions stemming from this issue are many, and man on stage, and the SO-year-old these out very well, as naturally as here being young at the same time these have become the focal point in varied attempts by poor nations to on tape. he played the more serious we are (or are they?) . Yet, we all span the North-South chasm. · • "Krapp's Last Tape" is an segments. Overall, one can say that grow old one day, one hour, one Some poor nations have often demanded aid from richer nations, and unusual play in that there is really Chris is a well-rounded performer. minute at a time, with each passing these demands have been-based on a number of claims. When Cuban Presivery little action taking place on Some members of the audience breath. Sad young men are growing dent Fidel Castr~ came to the U.N. not too long ago, he delivered amidst stage. Essentially the actor does felt the play dragged at times, but old, and that's the cruelest part. the cheers of "Third World" delegates, a long and bitter tirade against ri<!h exactly what the audience does that was due entirely to the nature Perhaps, old is all those things I n~tions on their obligations to poor nations. But how much is the question of listens to the tapes. However, of the play, not to any deficiency in mentioned, and, of course, all those ~1d one of benevolence and how much is it one of moral or other obligabecause there is so little action, the the acting. Since the play has so litthings I forgot to mention. No,I tions? Perhaps the answer to this question can best be found if one traces lone actor is the focal point of atten- tie action, it is understandable that doubt it. Old is beyond comprehenthe origins and causes of poverty among some nations. sion. There is po comparison to be- tion, and the audience closely wat- some parts would be less than exSome "Third World" intellectuals have blamed their poverty on colches his facial expressions and citing. However, such a play is not ing old. No finer example I can onialism and contend that when Europe especially; thrust its colonial tenbodily movements, more so than in without merit, if one is willing to think of. Crap! I can think of tacles all ove~ !he globe, an era of exploitation without any attempts .to -other plays. This close scrutiny,:tlid listen closely to discern the enhance the hvmg standards and develop the economies of the colonised . nothing ... David A. Clanton not seem to unnerve Chris. He ob- significance of the play. ' nations dawned: In effect, to use the words of Idi Amin Dada (ex-President of Uganda), "They have milked to cow without feeding it." With col:.ocrJ.:IOCr..r.-o-~ ~ ~ onialism, argues this group, came a Il!,yriad of other problems - social If you can sit noble as a stone ~ ~..,i~;. ; dislocations, new orders, and others - and these created a dependence on the colonising powers amongst the colonised. By the time the colonising hands and knees crossed, ~ powers withdrew, the new independent nations were so heavily dependent wrinkles under your eyes, " ~ on them that independence was merely at a political and not economic clothes dirty and grey, ~ !:a level, and since politics leans heavily on economics, when this in' you can be old. ; ~ dependence came it was merely a change in political and national status but not in power. Thus, conclude the intellectuals of this school of reasonO"' ...... ............ ...C ing, nations which colonised have a moral obligation to ensure the enhancement of their ex-colonies. ' It takes nothing to be lonely. It comes too easily. Other "Third World" intellectuals, especially those in the African bloc, It does nothing for your soul, go evei;t further back in time and demand aid from nations which parExcept to put holes in your tomorticip~ in the slave trade. This group has argued that the Slave Trade was the precursor of colonialism, and therefore this-also contributed to the impoverishment of some nations. The Slave Trade, this group points out,. How much time can we borrow, " ~ ~part from le~din_g to both social and economic dislocation amongst naPutting hole.s into our tomorrows. " !:a tions over which its dark clouds hovered, led to the forcible removal of -=o--....-..cor.,cocr~ ,. some 200 (by some estimates) people from their land, and this was a drain of manpower and brains, both of which contribute to any economy. ~ ~ NOTICE On -the other side is the "First World" intellectuals, and some have Inter-Varsity Christian claimed that most "Third World" nations are impoverished because of Fellowship will have a meeting on from "T. . , .. . SlnprH graft, corruption, nepotism and gross mismanagement of economies. This Friday night, September 12 from 7view was perhaps put most clearly by Eschel Rhodie, former Secretary of 9 p.m. in SLC room I. Information of the Republic of South Africa, in his book The Third Africa even though the reasons for writing this book were warped in that it was a~ attempt to justify the brutal racism of that country. '°'"M..t::l"M.P~R""IE~G-.ilN~A""'N""'T~.,,b?~ , ~ FromWorMr8roa. C,Awo,,..,eom,.,unlc1tloft1~ " Other "First World" intellectuals argue that some poor nations are so because of other reasons than those of colonialism or the Slave Trade. NEED HELP? ; Amongst these reasons has been advanced the view that it is things like education which continue to to plague some nations endeavors to advance. The reasoning of both sides cannot be dismissed as devoid of substance. Confidential Counseling ~ A full ~iscussion of these within the confines of this column is not possible, Pregnancy Testirg · r. " but bned comments should suffice. The effects of colonialism on some na. Alientown tions remain a sad reminder of that era, and those have been appropriately termed "neo-colonialism", a term, I believe, coined by ex-Ghananian President Kwame Nkurumah. ~ Women's Center 1 Antony I. Sibiya I heard "Krapp's Last Tape" last Friday, and I left curious, seeking, trying to find some meaning in that play. Perhaps, I am too young to understand it or not old enough to appreciate it, but nevertheless, I am old enough to acknowledge my ignorance. That play was. beyond me; beyond the scope of my experience and depth of my comprehension. The problem is, I had never thought about growing old until last Friday. I imagine, that here in college, I am laying the foundation for my future ; choosing the courses, career, and values which will guide me through life - a life which eventually will age. And that's the scary part. What will I be like as an old person? Will I sit alone in an qld folk's home, hoping that tomorrow my kinds will visit? Will I watch TV and add my own ~ommentary on how much better life used to be? Will I pray that social security, pen- lle11ie111••• • •• • • • •• • • • • • • • • ••• • Krapp's Last Tape" Encore Performance Campus Commentary "Rich Nation, Poor Nation" .....................................................,. ,.... f ~✓.,CCO"" I ~ I I~ ~~~ l~l!"-i-1-f~riJ i. I -~ I · l (215) 264-5657 ! pe-- ,... ,. . Frid~• Sep!enaber 12 _7 & 9 p. m _ . in tlae CPA Admission 25~ u,itla ID NoFoodOrDrinbAllou,ed . I I" i i I !! I - ' . ..,.o,..q,-.~o-..r,...,.,......,._~_... , ~.-.................................................. ~ �Philosophy Of Candidates Voiced At Public/Debate · For the first time in the entire history of Pennsylvania, the people of this state will be electing the position of State Attorney .General. In the past this position was always appointed by the elected Governor of the State. To mark this occasion the department of political scienc~ joined with the Wilkes-Barre Law and Library Association and cosponsored a public debate between Attorney General candidates Democrat Michael A. Opake and Republican LeRoy S. Zimmerman. The debate held in the Dorothy Dickson Darte Center for the Performing Arts grew a relatively large audience. with many noted community leaders in attendance. WBRE-TV, Channel 28 carried the debate live and Arthur L. Piccone President of the Law, and Library Association served as moderator. A panel serving as .the questioning body of the debate col)Sisted of Keith Martin from WBRE-TV, John Hart of the Scranton Tribune, Pat Ward, News Director of WQUQ and - a Wilkes student, Donald Gaetano. After each of the candidates presented a five minute speech on their particular philosophy of the office, each of the panel members could ask a question of the candidates which both would respond to and then a rebutal would be given. Keith Martin started the questioning by asking, "What are the special assets or liabilities that come with party affiliation that you can not afford?" Opake responded, "There are 800,000 more democrats in the state and by a 5 to 1 vote the people have shown that they want a person who is not hand picked by the Governor and is not part of the Governor's team. 1 am committed to making sure that the people get a fair shake." Opake said }!e "belives that the position of Attorney General has a responsibility to fashion and energize the justice department with a committment to the people of Pennsylvania and not to any party no matter what its political persuasion.'' Representing the Scranton Tribune, John Hart_asked a ques.tion pertaining to freedom of the press to which both men agreed that an "open door" policy should be pur into effect and , that the first amendment guaranteeing this should be protected. Another question asked of the men came from Pat Ward -who wanted to know how Opake could jestify duel candidacy as running for both the Senate and Attorney General? Opake contended that he "was not running for two offices state wide" and that he was basing his dual candidacy on the principles of democracy. He noted that either way, "I still want to remain in public office." Zimmerman said that running for two offices, "shows a lack of confidence and a lack of committment to this position as chief law officer of Pennsylvania." Zimmerman also pointed out .that Opake was one of several who endorsed a bill that would "propose a Constitutional Amendment making it impossible for a state-wide candidate to run for a publicly elected office unless he resigned from his other positions.'' Representing Wilkes, Donald Gaetano asked, "What ·are your feelings · concerning the Abscam operations and would you as Attorney General consider it permissable to run a similar program on the state level?" Zimmerman was the first to answer the question. He noted that as a prosecutor he feels that "for the first time i·n Pen, nsylvania, we on the state level (district attorneys, elected Attorney General and the State Police) can clean up our own mess in Pennsylvania." He also noted, "We must take a tough, hard stand . against. public corruption." Opake said that he " certainly supports" the new criminal investigative tools that we gave to the Attorney General and that he wants to expand the "prosectorial role of the Attorney General." The debate concluded with a reminder that a reception was being held for the candidates at Weckesser Hall. Darlene Schafffer September I 1, 1980, The Beacon, Page 7 .Upward Bound Helps ~igh School Staden-• Since 1967, Wilkes College has been involved in a program designed to aid and encourage collegebound area high 'school students. The_progra~ is Project Upward Bound, under the direction of Anne A. Graham. Aid and encouragement are extended to the students in the form of tutoring, classes, guidance, and counseling. Upward Bound, which: is funded by the United States Department of Education, is located on the second floor of Ross Hall. There are many facets of the program, but the main · thrust is, as Margie Esopi, Curriculum Coordinator, explained, "to keep them (the students) motivated to learn." Project Upward Bound sponsors classes held on Tuesday nights by area high school teachers. These classes are intended for the student who requires help additional to that available to him at his own school. , Students receive no grade for the classes, but rather an evaluation for their own use. There is also a class for high school seniors which helps to prepare them for the SAT's. Counseling is very important at Upward Bound. Students are supported and counseled in academics, career plans, and personal matters. Upward Bound counselor is Jean Narcum. Wilkes College participates in the program by employing college students as tutors for project participants from low income families. Roughly twenty tutors, in all high , school subjects, are engaged per semester. Approximately seventy high school students take part in the tutorial program; Tut.ors in the program are encouraged to become involved with the students. As a result, the tutors are asked to attend at least one nonacademic event sponsored by the students, so that the students can see them in a role other than that of teacher. · Any Wilkes College student who is interested in tutoring is asked to call Project Upward Bound at 8244651, extension 383. _ Elaine Czachor NOTICE A general organizational meeting for intramural sports will be held on Thursday, September 11 in the gym at 11: 15 a.m. Plans for flag football, women's softball and tennis will be discussed. Wilkes CoUege Students $TART THE $CNOOl YEAR RIIJHT C.HECK OUT THE ARMY ROTC PROGRAM AT -KING'S COLLEGE • OPEN TO COLLEGE MEN AND WOMEN . • ACADEMIC CREDIT • FULL TUITION ·scHOLARSHIPS AVAILABLE • BASl'C PROGRAM (FRESHMEN) INVOLVES ONE HOUR A WEEK • FUN AND CHALLENGING ACTIVITIES • LEADERSHIP INSTRUCTION EMPHASIZED • $100.00 A MONT-H DU -RING JUNIOR AND SENIOR YEARS . . . . AND THERE .IS MORE. FRESHMEN . .. WELCOME SOPHOMORES .. .. HURRY · JUNIORS. LAST CHANCE SEE CAPTAIN BOB KE~NAN IN ROOM "C'; SHEEHY STUDENT CENTER, KING'S COLLEGE OR CALL COLLECT (717) 961-7457 /7652. FAU SEMESTER CIA$$£$ ARE NOW FOIIM/N(J • I �Page 8, The Beacon, September 11, 1980 Senior Picnic ~njoyable For All BeaconBits •••••••••••••••••••••••••••• L.C.T.A. announced that starting September 7, there will be a modification of the No. 8 Swoyersville - Luzerne - Pringle line. Only No. 8 will operate in Courtdale. Leaving times from Cuortdale during the week are 7 a.m., 8a.m., 9:15 a.m., 12:l0p.m., 2:45 p.m. and 5:50p.m. On Saturdays inbound times from Courtdale will be marked with an- asterisk. The No. 6 Dallas line will also be changed. Inbound times from Dallas will change from 5 p.m. to 5: 10 p.m. All other lines remain the same . •••••••••••••••••••••••••••• Dr. S. Natarajan, assistant professor of electrical_engineering had his paper entitled, "Some Algorithms For Maximizing The Operating Frequency Range of OA Active RC Filters" presented at the 1980 European Conference on Circuit Theory and Design held in.Warsaw, Poland . ........................ , ... ' on a Dr. Andrew Shaw, Dean of Management, has been invited to serve panel of technical advisors to the Pennsylvania Economy League in a comprehensive study of the economic impact upon Pennsylvania's economy by ~ts institutions of higher learning. This study is sponsored jointly by PACU (Pennsylvania Association of Colleges and Universities) , the State Board of Education, and PHEAA (Pennsylvania Higher Education Assistance Association) . This study is scheduled for completion in September, 1981. Dr. Shaw also received notification of his selection as an Honorary Member of the Association of Pennsylvania Municipal Managers. Very few people are given this distinction, and Dr. Shaw is only the third persqn to receive it. The· goal of tnis association is to upgrade the skills and performanc~ of those who serve as administrators in government throughout Pennsylvania. ··········~···········~····· The United Way Campaign 1980 is now underway. ·Additional information can be obtained from Dr. Robert Ogren of the Biology department. ' ····························· Pizza, Spaghetti, Lasagna, Manicotti, Ravioli, Linguini ... looking for sometHing different to eat'! Why not try Roberto's on the Square next to the Paramount Theater? All this, plus a whole lot more. Take out orders ... phone 825-9971. Hours are weekdays 'till 11, Friday and Saturdays 'till 12. ' . ••••••••• ••••••••••••••••••• $15,000 is available to young music composers in the 29th annual B~l Awards to Student Composers Competition sponsored by Broadcast Music, Incorporated, the world's largest performing rights lice0:sing organization. To date, 254 students ranging from age 8 to 25 have received BMI Awards. Deadline for this competition is February 16, 1981. Official rules and ~ntcy blanks are available from James G. Roy, Jr., Director, BMI Awards to Stu dent Composers, Broadcast Music, Inc., 320 West 57th Street, New York, "1.Y. 10019. Library Assists In Career Plan~illg In an effort to e-ncourage greater use of the Center for Career Planning, the college will open a career planning-libr~ry in the near future. This subsidiary office of the Roth Center for Career Planning will be located on the second floor of the Student Center next to the television room. Student Government President Joe Galli explained that Eugene Domzalski, Director of Career Planning, contacted him this past June about the possibility of opening the Career Planning Library at a location which was convenient for the students. Galli stated that he thought the idea was excellent, and helped in making the student center location available. · As part of the Career Planning Library, four large bulletin boards will be placed on the second floor of the Student Center near the elevator. The bulletin boards will contain messages about career opportunities for seniors, lists of com- NOTICE Needed: White card students. Please call Ext. 201 or 202 at The Centeffor the Performing Arts-. panies coming to campus to conduct interviews, sign-up sheets for interviews, mock interviews on videotape, and lists of available jobs across the nation. · The Career Planning Library wm · be open on a part-time basis, but neither the hours nor the openlng date were available at this time. Louis Czachor SEPTEMBER PICNIC- One of thf- first events of the academic season was the Senior Get-together picnic held last Saturday at Ralston Field. Basic picnic food and refreshments were provided amidst a perfect day to relax with friends and listen to country- rock music provid y Quantrill. Apathy was slightly evident as turnout was less tlyln expected, but those who attended had a great time in the sunshine. Propos.a l ~o~ New ·c ampaign·Rule_ Discussec! By·cc At First Meeting Commuter Council presented a proposal regarding campaign rules and regulations at its first ,official meeting of the 1980-1981 school year. The new rules call for a petilion of at least 50 names in order for anyone_to be nominated for any elected office with the positions of CC and IRHC presidents securing at least 100 names for nomination. Under the new rules, Student Government president must obtaip 10 percent or 200 signatures in order to run. A cash limit of $50.00 has been set on all printed campaign materials. Also brought.out at the meeting was the fact that the gates of the Red Cross building are locked. Students who usually cut through the Red Cross property are urged to walk behind Hollenback Hall. Miller said that CC has agreements with various area residents about using their property to get to the Park and Lock facilities. "We also have the consent of the Elks Lodge and we are working in obtaining permission of Chacko's Bowling Lanes," Miller reported. He continued that he will be meeting with Dr. Andrew Shaw to discuss the possibility of having a per:manent walkway made for students to use. In a_related matter, Com_muter Council announced that parkmg lot tickets have gone up to $13.50 for a book!et of 20 coupons. "This .is relatively cheap as the $13.50 bolls down to roughly $.66 a day or a one third percent discount on the regular rates." Miller also noted that CC sells bus tokens at $16.00 for 50 one zone or 4!) two zone bus tokens. Parking coupons and bus tokens can be purchased from Commuter Council daily from 11 a.m. to 1 p.m. on the second floor of Weckesser Hall. Tentative plans are also being set for a lunch time coffeehouse on October 14 at 11 :00 a.m. in the Student Center. Pat Godwin, a local talent will be the first of several to participate in the coffeehouse. CC would like to have at least one coffeehouse a month. The meeting concluded with a reminder to all students that various subcommittees are being formed to handle campus events. All students are invited to join. r'lfl SiflJflll r'llllJSfl - i1Jr -- Andgave... gave .. ; - _ Andgave. She - · , J·,_.< J --~ !-': -· _•~ BErrE MIDLER ) : , ALAN BATES ' --- Y> . • THE ROSE .~ • - MIDNIGHT SHOWS - All Seats: $3.00 Fri.&Sat. September 12& 13 [Jllflll]llrlflfli~ r.r1[1 SIJ~iflfll~ See Bob,John,and Mike MON.-THURS. 11 A.M.-9 P.M. TUES., WED., FRI. & SAT. 11 :00 A.M.-5:30 P.M. 288-3751 �September 11, 1980, The Beacon, Page 9 Righter Deems Cross Country Snee Named Head Coach• • • • • • • • • • • • • • • • • • • • • • Tennis Team Prepares For King's The Toughesf ~rlGoi,g' ' ) ' " It's the toughest sport going." For Coach Ron Righter and his dedicated cross-country team, this may be an understatement. It is bad enough to run seventy-five to a . hundred ttiiles a week during the summer heat, -OUt when you couple that with long lonely hours and total deaication, you find you have a sport that requires a 'special person.' "There is no time to regroup. You can't stop, " says Righter. The cross-country runner must be in the best possible shape. Unlike other sports, there are no tune outs, periods or halfs. The cross-cquntry runner must never slackea; to do so even fot a brief second, may mean the difference in the six mile race. It seems that Righter has little to worry about in that area. With people like co-captain Eddie Eppler on your team, there is no need to worry about slack. Eppler, a senior Business major from Washington, New Jersey, runs despite the fact that he only has one kidney. " Eddie works hard 365 days a year. He's an inspiration to us all," said Righter. Righter also speaks highly of the other captain, senior Dan Thomas of Wilkes-Barre. " He's a leader by example," said Righter. " He lets his actions speak for him." Righter is high on this year's squad. After coming off the best season in Wilkes' history, Righter has high hopes for the squad. He has more people to work with and growing interest from the schQol. His schedule includes almost twice as many meets as two years ago so the potential for a season equal to last year's is there. One of the high points of the season may come against archrivals King's. King's, according to Righter, has one of the better teams in the state. A Colonel victory would make this a sweet-season for the team. The only problem Righter sees in this year's squad is depth. Despite the return .of standout Ken Pascoe, Righter lost some key people in Don Patrick, Louie Mucciolo and Eddie Cunningham. Righter hopes to counter these losses witl1 the addi- Ron Blglater lions of Jim Bell and Niel Pascoe, along with John Supinski, a key returning runner. The biggest return to this year's cross country team may be Righter himself. After coming off a successful rookie year, Righter has gained valuable experience, something he lacked in cross country. Righter, recruited as the basketball coach, has learned a lot about coaching in one year. Although he feels cross country is a game of self-discipline, he acts as the monitor. He provides the extra discipline the team needs and it is he that unifies the team. Cross country may be the "thoughest sport going," but according to Righter it is also very rewarding. " You are totally spent, and you've given it your all. It's a very good feeling." That "good feeling" can't help but continue for this year's Colonels. George Saba NOTICE The Wilkes College Intramural Program, under the direction of Dave Kaschak, has announced the times and locations for up-coming intramural organizational meetings. Check the listing for the sport of your interest. September 11th, 11 : 15 Flag Football, Gym September 11th, 11 :30 Women's Softball, Gym September 11th, 11:45 Co-Ed Tennis, -Gym Men's Tennis, Gym Women's Tennis, Gym Wilkes College almost went Debbie Welliver to give the team through the 1980 sports season needed experience and support. without a women's tennis team. At Other returning members expected the last possible moment Nancy to aid the team are Beth Keyworth, Snee was named head coach of the Beth Groarke and Lisa Warden. Wilkes Squad. Coach Snee was not, The coach also added that however, the last choice. In fact, Freshman Cathy Price has good the team was lucky to get the potential and has looked very imformer Wilkes tennis standout. pressive in practice. Snee was an Environmental The team will be working hard to Science major and former proget in shape for the upcoming fessor at Wilkes. She also found season. First year coach Snee is time to pay four years on the Col- . looking forward to her squad imlege tennis team. Snee played first proving by holding extra practice singles and was selected most sessions seven days a week. Snee valuable player in both her junior continued that she would like the and senior years. As a senior, she team to win a few matches, but led her team to its first of three conmore importantly give playing exsecutive Northeastern Pennperience to some of .the new · sylvania Women's Intercollegiate membersontheteam. Athletic Association Titles. Wilkes will compete against Coach Snee hopes she can help twelve teams and for the second the team come back from last year participate in the MAC chamyear's disappointing season. The pionships in May, The matches will Colonelettes added ten new consist of · six singles and three members to their squad and doubles competition.. greeted five returning players from Although the coach would not say last year's team. the team is in a rebuilding process, The Blue and Gold will depend on the squad is looking to rebuild the Co-Captains Peggy Mascelli and reputation they once had as a major . . . . . . . . . . .,..,. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .~ Bartikowsky Jewelers Catalog Showroom 141 South Main St. Wilkes-Barre Please show your college matriculation card or some other I.D. Plenty of Store Side Free-Parking powerhouse in the NPWIAA division. The coach expressed her feelings that the girls can have a good season if the team stays healthy and enough people come out to show some-support. DROP SHOTS ... This week there will be elimination matches to determine the starting positions ... Practices are from 4:00 to 6:00 p.m. ... The team's fint match will be held this Saturday against King's at the Ralston field courts at 11 : 00 ..• Bob Bu_chsbaum II Vo ,yball Team le See s Improvement Volleyball is one of the most grueling and deman~g sports in the world. The game 1s pretty much a neglec~ fos~er child in America, the land of its birth. Head_ coach Doris Saracino and ~er assIStant Nancy Roberts ~ould like to change that as they field a team for the 1980 season. Both coaches will be working hard to develop the team's skills and improve their conditioning. Coach Saracino is very enthusiastic about this year's team and feels they have the potential for a winning season. The coach said that last year's team had bench problems and was lucky to have had a 7 and 11 record. This year's team has some new players that can really help the Blue and Gold. Coach Saracino explained that volleyball is comprised of two basic positions, hitters and setters. The setter is really the quarterback of the team, controlling the game and setting the strategy. The strategy will either consist of a 4-2 or a 6-2 zone. The latter will be used mainly for offense while the 4-2 zone is a defensive game plan. Senior co-captain Cathy Dudick will lead the setters along with help from senior Sarah Farley. The 11''S TIME TO BUCKLE DOWN- If determination could will football coach was very pleased that four games, the Blue and Gold would be O!J their way to an undefeated season. new setters joined the team. Pictured above are members of the Colonel's offensive unit going through Freshmen Deborah Kromer, Ellen on'! of their many pre-season drills. l;;:;k atthose faces! Doty, and Sally Fisher and ._. . . . . . . ..,.. . . . . . . . . . . . . ..._. ., . . . ...,.. . . . . . . . . . . ., Sohomore Carol Cigarski are also ,,__ _ _ _ _ _ _ _ _ _ _ _ expected to get much playing action during the season. ._ NOTICE The hitters (spikers) are also imWilkes Day at HersheyPark will portant because they are responsibe this Sunday, September 14. ble for scoring. Co-Captain Mary Tickets will be $7. 75 for the first ~00 Kay Price will be the main hitter customers. The bus will cost an adalong with Cindy Rossie, Lisa Gazditional $5.00. Tickets are available , dick, Cindy Casper, Jody Johnson, in the SG Used Bookstore, base- ' Cheryl Friptak, Ellen Van Riper ment of Church Hall, up to and inand Lisa Colb (also an excellent cluding Friday, September 12. server) . Tickets may also be obtained in the There is no doubt that the ColNew Men's Dorm on Saturday from onels have the talent and ability to 11 a.m. to 1 p.m. have a great season. They have been practicing two and a half hours a day to get ready for a full sixteen game schedule. Coach Saracino said that talent and·skills are not the only important factors SPORTING GOODS of a winning team. She explained that the players COMPANY will need determination and dedicaWe Accept Master tion to win. They will have to take Baseball Meeting Charge and Vi.s.1 Dave Kaschak, Head Baseball pride in themselves and be aware of 39 West Market Street Coach, bas announced that there their problems. "We will have to Wilkes-~rre, Pa. 19701 take one game at a time, " the coach will be a baseball organizational Phone: 822-1333 remarked. meeting today in the Gym at 12:15. free Parking at Hotel Sterling Volleyball is not the most popular Various topics will be ruscussed inPJ.lurire'H cluding fall workouts, parking con- sport at Wilkes; but if the ColoneletProprietor tes have a good season you never cessions, and student information. _______________, know. Bob Buchsbaum Notice Your College Student Discount Carel is now available for you to pick up at ' . Chuck Robbins... �Page 10, The Beacon, September 11, 1980 Snyder And Ward To Play Major Bole lnRedevelopD1ent Of ~ckwo111e11 It's time to wipe the slate clean, but not completely, in women's field hockey. Although last year's team will be a tough act to follow, it's still too early to start writing ' epitaphs for the 1980 season. To some, this year's hurlers may be confronted with the old cliches of 'living up to last year's standard of excellence.' But .not so, according to senior co-captains Pam Snyder and Megan Ward. To them, this year is another season, with different 'hurdles to cross,' and a different team to work with. As Ward put it, "It would make it hard on this year's team to compare it with last year's team. Every year you start out the same.' ' With Wilkes' tradition, there's always the possibility of having a good season, Snyder added, but it's Both girls stress · that Coach "a matter of getting it together. " Meyers is the driving force behind the team. However, Gay Meyers isn't the only one responsible for shaping this year's team. Snyder and Ward will also play a major role. As cocaptains, their primary task is to keep the team motivated and positively directed, especially as the season begins. But this shouldn't be a problem. The two co-captains describe the Colonelettes as a "gutsy and determined" team. Although many of last year's starters won't be back, "those who are returning are really pushing it," said Snyder. As-in past years, the team also has some new players who might develop into stars of future seasons. Snyder and Ward plan to share their experience with the younger With the season opener one week players, and to help them become from today, getting it together will better oriented with the team. They be a major hurdle. It takes time, hope to provide moral support as practice, hard work, and a few well, to be "someone to talk to, conscrimmages to find out which fide in," as Ward put it. Being co-captains, Snyder stressstrategies will work best. Coach Meyers will have her ed, they care about "keeping the hands full deciding which form of team as a unit.' ' "If you show that you care, then attack or game plan to use. She also has to determine which players are the rest of the team is more apt to best suited for the various field care," said Ward. positions, many of them involving . Caring is what the 1980 seaosn is different skills. This is not an easy all about. Both girls are proud of task, but, fortunately, Meyers is an their team's attitude. They feel that "excellent coach," according to the their teammates have put great effort into their pre-season practice two co-captains. "Her enthusiasm is unmatched sessions. The desire to win is pre' by any coach I have ever seen," sent. The Colonelefies have already says Snyder, Ward agrees, "She always gains begun scrimmaging ·other teams, the confidence and respect of the and the events of the next week will determine what kind of -season is players." Megan Ward Pam Snyder An honors graduate of Wilkes College, Mary Jo received a Bachelor Mary Jo Frail of Arts' degree in Psychology and a teaching certification in Social Studies. She also participated on the Women's basketball team for four years and the Women's softball team for three years. Frail received 11 varsity letters in her collegiate career and will be a great asset to coach Meyers and the rest of the team for the 1980 season. The Colonelettes will face its toughest test against three of the finest Division II teams in the country starting September 13. Coach Meyers said that the scrimmage games against East Stroudsburg, Messiah, and Drexel University will tell much about the rest of the season. Bob Buchsbaum Tlainclads Hope For Winning Year _ After their first two winning seasons, including last year's fabulous 13-4 season, the Wilkes College cross country team is still looking up. Second year coach Ron Righter leads the harriers again this season. Righter feels, "we'll be there. We're shooting for another good year and the kids are pumped up." Captain of this year's squad is Senior letterman Ed Eppler, who Righter says, leads by example. Ed has really worked hard over the summer running a lot of distance, including some marathons. Ed also worked on his speed where he needed work." Other returning lettermen are Senior Danny Thomas: Junior Ken Pascoe; Senior John Suponski, who Righter feels "has worked hard and is ready to challenge." Also, Ed Cunningham and Lou "Animal" Q,,. ~ 0 -ti) ~ ~ ~ ~ Op~••• Gawi• The Wilkes College field hockey team will need something extra to equal last year's amazing team. All the Colonelettes did last year was win their sixth straight NPWIAA title, second straight MAC Northwest Championship, gain a second place finish in the MAC Tourney and compile an (11-33) record. The lady responsible for the girls great success has been head coach Gay Meyers. In ten years of coaching, she has compiled a 68-3813 record along with much respect from other coaches around the league. Last year she had help from two of the greatest women athletes in Wilkes College history. Jerry Ann Smith and Mary-Jo Frail handed the Wilkes field hockey team its finest season since the team was formed in 1962. This year the team will need some sort of miracle to accomplish last year's record. The team was hit hard in losing .seven out of 11 starters in 1979. The blue and gold will rely heavily on co-captains Pam Snyder and Megan Ward for the 1980 season. Coach Meyers also added that field hockey is a team sport and if everybody stays healthy, we could have a good seaso_n. The one bright spot for the team has been the appointment of·Mary Jo Frail as assistant coach. Mary Jo served four years as a member of the Wilkes field hockey team and will now add her experience and support as a coach. ahead. One thing is for sure, the Wilkes tradition of fine leadership is sure to remain. Megan Ward, an English major with a preference toward writing, is beginning her sixth year playing field hockey. She began her career playing at Bootin High School in Northwest New Jersey. Since then, she has had a good share of playing experience at Wilkes. Also with a fine field hockey background is Pam Snyder, a Business Administration major with a concentration in marketing. Now in her eighth year of competi· tion, Snyder began playing at the Conestoga Valley High School in Lancaster County. There she made the division all star team in her senior year. As she begins her final year at Wilkes, Snyder has already garnered some impressive honors. Last year she was a first team MAC all star, in addition to playing in the 1979 National Tournament. "Jerry Ann Smith and Mary Jo Frail, last year's co-captains, will be missed, " Snyder and Ward said. In fact, last year's entire season will be missed. It was a great year with an exceptional team. Once again the possibility remains that the Wilkes women's field hockey team may have an impressive year. As the old cliche goes: 'ring out the old (season>, and ring in the new.' Mark James z 0 S■yder ~•••••• For Frail Named Assistant Coach ~ > Mucciolo return from last year. close." The schedule has been expanded A key newcomer to the team is Junior Jim Bell, who has been a again and Righter is still working Wilkes student for the past two on more teams. There is a possibiliyears but has not run competitively ty of 21 or more teams on the schedule. The thinclads open on since high school. The top freshman recruit is Neil Pascoe (yes Ken's Saturday, September 13 at brother) who had an outstanding Delaware Valley for a triangular career at Nanticoke Area · High meet with Delaware Valley and School. Another top freshman is King's. Jim Truskowski who hails from Coach Righter asks for as much support as possible from the college Northwest. The only letterman lost from last and community. Rich Nordheim year's squad, but a key loss, is Captain Don Patrick who graduated. - - - -... "Don was a good· leader and you ... <,; 1 couldn't ask for a better leader," '-11 explains Righter. ~ATHLETIC As far as the top MAC teams SHOES Righter feels, "Scranton, Delaware Valley and King's will be tough with King's as the top team . Some of the "\e-,.......-:--..,i 1 1 WtM:~~oN "t' IN ~:~~0~h~~~=;~ ;~ ~~ !~::irin !~~ reach. All these teams are very MIDTOWN PIZZA York Pizza New ---•--11!111~-C •O S"1.!oo Style We feature Sicilian style pizza squares, ·serve salads, hot platters and cold or hot hoagies. We have specialties such as: -A~1t:~~_;.Y RAQUETH ~ ~ MlN'S > t"" WOMIN'S ROA!>RIJHNfR ~ > t= WE CARRY THE LAR<?EST SELECTION OF NIKE FOOTWEA Stromboli, Calzone, Sausage Roll and Parmigiana _:J'umovers .ti:1 IN THE GREAT .,N.l Receive 15% Discount with this ,, on any hot platter (Includes salad, bread and butter) Hours: 10:00 a.m. to 9:00 p.m. Sat. 10:00a.m. to6:00 p.m. coupon 41 South Main Street PHONE 829-7740 Expiration Date 9--4-80 t"" (°;l 0 ~ 0 z • .~ ~ mer1can~ athl 91 South Main Street Wilkes-Barre 822-5264 .........., •Al--.. •s.- I �September 11, 1980, The Beacon, Page 11 - -- . . - ·· ···-··, ·I Menaorylane M~T~fft1° SXr~A t>'f ~£,'tt\JS Did you ever sit down and wo~d~r exactly what a college athlete is? Besides dismissing this person as one of your friends or as one of your classmates, have you ever tried to get at the essential qualities of this unusually highly-skilled human being? My bet is that you haven't, and you ·know something, this is one of th~ biggest problems facing college athletes today. ' Far too many times in this age when institutions of higher learning are troubled with financial problems, the college athlete becomes the solution for increasedrevenue. In the same respe'Ct as an annual brochure or wellplaced advertisement is used to gain the public's interest in an institution, · so too is the "star" athlete used as a public relations tool. There was a time when college athletics was on the same level of importance as high school athletics, but that relationship has long been removed. Today, college athletics is big money and don't let anyone fool you. The more people an institution can pack into a stadium or gymnasium, the better it is not only for the " home team advantage," but also for that particular school's pocketbook. And what is it th;it usually draws large crowds to see a college game or match take place? You got it, a "star" athlete. · If you have recently picked up a newspaper or magazine featuring colSeptember 13: lege football, the odds are you probably have encountered some type of Cross Country Delaware story, picture, or cartton dealing with Purdue's quarterback, Mark HerrValley and King's (Away) mann. A 1980 preseason candidate for the Heisman Trophy, Herrmann has Soccer -Alumni<Homel received moreink lately than President Carter apd his brother Billy comWomen's Tennis King's bined. I am not trying to insinuate that this exposure is bad, just that it is <Home) ·, amazing how a college footbaU quarterback can get as much media Women's Volleyball Tournacoverage as the President of the United States. How is such a task acment <Home) complished? The answer is very simple. More th~n Mark Herrniann's per· Women's Field Hockey sonal glory is involved in the nationwide promotion. Every time Mark Her<Home) FatareAthleteeOfTbe Week? .-rmann is introduced at a rally or dinner, the name of Purdue University is mentioned as well. And what does this mean? It means more national exSeptember 17: 1n an attempt to expand on an exciting sports feature and to give credit posure, increased enrollment, and last but not least, more money. Because Soccer - Scranton (Away) where credit is due with greater frequency, this year the "BEACON" Herrmann is a college athlete; he is part of the National Collegiate AssociaCross Country - Baptjst Bible sports pages will'include an " Athlete of the Week." In the past, the sports tion (NCAA) which also received endorsement every time he is featured . <Away) department has ended the year with a male and female "Athlete of the This means a- better relationship for the NCAA with the public. So in a Year." Response to this annual feature is always tremendous. It is believsense, everyone wins! September 18: ed t-hat by expanding this yearly award to a weekly occurrence, a greater But not every athlete is a "star" and not every school is the size or has Women's Field Hockey interest will develop not only in the spo1·ts pages, but in our athletes and . the resources like Purdue University. What about your Division Ill athlete ElizaJ,ethtown (Away) Wilkes athletics as a whole. Women's Volleyball After each week of competition, .the "BEACON" sports staff will vote on . whose team finishes last in its respective division? What is it about th.is per• son that keeps himJher going to practices and enduring weekly punishment Elizabethtown (Away) the one athlete who they feel excelled above all other athletes as far as at games which might possibly have no influence on the outcome of a diviWomen's Tennis - Scranton overall achivement is concerned. This athlete will be notified of his selecsional championship? Some people say it"s pride, others claim that it is (Away) tion and will be briefly interviewed concerning his "award-winning" per-simply the love for a particular sport. I really don't know what to attribute formance. This interview, along with a brief biography and photograph of it to. But I do know one thing for sure, college athletes are a special breed of Sports Notice the athlete, will be published in the following week's "BEACON.'' people. Today is the last day applications · For those of you who are wondering why there will not be a male and Setting aside the stereotype of a college " jock," the average collegiate for assistant sports editor will be female "Athlete of the Week," the reason is simply this. After much conathlete is nothing more than a student who would rather participate in accepted. The deadline is midnight sideration, the staff decided that an award given to a single "Athlete or the sports than in various campus clubs and organizations. This is not to say tonight. Anyone interested may Week" is much rnpre meaningful than an award given to a male and a that college a~hletes do not participate in campus clubs or organizations, or leave their -name and phone female "Athlete of the Week.'' In an age where men and women are comthat people who participate in campus activities cannot also be involved in number at the "BEACON" o fice, · peting equally in all fields, the 1980' -81 sports staff feels that the time has athletics. This simply means that while for some of us t-0 be the president of Room 27, Parrish Hall or call 824· come for the "BEACON" sports department to progress as well. a campus organization is the most important thing that can happen in our 4651 ext. 473. Last year, Diane Kendig won the female "Athleteof,\he Year" Award as college careers, to be the best in his-her particular sport is one of the most a guard on the women's basketball team. Setting a school record of 600 important things that can happen to a college athlete. · points in a season, Kendig captured Middle Atlantic Conference and AllFar too often, though, a college athlete is rated and criticized according American first team honors while also winning the league's MVP award. .to the scales that have been established for our highly paid professional " Bryan Billig was selected as Jast year's male "Athlete of the Year.'' athltes. Because of the high amount of money spent on the promotions of Billig led the Colonel wrestling team to a 19-2 record with a personal slate college athletes and the great amount of revenue 'that is acquired by inof 23-6-0. The Wilkes grappler tied Jim Weisenfluh's record of 14 overall ARMY & NAVY stitutions from the vario!IS sporting events, college athletics is quickly pins in one season and Al Zellner's single dual season mark of 10 falls. becoming identified with professional sports. Because of this identificaAdd to the records of these athletes the performances of standouts like 113 South Main St. tion, the same forms of criticism that are levied on a professional athlete Chick Andrewscavage, Carmen "Homer" LoPresto, Peggy Butchkavitz, Downtown Wilkes-Barre are also being used to describe the performance of the college athlete as ••Pam Snyder, and it is easy to see that the selection of "Athlete of the IIOIJIS: w, ,......,,.,.... io ........ , ... Week" will be a very difficult one to make. For example, if you had to . well. This is totally absurd! Especially in a small-college setting, the press as well as the public must make the choice between Billig and Kendig, who wo11ld win your MVP remember that although the athletes they see performing at the local col:' award? This year, this kind of match-up is not only possible but is very like• lege gyms or pl~ying fields are older than high school athletes, they still ly. Read the " BEACON " and compare your choice with that of the sports are not professionals. . staff. You may be surprised with the outcome ! ! ! ! These athletes do not receive any special treatment (either socially or academically) like many of their opponents do at larger institution:,. They do not receive the large scholarships, the free apartments, or many of the Due to a decrease in the number other luxuries which athletes at "big-time" schools are so accustomed to. of . sports pages in last week's No, a small-college athlete is simply a person who has a strong desire to " BEACON," many of the features DINIM-COIDUIOY participate in sports while pursuing a college education. . and sports stories promised in Across from Bishop Hoban -PLUSThe purpose of my dealing with this topic is not to get on the good side of "Sumthin' Extra" were- not . UMYPAIRS Ph. 822-7045 athletes, coaches, and athletic directors, or to condemn the present situapublished. The sports department PAlffll PANIS tion of college athletics. It is simply to put a perspective on an issue that -Import.ct apologizes for this and hopes that ,AIMIi.WANS many times gets lost in the memories ~f everyone. So remember, the.next this week's "complete" issue -Colda..rtime you attend a college game or match and see a player make a mistake. SWU1Sia1s remedies the , situation.· Also, Ca/11n Advance keep it in mind that "athletes are people too!" IWNLSNmS special thanks to Michele Fydrich lot Kegs and Quartets and Daria Morris for their work on (Must have LCB Cord) the cartoon and ·column head respectively. OnceA,-,n~ Can You Name Tlaat Plaoto? Sports Calendar Athlete Of The Week - .,n.n. 1 LliP"· w.·m; r.... DECKOU R'S BEER -r•~ ,._...,._M __,.....,,,.. . ., �TijG1•~~0l?f 1/2 r1cesALI . Wilkes College Wilkes-Barre, Pa. _· -(beNeurUork limes '- · 1.ooklng for a wciy to enhance your education ••• to sa,,e money ••• understand more wordly events ••• . Then try reading the NEW YORK TIMES this semester, at the low student discount · rate of ' 15c, HALF THE NEW- · STAND PRICE of 30c a copy. This offer Is available to all members of campus community-dorm, commuter students, professors, and admlnls~ratlon person- nel. , 1 FOR MORE INFORMATION.CONT ACT Jon Pliskin . at SLOCUM HALL orCALL '- 823-2635 iJ;l 11r:l BEAUTY IN MOTION! Frisbee was the name of the game for Bob Matzelle at the recimt Senior Pic-N-~ September 11, 1980 Vol. XXXIII, No. 2 � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 September 11th Date A point or period of time associated with an event in the lifecycle of the resource 1980 September 11 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/1db07ba7804de809bac91e0b19ec485b.pdf 4f743f4940fb5c8aaf8f43b12d4ed004 PDF Text Text - . Cross Registration Program Established With King's Wilkes College and King's College have both agreed to afll>w their respective students to enroll in courses offered at the other's campus. The new cross registration became effective at the beginning of the 1980-81 academic year. The only stipulation placed on students interested in the program is that the course they want to rake must not be available (and will not be available in timely or convenient fashion) at the home campus. Students must be academically qualified and there must be room for additional enrollment in the desired class. The procedure for the cross registration is relatively simple. The Registrars of both colleges have exchanged course schedules . andhavetriedtocoordinatecourse offerings and their respective times to meet the cross registration enrollments.. Students should decide what course they want to take, inform their advisor, and pick up the necessary forms : Once the forms are filled out, they should be returned to the appropriate Dean of Student Affairs Office. At the end of each academic semester, the Business Officers of both colleges will prepare a Balance of Tuition Payments Report. Money will be exchanged at the rate of 80 percent of the average of the two collegefs full-time tuition . fee for students carrying 12 or more credit hours, and 80 percent of the average credit hour tuition for students attending less than 12 hours at the "away" school. Besides having established a cooperative cross registration with King's College, Wilkes also has a transfer of credits policy. Grade of ~.o("C") or better will be accE;Pted m transfer. However, grades t,arned in transfer will not be comptited in the cumulative average ·at Wilkes. Students interested in transfering credits should pick up two copies of the request for transfer of credit form from Student Affairs in Weckesser Hall, the Registrar in Parrsh Hall, or Admissions in Chase Hall. Forms must be completed in duplicate and must include the _course description as listed in the Bulletin of the transferring institution. All courses must be approved by the Chairpe. '50n of the appropriate department and completed forms must be returned to the Dean of Student Affairs Office. An official transcript · with the course listed must be sent to the Admissions Office at Chase Hall. _Darlene Schaffer Approximately 700 new students . were introduced to the Wilkes College Family this past weekend. The new students include both freshmen and transfer students. The new students gathered in the Gymnasium while their parents congregated in the Dorothy Dickson Darte Center for the Performing Arts. The students were first welcomed by George Ralston, dean of student affairs, who later turned the podium over to President Robert S. Capin and Dr. Off.1c1a . I COIone I M asc ot 1nst·1tuted By SG · The institution of an official Colonel mascot was announced at Student Government's Monday night meeting. Tryouts for the position will be held in the gym on Friday, September 12. The mascot will wear the Colonel uniform and work with the cheerleaders at athletic events. Student Government hopes that this will help restore school spirit at the games. Times for tryouts will be announced later. Tickets for the September 14 Hersheypark will be sold in the basement of Church Hall from 10 a.m. to 4 p.m. until Friday, September 12. Tickets will also be available on Saturday in New Men's Dorm from 11 a.m. to 1 p.m. Students may purchase two tickets with their ID card. Cost of the tickets is $12.75 in-,. eluding bus fare to the park and admission. Buses will leave Stark Learning Center at 8:15 a.m. Departure from the park is 10:00 lnter-Dormitory.·council .Changes Name To IR H C A "dormitory" as stated in Webster's dictionary is "a place to sleep."Inter-Residence Hall Council President Janine Tucker did not feel that Inter-Dormitory Council really fit her organization. "Dormitory is an obsolete word; it is thirty years old, " stated Janine. Janine decided to make the name change after attending the National Association of College and University Resident Halls Convention. At the convention very few organizations utilized the name dormitory. Even though Janine feels that the name is long it is up-to-date. "Everything is still the same, our duties are remaining the same, it's just a name change, " Janine said. There was no opposition from Neiv Students Introduced To 'Wilk~sCollege Family' anyone concerning the change according to Janine. The official change was adopted at the summer Student Government meeting. "I had recommendations from President Capin, Deans Hoover and Lampe, and Paul and Jean Adams when it came time to make the proposal, " Janine explained. Also to be added to JnterResidence Hall Council this year will be the addition of Outstanding Residence Hall Award to the other awards given at the end of the year by IRHC. There will be an award for the male and female residence halls. "The award is ma-inly to promote spirit between the halls and to develop more unity," the president stated. p.m. Tickets for the all college picnic are also available in the basement of Church Hall from 10: 00 a.m. to4:00p.m. Also discussed was the situation concerning student advisors. A committee is in the process of being set up to meet witti Dr. Gerald Hartdagen, Dean of Academic Affaird. The committee will have a chance to speak at a department chairman's meeting and a faculty meeting about the situation. Present Stark study regulations were criticized by various members of SG. Presently, four rooms are available for student use during the night until 1:30 a.m. According to Galli, each of these rooms holds a night class several nights a week. This then only leaves from 9:30 p.m. to 1:30 a.m. for student study. Student Government is taking the situation into consideration in an attempt to increase the · number of study hours available in Stark Leaming Center. A student bill or rights is also under review by SG. This wold be the first time in college history that rights would be outlined in writing. Advisor Art Hoover feels that this is a good move and should be followed through. Joe Galli, President, announced that a room on the second floor of the Student Center ha been designated for careers planning. Job opportunities and interview possiblities will be posted on bulletin boards outside the office. Galli reminded students that each club and organization is given a mail box in the bookstore. Club officers should check it regularly, he added. The meeting closed with Galli announcing the motto for this year "mutual support and cooperation. " He stated that he hopes that this will become a guideline for everyone this year. Gerald Hartdagen, dean of orientation group leader. The groups of approximately 10 spent academic affairs. In the meantime, the students' about an hour and a half together parents were being welcomed by with their leader discussing camJane Lampe, associate dean of stu- pus life, answering questions and dent affairs. After President Capin - touring the campus. Resident Hall and Dr. Hartdagen concluded in the lounges and the Annette Evans gym, they joined Dean Lampe at Alumni House were utilized for these discussions. the Darte Center. Before going to the traditional The three student leaders, Joe Galli, Student Government Presi- picnic on Bedford lawn the students dent Bill Miller, Commuter Council and parents had the opportunity to meet with their respective departPresident and Janine Tucker, Inter-Residence Hall Council Presi- ment chairmen. A new alternative to mixers was dent, and freshmen class advisor, Marla Brodsky explained their Playfair at the gym at 8:30. respective governing organizations Playfair is an unusual set of and upcoming activities. Between dynamic games and turned out to these speeches an "icebreaker" be a big hit among the new students was initiated by Galli, where the and upperclassmen. (For more on upperclassmen orientation group Playfair-see the Feature Section, leaders infiltrated the crowd of new page5.) Sunday, the second day of orienstudents and introduced tation, began with a reunion of the themselves. At this time the large group was small groups with the group leader separated into lesser groups: com- and then to a lecture at Darte muter students met Arthur Hoover, Center with Dr. Riley, chairman of the psychology department. After associate dean of student activities, the lecture, the students parin Start Room 101; transfer students went to Stark Room 1 with ticipated in testing with Dr. Bing Wong, chairman of the math Dean George Ralston; and the residepartment and Dr. George Siles. dent students remained in the gym New Student orientation is plannwith Paul Adams, housing director, and Jean Adams, associate housing ed by the deans' office with cooperation from student Governdirector. ment. The student chairmen for After being introduced to specific this year were Cheryl Crea and policies, these groups were split inFred Daniele. to _small_e r groups and assigned_~n Margaret Scholl Closed Gate Blocb Path To Park & Lock One topic that sparked particular HERSHEYPARK· trip, Sept. 14 attention and discussion at the were also discussed. Attendance weekly Commuter Council meeting was encourage in all upcoming held Sept. 2, was the fact that the events by President Miller. Miller also commended Student gate behind the Red Cross building on South Franklin Street has been Government for having the Used closed. In the past, the open gate Bookstore open and running so has allowed students who park in smoothly this year. The rest of the Park and Lock South to cut through council joined the commendation. this section without. walking around Miller reminded the council of the the block. Bill Miller, CC Presiden All-COilege Assembly set for Sept. learned from Gordon Fater from 9, Tuesday at 11:15 in the gymthe Red Cross that the closing of the nasium. Attendance is mandatory gates was due to insurance pur- . by all Wilkes students: Miller announced at the concluposes. "Cars have been stolen from that area and our action was not sion of the meeting that Joe Galli, directed toward' the Wilkes pre$ident of Student Government, and · Janine Tucker, IRHC Presistudents," stated Miller. Weekly office hours were also set dent and himself have adopted the up and will be in effect this week for motto "Mutual Support and Cooperation" for the upcoming those who need to purchase bus tokens and parking tickets. Office year. Margaret Scholl hours are from 11 a.m. to 2 p.m. daily. Prices of bus tokens are 50 onezone tokens for $16.00; 40 two-zone NOTICE tokens for $16.00 and Park and Lock Students are remindtd that Fristickers will be going up to $13.50 in day, September 5 is the last day to the near future. sign up for class audits under the Upcoming events such as the Allnewp.,licy. College Picnic, Sept. 13, and the �Page 2, The Beacon, September 4, 1980 September 5th······················· N~u, FacultyAndAdministl-ation "Krapp's Last Tape" Added To Tlae OJllege Fanaily Several new administrators and puter Science, who has a B.S. from faculty have been added to the staff King's and a Ph.D. from Brown. of _the college this year. For the ' Mrs. Janis Nestor Blimling, Inmost part, they replace faculty structor of Library Science, has members who have been promoted, earned a B.A. from Monmouth and retired, or have resigned. a M.L.S. from Rutgers. Kenneth A. In administration, Dr. Mahmoud Broadt, Associate Professor of AcFamy has been given the position of counting, has received a B.S. from Director of Continuing Education. Bloomsburg, a M.S . from Bucknell, He will also retain his former posi- and he received his certification tion of Associate Professor of from the state of Pennsylvania. Education. Former Associate Dean Timothy J . Cain, Instructor of of Admissions Eugene Somzalski English, has a B.A. from Pennhas been promoted to Director of sylvania State, and a M.A. from Villanova. Dr. David A. Goode, Career Planning. David W. Gregrow has been hired Associate Professor of Sociology as an Admissions Counselor. and Anthropology, has received his Gregrow has a B.A. from Wilkes. B.A and M.A. from Queens College, ·,Mary Jane Nulty has been placed in City University of New York, and the position of Housing Coor- his Ph.D. from California at Los dinator. Nulty received' her RA. Angeles. Theresa Grabo, Assistant from Wilkes also. Dr. Hsi Ping Shao Professor of Nursing, has earned a will assume the duties of Director B.S. from SUNY, Buffalo, and a of Institutional Grants and M.A. from Marywood. Assistant Professor of Nursing B. Research on October 1. Shao's degrees include a B.A. from Alene Harrison has received a B.S. Taiwan Normal, A M.A. in Library from Idaho State and a M.S. from Science from Drexel, and an M.A. Michigan. Mary Jo A. Konkloski, and Ph.D. from Pennsylvania. Assistant Professor of Nursing, has Robert J. Welch has been hired as a B.S. from Edinboro State and a Assistant to the Dean of Ad- M.S. from SUNY, Binghamton. misisons. Welch has a B.S. from Assistant Professor of Physics Bloomsburg and an .M.S. from Jerome Kucirka earned his B.S. at Wilkes. The position of Director Of Wilkes and his M.S. and Ph.D. at Public Relations and Publications Drexel. Kenneth G. Lewis, Assishas been filled by Randall Xenakis. tant Professor of Business AdHe has a B.A. and an M.B.A. from ministration, received a B.S. and M.B.A. from the University of · Rollins College. _Two academic departments have Scranton. new chairmen. Col. Bruce L. Burke Dr. Michael C. O'Neill, Ass stant has been assigned as Professor of Professor of English and Theater, Aerospace studies and chairman of has a B.A. from Fordham and a that department. Burke has receiv- M.A. and Ph.D. from Purdue. ed a B.A. from Akron and a M.S Bruce J . Reiprich was added to the from Tennessee. Assistant Pro- music department. Assistant Professor of Sociology and An- fessor of Nursing Diane F. Eisinger thropology John Natzke has taken has received a B.S. from Pennover the chairmanship of that sylvania and a M.A. from Columdepartment. Natzke has earned a bia. Instructor of Library Science B.A. from Wisconsin State and an Catherine Schappert has earned a M.A. and Ph.D. from Western B.A. from King's and a M.L.A. from Pittsburgh. Michigan. Dr. Peter A. Siver, Assistant ProTwenty educators have been hired as regular faculty members fessor of Biology, has a B.A. from and five Teaching Associates have SUNY, Binghamton, a M.S. from been hired. The 20 new faculty New Hampshire, and a Ph.D. from !Dembers include: Dr. Louise Connecticut. Dr. Roderick M. McNertney Berard, Assistant Pro- Stewart, Assistant Professor of fessor of Mathematics and Com- Philosophy, earned his B.A. at :First Play Aa4i~ions Set For Sept. Sand 9 Auditions for "A Midsummer Night's Dream," a Wilkes College Theatre Production, will take place on Monday and Tuesday, Spetember 8 and 9 at 7 p.m. in the C.P.A. The play is a comedy by William Shakespeare involving two sets of lovers who get lost in the woods on a midsummer night. During the night the woods come alive with fairies, creating an atmosphere of dream and fantasy. According to Jay Siegfried, Assistant Professor of Theatre Arts, "A Midsummer Night's Dream" will be the most ambitious theatre propuction at the college for some. time. The play requires at least 13 men and eight women, but many more can be used. There is no big lead in the comedy, but there are many smaH roles. Almost anyone who tries out will have a part, no matter how much acting experience he or she has. Mr. Siegfried especiaq,. encourages those students who have taken modern or jazz dance classes to audition. . The play itself will be presented in the C.P .A. on October 24, 25, and 26. Anyone who would like to be in the play but can not attend the auditions on Monday or Tuesday may call Mr. Siegfried at ext. 201. NOTICE The History Club will meet next '. Thursday, September ll, during the activity period on the third floor of Franklin Hall. Anyone interested in becoming a member is asked to attend this meeting. The Club is open . to everyone. Imagine againg 60 years in only three hours and you'll have some idea of the way Chris Lonstrup prepares for his role as Krapp in the Wilkes College Theatre Pro(luction of "Krapp's Last Tape." Written by Samuel Beckett, lhe play is about an 80 year old man who listens to a series of tape recordings he made 30 years earlier. Several times he stops the tape, often reacting angrily to the stupidity he perceives in the man he was thirty years ago. Preparation for this role requires not only mental but physical attention - it takes three hours to apply the makeup to t1,1rn Chris into an old man. Jay Siegfried, Assistant Pro: fessor of Theatre Arts and director of this one-man performance, feels Austin, and his M.A. and Ph.D. at Syracuse. Assistant Professor of English and Foreign Languages Allan Stoekl has a B.A. and M.A. from Wisconsin. Major Gary R. Taylor, Assistant Professor of Aerospace Studies, has earned a B.S. from Ohio State and a M.A. from Texas Tech. Assistant Professor -0f Nursing Lois Patricia Zong has received her B.S. and M.S. from Pennsylvania. Betty P. Zuraw, Assistant Professor of Nursing, h!lS a B.S. from Hunter, and a M.A. from Columbia. The Teaching Associate positions involve special appointments in which non-faculty members possessing expertise in a certain area but lacking the credentials for regular faculty rank are hired. A teaching associate can hold his position for a maximum of three years. The newly hired teaching associates are: Roseann S. Cordora (Business Administration) has a B.S. and an M.B.A. from Wilkes. Catherine M. Cummings (Nursing) has a B.S. from Marywood. Lauren McCallum (English) has a B.A. from Grinnell and a M.A. from Catholic University. Mary Ann Saueraker (Nursing) has a B.S. from Wilkes. Joann M. Simons (Nursing) tias a B.S. from Marywood. Louis Czachor this play is "visually fascinating because the audience is actually doing the same thing the actor is doing," that is, listening to the tapes. The audience and the actor become engrossed in listening, so that both actually share the same experience for much of the play. "Krapp's Last Tape" was presented as a Summer Theatre Production, playing to local critical acclaim. The play was received so well that a special encore performance will be presented on Friday, September 5 at 8 p.m. in the Center for the Performing Arts. Admission for the public is $1.00. Wilkes students with I.D. may attend free of charge. After the performance, there will be a tour of the building and of the theatre facilities for anyone who is interested. ~ Education,Philo~ophy Depts. Offices Relocated To Stark 1980-SJDate. Set For Teats Students completing teacher preparation programs and advanced degree Candi.dates ,·n spec1'f1'c fields may take . the National Teacher Examinat1·ons on any of three different test dates l·n 1980-81 · Educational Testing Service, the nonprofit, educational organization that administers this testing program, said today that the tests will be given November 8, 1980, February 21, 1981, and June 20, 1!1111, at test centers throughout the United States. On each full day of testing, registrants may take the Common Examinations, which measure their professional preparation and general educational background, and-or an Ar~a Examination that' measures therr mastery of the subject they expect to teach. Prospective registrants should contact the school districts in which they seek employment, state agencies in which they seek certification or licensing, their colleges, or the appropriate educational association for advice about which examinations to take and when to take them. The NTE Bulletin of Information contains a list of test centers and . general information about the examinations, as well as a registration form. Copies may be obtained from college placement officers, school personnel departments, or directly from National Teacher Ex. aminations, Box 911, Educational Testing Service, -Princeton, New Jersey 08541. , If you are looking for either the 434, an<J the department secretary's education or philosophy depart- new number is 435. Dr. Donald A. ments, don't go to Butler or Kocyan Henson, Chairman of the Halls. The departments aren't Philosophy Department, will not be there ... they have moved to the reached at Ext. 456 and the departStark Learning Center. ment secretary can be contacted by Butler and Kocyan Halls are both calling Ext. 455. . scheduled to be demolished acUntil the installation of the new cording to the new college renova- campus telephone system is comtions. As a result, both the Educa- pleted, both the education and the tion and the Philosophy Depart- philosophy departments can be ments were forced to relocate. The reached by calling Ext. 384 and 257 education department is now respectively. The anticipated comlocated on the first floor of the Lear- pletion date for the new system is ning Center, and the philosophy September 19. department can be found on the seDarlene Schaffer cond floor. NOTICE In addition to the new locations, A used bookstore will be operated both departments will be assigned by Student Government in the basenew extensions. Education Depart, ment Chairman, Dr. Eugene L. ment of Church Hall, Monday througll Friday from 10 a.m. until 4 Hammer, has been assigned Ext. p.m., starting Monday, September r · -----.--._ . _ _ i I l l I l NOTICE Tbe registration deadline for the Dental Admission test is next Monday, September 8. · PREGNANT? . • NEED HELP? I! NUMBER 9 I SHOP . 9 w. Northampt.on St. Wilkes-Barre, ~a. 18701 ~ Confidential Counseling I ~ Pregnancy Testing Alientown · ·I Boutique•Jewelry•Clothes Layaway Available 1• .'-\.,.tQ>IQ'>o#l,.q,~_,~~~...,c::i""41~ Women·s Center WeAcceptMosterChorge&Viso · w--= ___ - I ( 2 I 5) 264-5657 - - - - .,.,q,,o,oQt.o,,~~N#-o-.-~.,..'t,.. MIDTOWN PIZZA .< New York Style Pizza We feature Sicilian style pizza squares, serve salads, hot platters and · cold or hot hoagies. We have specialties such as: Stromboli, Calzone, Sausage Roll and Parmigiana Turnovers Receive 15% Discount with this coupon on any hot platter (Includes salad, bread and butter ) Hours : 10:00 a.m. to 9:00 p.m. Sat. 10:00 a.m. to 6:00 p.m. 41 South Main Street PHONE 829-7740 Expiration Date 9-4-80 > ~ ~ > = ~ trj 8 ~ ~ 0 z �.September 4, 1980, The Beacon, Page 3 ,"Outstanding ·American" Awarded Beacon Bits Looking for something new in wining and dining? Why no~ try the Kinney For His Many Achievements valley's newest and most unique restaurant, The Station. Located m the old Central Railroad Station on Baltimore Street, The Station provides an opportunity for local residents to dine and be ent~rtaine_d in auth~ntic 1868 railroad fashion with the advantage of 1980 mgenmty. As with other establishments, proper ID is required. "No goal is ever achieved without sacrifice." Add to this Isocrates' quote, "Nothing that is done with intelligence is done without the aid of speech" and you have the award •••••••••••••••••••••• winning Dr. Bradford L. Kinney. The Pennsylvania Department of Transportation will be soliciting bids for Recently, in recognition of his the demolition of three buildings in the right of way of the North Cross dedication, Dr. Kinney was Valley Expressway. The new link will provide a direct roadway between selected as a recipient of the the Back Mountain arid the West Side areas with Central City Wilkes- "Outstanding Young Men of Barre. This will mean traveling to and from Wilkes will become easier for America Award for 1980." This award, given to nearly 300 men namore Wilkes College students. tionwide, honors those who are •••••••••••••••••••••• dedicated to enriching the comShowcase Theatre will open its regular season with the Neil Simon com- munity and the profession they edy "California Suite." Based on a plot that centers on three couples who serve. On the community level, Dr. encounter problems while staying at a hotel in Los Angeles, the play is Kinney is an executive member of scheduled for two successive weekend performances at Church Hall, the "Kids on Campus, Inc.," and is September 5-7 and 12-14. Tickets may be obtained from any cast member a member of the Masonic Fraternier by contacting the Showt!ase Theatre. ty as well as Deacon of the First Presbyterian Church. He is also a ••••••••••••••••••••• • noted genealogist. The Shickshinny-Mocanaqua Bridge will be closed for 7 weeks beginning As an Assistant Professor of September 3 for reconstruction. Local students should be advised to use the Speech, Dr. Kinney is very active West Nanticoke or Berwick Bridges. with the new communications major. He is also the coach and the ••••••••••••••••••••• • director of forensics and debate at A new face has been added to an old body. The Boston Store was recently Wilkes and has led his team to both purchased by Boscov's of Reading from Fowler, Dick and Walker. The new state and national recognition. Dr. store has eliminated some old departments and has added some new, in- Kinney spends considerable time cluding sports and plant departments. Parking is free and bus transporta- and effort working with students to tion to Boscov's Boston Store is free Vlith a coupon. Coupons can be found in help them develop the necessary local newspapers. skills they will need both in and out of competition. •••••••••••••••••••••• Over a five year period, Dr. KinMany students can avoid having Federal Income Tax withheld from ney has built a reputation of always their paychecks. Students who had no tax liability last year and expect to having the "most prepared and the earn Jess than $3,300 this year, should file forms W-4, "Employee's most disciplined" team in their Withholding Allowance Certificate," with their employer and enter "Ex- competition circles. As the past empt" on line 3. In this way employers will not withhold Federal income President of the Pennsylvania State tax from wages and the working student will not have to file a Federal in- Forensic Association, Dr. Kinney is come tax return next year. currently serving as a contributing Students who hold more than one job during the year should file Form W- editor to the Journal of the 4 with each employer. American Forensic Association. During the past year, he has had . '-=========================:::J NOTICE Applications for bartenders, security workers and office workers· for the StQdent Center are available at the library and Student Center office starting Wednesday, September 3. Applications can be returned to Carol Benek in Waller Hall or the Student Center Office. NOTICE The registration deadline for the Medical College Admissions Test is Friday. September 5. allOOKSHAIR SALON Men'• and To the Editor: ·Seniors, as the academic year begins, we embark on our final ventures of activity here at Dear Old Wilkes. For many of us the experiences in the past years have been memorable and cherished. It is now time to set the pace and finish our stay at Wilkes with more memorable activities to further ................... ♦ manlcur" and per!'" : EastWing : 41 S. Main St. , W-8 : ♦ We hove a great selection of Indion tops, skirts, dresses and bedspreads . Also leothe~handbags and Landlubber Jeans . ♦ C • d I ome1nan seeus. ♦ ♦ ♦ ♦ Dt-1121 t ♦ ♦ ♦ : ♦ ♦ ♦ . ------------~~ ................• ,15 s. Franklin St. ~ . P o. All af reasonable prices Cliil:I .. - - I ----.... liU R ....:A~:,ITH IO% ·DIICQUNJ I II I I ♦ ♦ strengthen our love for our Alma Mater and friends. As your president, I have taken the responsibility, along with the officers and representatives of the Class of 1981, to develop · and materialize activities and events to make our final year fulfilling. But in a broader sense, the responsibility also lies with YOU, to support and assist these people as much as you can. Based on the turnout of the elections last spring, it was shown that there IS a concern for the outcome of our senior year. I would encourage each and every senior to make his or her ideas known at class meetings (which are on the Calendar), through the representatives of the class, or to me directly. The additional participation and input of ideas by more class memebrs can only strengthen our class. . . I four articles published - two on debate and two on public address. Although extremely busy at all times, Dr. Kinney also has the time NOTICE to serve as Lieutenant Governor of The National Poetry Press .anthe Providence of the Colonies of Pi nounces the COLLEGE POETRY Kappa Delia. Pi Kappa Delta is the REVIEW. Any student attending national Honor Fraternity that either junior or senior college is recognizes (jrators and debators. To eligible to submit his verse. There date the fraternity has over 400 is no limitation as to form or theme . chapters and well over 50,000 Shorter works are preferred members, of which Wilkes is a part. because of space limitations. Each In addition to coaching the poem must be typed or printed on a Debate Union, Dr. Kinney is also separate sheet, and must bear the the faculty advisor for the college name and home address of the sturadio station - WCLH. As Director dent, :tnd the college address as of Broadcasting Services .for t'1e well. Manuscripts can be sent to: past two years, he )las Jed WCLH to Office of the Press, National Poetry the title of "Best Collegiate Radio . Press, Box 218, Agoura, C~lifornia Station" for two consecutive years. 91301. The deadline for submitting Dr. Kinney was recently ap- poems is November 5, 1980. ----Letters To The Editor--- : Women'• holr 1tylln9 Bradford L. Kinney pointed by the administration to the position of academic coordinator of the co-op program. Resulting from his many accomplishments, Kinney has also been named to "Who's Who in the East." This award commemorates those individuals who have made significant strides in their profession. In the 120-year history of the award, such men as Daniel Webster, William Jennings Bryan, Henry Cabot Lodge, and the late president John F. Kennedy have been honored. Now Dr. Kinney's name will join the impressive list. A letter of official commendation was also sent to _Dr. Kinney by the Kingston City Council fQr his outstanding achievements. Council President Thomas Roberts made the motion and Councilman James Nicholas seconded it. The motion was passed unanimously to honor Dr. Kinney. Darlene Shaffer THIS COUPON I 1111•1CMUABOII T-SHIRTS m~ SWEATSHIRTS.& JACKETS CUSTOM PRINTED ~ RETAIL & WHOLESALE • COMPANIES• CLUBS • SCHOOLS • INDIVIOIJALS CALL FOR FAST QUALIT Y SERVICE / /I · fll11, ~1"8 . ~ I 86______ S. Main 825-6393_ , _.I,,__ WILKES -llRIIE UNIFORM CEltTER ____ 'F I sincerely hope to see most of you at our Senior Get-Together Picnic, this Saturday, Sept. 6. This event will · enable the executive council to meet with a larger number of Seniors as well as to get some ideas from YOU about graduation, guest speakers, parties, and the rest of the year's activities. Please, come and enjoy the music, the food, and the friendship of your fellow seniors. See JOU Saturday at 1:00 ! Robert Wallace, President, Class of '81 To the Editor: We at WCLH would like to extend a warm welcome to all the returning upperclassmen and a special hello to all the freshmen. We are the stereo voice of Wilkes College 90.7 FM stereo. If anyone would like a free program guide then why not stop at our studios, located on the third floor in Darte Hall. WCLH offers the widest musical format in Northeastern Pennsylvania. We play progressive Rock, disco, jazz, top 50, country & western, golden oldies, and a whole lot more! On Wednesdays we have the New Album Spotlight, where we feature a new album at 10:05 p.m. On the 10th you'll hear Blondie's Eat to the Beat. The rest of Spetember's new albums to be featured are: Sept. 17, Iron City Houserockers, Get Out Alive. Sept. 25, John Hipt, Two Bit Monsters. On Thursdays at 10:05 P.m., WCLH presents the Golden Album Spotlight has been replaced by three hours of the words and music of the Rolling Stones. The Stones special starts at 9:00 p.m. The albums featured for the rest of the month of September for the Golden Album Spotlight include. Sept. 18, Pat Travers, Go For What You Know. Sept. 25, Jefferson Starship, Gold. If anyone has any questions concerning the station don't hesitate to come up or call. The number is 8257663 or 824-4651 ext. 360. P.S. Attention to those concerned with joining WCLH or obtaining a 3rd class license, the Federal Com: munications Commission is coming to the Wilkes-Barre area. The 3rd class test is a very easy written test, so come up to the station and get your application because the FCC will be here in early to mid September. Sincerely, Robert Rushworth Public Affairs Director NOTICE There are still many openings for students interested in cooperative education this semester. Interested students should see Robert Koester in the cooperative office, �Page 4, The Beacon, September 4, 1980 Support Your Local SG Tr~dition usually dictates that campus organizations are slow getting underway at the beginning of a school year. It seems, however, that this year's Stu~nt Government has broken this tradition an~ started the semester with the type of momentum that is usually manifested much later in the year. The semester started off on the right note with a very successful new student orientation. Comments were that it was well received by students, parents and administration. "Playfair," this year's new addition accomplished the purpose of getting students to interact with each other something orientations of previous years years seemed unable to do successfully. The first All-College Assembly of the year is scheduled for Tuesday, September 9. Although this type of gathering was institvted last year, this year's assemblies will hopefully take on a new format geared for student participation. Having the assembly in the beginning of the year is the right step -in establishing needed "student life" rom the start. Every student should be present and show their support for the activities and policies sponsored by Student Government. Don't be afraid to show a little school spirit, unity, and enthusiasm. There is strength in numbers. In another attempt to revive what is left of school spirit, President Joe Galli and other officers are instituting an official Colonel mascot. This person would -be present at athletic and other events leading the crowd in traditional and not-so-traditional cheers. Again, the success of this endeavor relies on student support. It is hoped that it will -not be in vain or regarded as futile . A mascot is a worthwhile project which is long overdue. Also, this year's calendar shows at least one SG sponsored event each month. This is due to the breakdown of the Social Committee into sub-com~ittees, which can 'only lead to more efficiency and thus organized and interesting events. Although SG policy states that this is one of the · duties of the body, it is something which has not been followed closely in previous years - or totally ignored. These affairs include a variety of themes and will provide a welcome diversity of social events for everyone's enjoyment. The upcoming events include an All-College Picnic Hisses & Kisses The purpose of a campus newspaper is to serve as a forum for the debate of campus and current issues. In order to achieve this end, the Beacon hopes to cover events and issues fairly and accurately. Unfortunately, ~owev~r, sometimes the issue may be factually or grammatically mcorrect. . A new editorial policy concerning criticism ~f the B~acon has been instituted this year. The Beacon editors will accept valid criticisms of articles which have been published in the most recent issue. Typed complaints or comments and suggestions of. how to alter the s_ituation will be ta_ken into consideration by the editors. These must be put m a sealed envelope along with a copy of the article in question and delivered to the Beacon office or the Beacon box by 3: 00 p.m. on the Sunday after publication. . The appropriate editors will gladly ~eet ~1th the ~uthor of the -criticism at a mutually convement time to discuss the nature of the complaint, if deemed necessary by the editors. All letters must be signed in ink along with the class year or appropriate title, and phone number where the author can be reached. This information will be confidential Inconjunction with letters to the editor, hopefully, t_he line of communication between the campus commumty and Beacon editors will be greatly enhanced with the addition of this policy. In this way, the Beacon staff hopes to better serve the campus for which the paper is published. on September 13 and HERSHEYPARK trip on September 14. Events and social gatherings have not occupied all of SG's time. A written Bill of Student Rights is in the process of being adopted. This will be the first time that any document of this nature will exist in the books and not just in the minds of students. This is a definite step in the right direction in so far as students will be allowed to carry out their responsibilities in terms of their rights not only as students, but as people as well. In this same vein, SG is attempting to improve student relations with academic advisors in cooperation with college administration., Considering the unfavorable reputation most advisors have come to earn, it is hoped that this will not only improve communication between stude9ts and their respective advisors, but the content of that communication as well. Many academic, career, and extracurricular opportunities are missed because of improper and incomplete guidance at the hands of a misinformed or uninformed advisor. This combination of events and policies are the recipe for a successful and beneficial year for everyone. Student Today at 11 a.m. Government is demonstrating their support of students with these improvements. Now it is time that the students · · showed their support for Student Government through a ·by the Student Center ~ positive attitude and enthusiastic participation by all. Submitted Material Policy Campus club and organization officers take note: The following standards will apply when submitting material for publication in the Beacon. I. lncludt: the type of affair being conducted. Give complete details regarding admission fees, entertainment, refreshments, etc. 2. State the time, day, date and location of the affair. 3. List names of committee members responsible for organiz~ii,~!::i~air with proper titles, if 4. All information for publication MUST BE PRESENTED TO THE BEACON BY THE SCHEDULED DEADLINE IN ITS FINAL FORM ! Material should be in the Heacon Office, second flodr of parrish Hall or in the Beacon box in the library no later than 3 p.m. on the Sunday before publication. It should be typed in double spaced format on 8'h x 11 white paper. This rule will be enforced and the editors reserve the right not to include any information received after this deadline or not in the specified -format. Letters to the editor are welcomed from all interested parties. Letters MUST be typed neatly and submitted by 3:00 p.m. on the Sunday before publication. Letters may be delivered to the Beacon office, second floor of Parrish Hall, or the Beacon box in the library before this deadline. All letters MUST be signed IN INK, but names will be withheld upon request. Class year and-or appropriate title should be included with the signature. This status will be .verified by the editors. Any letter bearing a signature and-or title deemed as fraudulant by the editors after verification will not be published. Editorial discretion will be used in all cases, especially where questionable language is used. All letters will be published as written, without corrections (except for the preceeding case) , and the views expressed in letters are_ those of the author and not those of the B-eacon or college. Tuesday.September 9 At 11:15 In The Gym Se 1herelllll NOTICE There will be a Senior Class Meeting September 4, Thursday, at noon in SLC Room I. r.:====Tij~1R-~rr0 N_ _ lB ~ t;;;' J USPS 832-080 Letter to the Editor Policy All-College Assembly Editor-in-Chief P atti Sparlow News Editor Louis Czachor Managing Editor Margaret Scholl Asst. News Editor Darlene Schaffer Feature Editor David A. Clanton Asst. Sports Editor Copy Editor Lisa Gurka Asst. Feature Editor Mary Kay Pogar Circulation Manager/ Cartoonist Michele Fidrych Sports Editor Peter Steve Business Manager Vanessa Martz Advertising Manager Michele Serafin Photographer Frank Jeffrey Advisor Dr. Norma Schulman Parrish Hall 16 S. River St. Wilkes-Barre, ·Pa. 18766 Published weekly during the school year from September to May except for vacation periods and semester breaks. Entered as second class postage paid in Wilkes-Barre. Send form number 3579 to the Beacon, Wilkes College, Wilkes-Barre, Pa. 18766. Subscription rate to non-students: $4.00 per year. Advertising rate: $2.50 per column inch. Phone: (717) 824-4651 All views expressed are those of the individual writer and not necessarily of the publication or the college. ~ �September 4, 1980, The Beacon, Page 5 New Director of Public Relations Welcomes Student Input And Ideas What function does the Public Relations Office , located on the third floor of Weckesser Hall , serve? Who is responsible for printing all Wilkes College publications? What office should one call (ext. 205, 824-4651 ) to find out current information concerning upcoming events on Wilkes campus? These events include : Concert and Lecture Series, art exhibits, plays, recitals, community related activities, and sports happenings. Mr. Randall J . Xenakis is the new director of public relations here, and the man who can help answer the above questions. Mr. Xenakis replaces George Pawlush , who has accepted a position at N.P.W. Hospital , and brings with him a wealth of experience and ideas. A native of New Hampshire, he attended Rollins College in Winter Park, Florida where he earned his B.A. 0973 ) and M.B.A. 0975) , concentrating in ◄abor and communications. Ironically, his high school counselor recommended Wilkes an an excellent, private, small, liberal arts college ; however, a baseball scholarship lured him down South. Over the span of several years at Rollins College, he received "hands on" experience by managing, and eventually announcing basketball play-by-play, at FM radio station WPRK ; and later, becoming Director of Sports Information and Director of News Bureau. Most recently, he was Director of Public Relations and Publications at Rollins College and an Adjunct Professor of Business Administration at Southern Business College. These experiences he said "have provided me with some-background in working with television and radio people." Though quite happy with his position at Rollins, "I knew I wanted to get back to the Northeastern area." Rubbing his hand on the carpenting, he said "Florida's terrain is like this - very smooth, few mountains or hills. The weather is much Randall J. Xenakis like it is here in Wilkes-Barre right now, only it's this way all year round." He adds, " The winter months seem to revitalize me. So, when I saw the opening, already knowing the quality and reputation of Wilkes, it was just the thing I was looking for." Shortly after being interviewed by Dr. Andrew Shaw, President Robert S. Capin, Ms. Linda Holbrock, and Dr. Thomas Kelly, "I knew this was where I wanted to be. As I walked around campus and the downtown area, the people were all very friendly . I stopped and talked to local people, sat on the benches on the square, and got a good idea of the important role Wilkes College provides to the community. And, the buildings on campus are· very beautiful - quite an interesting history behind them.'' Randy Xenakis has a friendly, out-going personality and hopes. to get to know all of the students. "I want any student to feel free to come and talk with me in my office or anywhere we happen to meet. I plan to eat several meals at the caf_~teria and Conyngham Student Cen!er so I can know students on a personal basis and find out their wants and needs. I want this office to reflect the openness and friend- ship found in all other aspects of the college." He says, "I want this office to be the center of information; if we don't know it, we'll take your number and call you back.'' "My job is to let people know we have got quality students, faculty, and an academic institution here at Wilkes. This college is only fortyeight years old, and for it to have the reputation it does is amazing. Our main thrust is admissions and coordinating all Wilkes College publications. This college is updating, changing curriculum, and expanding all the time. We can compete with any school its size in the country." He envisions that Wilkes will branch out and eventually reach, and attract, students from many different geographic areas. In closing, he says "Public relations, good or bad, is the duty of everyone at this college. Word-ofmouth is often the best advertising." After talking with Randy Xenakis, one knows that public relations has never been in better hands (or mouth) . David A. Clanton ~acaaauuaaaaaucaaaaaaaauaaaacacacaaaaacaaccau~ What's Happening An All-College Assembly will be held in the gym today, Thursday at 11 : 15 a.m. Wilkes College Day at HERSHEYPARK and other activities will be discussed. Orientation to clubs and organizations will take place on the lawn betiween the Student Center and the alumni house on Thursday, Septemt>t:r 4 from 11 a.m. until 1 p.m. The rain site is the lobby of the Stark Learning icenter. A roller skating party, sponsored by Inter-Residence Hall Council, will be held at the Roller King in Kingston from 10:30 p.m. until 12:30 a.m. A Wilkes ID is required, and admission is free. There will be a performance of Samuel Beckett's "Krapp's Last Tape" in the Center for the Performing Arts on Friday, September 5 at 8 p.m. Box office will open at 7 P .m. Faculty and staff may have two free tickets. Wilkes students with I.D. may have two free tickets. General Admission is $1. The Class of 1981 will have a Senior Get-Together Picnic on Saturday, September 6 from 1 to 5 p.m. at Ralston Field. Music is by Quantrill and there will be refreshments. Tickets are $2.50 each. Auditions for "A Midsummer Night's Dream" will take place on Monday and Tuesday, September 8 and 9 at 7 p.m. in the C.P.A. New Student Orientation ... Amoeba Tag Breaks the Ice Maybe a demonstration of transcendental mass meditation? A documentary about the drug culture of the 1960's and the effects of LSD? Maybe none of the above? Actually, this is simply a description of a large group of Wilkes students meeting new people in an unusual but effective way during one of the orientation programs this past weekend. The game · just described is one of many games and activities in the repertoire of "Playfair," a program that helps people get to know one another. · The game described here is called "Amoeba Tag," a game of "it" played by running in slow motion away from those who are "it. " When the person who is "it" tags y.t.<-~ 10 -~t"OO\. someone else, the two link arms and are now "it" together. The two chase others until four are linked together. Then, like any true . ._ . . amoeba, they divide in half and now there are two "it" groups with two ATHLETIC SHOES people in each group. These two groups move around in search of PRO MODEL others to tag and make them part of AND their "amoeba." The game conSUPERSTAR i tinues until everyone in the room is & ~~ . . linked up with at least one other pm person. When any group thinks there are no more singles in the room, it I . .\ begins the chant, "Uh-mee-BAH !" HIGHPOINT ' The other groups join in and soon everyone is yelling that one word. ~ . ~-.-,~ _: After a few strong yells of "Uhmee-BAH !" the chant stops and It's We -corry the lorgnt select.ion of Adiclos time for the next activity. footwear an~ clothing in the Great N.E. If this sounds confusing, it is until you actually play it. It might even sound a little silly, but once you get involved, it becomes fun and no one remembers how childish It may have seemed at first. It may Mon.-Sat, 10-5:30 283-0285 be hard for you to lose your inhibi91 South Mains~., PHONE FOR EASY DIRECTIONS) tions, but it becomes a little easier ( when you realize the other 500 peo822-5264 ple in the room are all yelling •ALLENTOWN• BLOOMSBURG _________20_,_.p_1.e.rc_e_s_._.._K_1_n_g_s.•o_n_•------.1 "GET-OFF-MY-BACK!" while jab•SCRANTON IN...._....,.._. "Uh-mee-BAH ! Uh-mee-BAH! " Hundreds of people, walking in groups or twos or threes, arms linked with the people in their group. "Uh-mee-BAH ! 1Jh-mee-BAH !" Looking intently around them, moving slowly, but with determination, all chanting one word. " Uhmee-BAH ! Uh-mee-BAH!" The chanting becomes louder, they stride more forcefully now, sometimes jostled by other groups in the crowd, but not relenting in the deep-voiced chanting .that seems to come from the very marrow of each one. " Uh-mee-BAH ! Uh-mee-BAH ! Uh-mee-BAH !" Is this a description of this week's film in Anthropology class? Or the latest science fiction movie about a futuristic society of automatons? abric .desig )!j add a burst of color to your dorm with fabric art wallhangings, floor, toss pillows, mobiles. Also many unusual gifts for under $10. - 15% OFF ·, . . . . amer1can _; , athlete \ . ~:a. ·~;,.· ANY PURCHASE WITH THIS· AD & COLLEGE I.D. UNTIL OCT. 31, 1980 bing at their air with their elbows, and are really enjoying it. It Is not easy to say or write what "Playfalr" is, but some students at the event tried to express their feelings about the activities. "That was really neat!" and "I think this Is great!" were some of the comments made by both new students and the orientation staff. But maybe the best word to characterize "Playfair" is indescribable. Any attempt to accurately describe the effect these games have on the people taking part in them Is futile. For the past few years, the college scheduled a mixer in the gym for orientation weekend. The purpose of these mixers was to help the new students meet other students. Usually, howev~r, very few of the new students tried to mix, unless one of the orientation staff pulled them to the middle of the floor to dance. "Playfair" seems able to make everyone want to join in and have a good time. The games help to release tension, overcome shyness, and allow people to relax even though they are surrounded by strangers. "Playfair" accomplished what the mixers could not - it brought students together and helped them interact while having fun. Mary Kay Pogar ··································~ The Beacon is looking for enthusiastic people ~ become reporters for this year. Interested students should leave their name and phone number at the -Beacon office, seco~d floor of Parrish Hall, in the Beacon box located iri the library or call the Beacon office at extension 473. Students interested in doing photography work are also welcome. �Page&, The Beacon, September 4, 1980 Qa,aterbaclc Position S'IIU Open • •••••_•••••••••• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Colonels Preparing For 1980Sclaedule 0 Practice started last week for the Colonel football squad and almost as an exact repeat of last ·year, there was no starting quarterback. With the graduation of Mike Wilson and Tom Cywinski's choice not to return, 19 year veteran coach Rollie 'Schmidt said that there is no one who can be called Wilkes starting quarterback as of yet. The field general position is currently being fought for by a · number of candidates, including two freshmen. Schmidt reported that five people he has been watching include Wayne Lonstein, George Hall, Ray Boudreau, Bob Ford, and Tony Vlahovic. At this point in time, it _appears that all five candidates liave an equal shot at making the quarterback position, although Lonstein has the most experience. Going into Glenn Cola,ln his third year, Lonstein is reported as being a good passer but lacking In foot speed. Schmidt stated though that the Ellendale New York native has been working very hard on his running and has improv~ greatly over last season. Lonstein's competitors all appear to be making good showings so far in practice as well. Schmidt mentioned that Ford has shown much maturity over last year with good overall outings at practice. Hall, Boudreau, and Vlahovic have all been impressive to the coaches also, with Hall apparently playing the same kind of sound football like he did at Coughlin. Although there Is a weakness at quarterback, the rest of the Wilkes offense looks to be very impressive. In the backfield with the as of yet un-named quarterback will be alleverything Carmen LoPresto. LoPresto presently ranks third on the Wilkes_all-time rushing record. The 5-8, 175 pound senior from Pittston is coming off his finest college season ever finishing fifth in the MAC in rushing with 662 yards and 7 touchdowns. Accompanying LoPresto in the ball carrying chores will be either 5-11, 180 pound senior Rich Chapman or 5-10, 165 sophomore Scott Davenport. Chapman ranked se1cond last season on the Wilkes rushing list gaining 315 yards while breaking the goal line three times. Davenport was an outstanding allpurpose back last season and should add tremendously to the Colonel ground game. · Clearing the way for the "boys in the back" will be an experienced front line anchored by · 6-3, 230 pound tackle Carl Sosnowski. Don Jones will fill the other tackle position while 6--0, 210 pound Steve Wengen and Todd Nicholas enforce the guard spots. Defensively, the Colonels should shine again. Co-captain Ed Mollahan will be the main stopper in the defensive line at 6-4, 235 pounds. Mollahan's linemates will include Nanticoke Area grad Paul will be the anchor on the team." Aiding the defensive line in thwarting opponents will be a fine corps of veteran linebackers. Standouts in the linebacking position from last year include John Frap-polli, Glen Colvin, and Mike Azure. An experienced defensive Backfield will also be on hand to pick off opposing ariels whenever possible. Returning to the "Big-D" backfield will be Mike Gould, Joe Shurites and Don Nicholas. One star defensive performer who will not be returning this year is Bob Luby. Luby decided not to return to Wilkes this year because of the travel distance between his Florida home and the college. " Bob Luby not coming back this year is going to hurt us," commented Schmidt. "We are going to miss his experience." Luby is also joined in the no return department by Bob Rushworth, the squad's second leading receiver last year. Schmidt stated that Rushworth decided not to play football this year because of the poor condition his knee was in. After previous problems with his knee., "Bob felt it was not worth it to risk further injury" commented Schmidt. "You can't blame a kid for something like that. " After a 4-4 season last year missing out on a 5-3 finish by one point to Susquehanna, coach Schmidt is· looking for a competitive sand possibly surprising year. Commenting on his opponents Schmidt said, "All of them are tough, anybody , can beat anybody." After lookir;ig over the Northern Division of the MAC, Schmidt said that Lycoming has to be the favorite because of the return of Rick Bird at quarterback. He also pointed out that Delaware Valley is coming off its finest season ever, and Upsala is always strong, although they have a new coach and it will be interesting to I . 1 . ~ · " see what effect a new system has on the players. Along with Wilkes' usual op. ponents this year, Trenton State Schram and Dave Hadley, both and Ramapo have been added to veterans of the head hunting trenthe Colonel gridiron schedule. After ches. When asked about his defentalking to the coaches at LaSalle, sive squad, Schmidt commented, the Wilkes coaching staff has found "I'm counting on all of them." He out that Trenton State has a good he did proceed to admit that, "Ed replacements just lack the needed experience to fill in without problems. When asked what he would like to accomplish this season above an else, Schmidt replied once again with a simple but meaningful answer, " Improvement." He explained that he felt the team improved last year, and he hopes that ·u can improve even more this year. He hopes each player improves himself and after each game, he wants everyone to feel they have done the best job they could. Schmidt concluded that although winning is important, the most important thing is to compete. Out of the experience of competing, Schmidt sees the players obtaining a good feeling about themselves which he feels is the most importnat thing of all. .Pete Steve HELP WANTED Experience with or interest in 1 taking 8mm movie films? Need so- 1 meone to to some sports filming interested? Contact Mrs. Meyers, ATHLETIC DEPARTMENT, EXT. 355. BARONS' TRYOUT For the first time in the past few years, the " old name" BARONS will hold a tryout camp in Scranton. Owner Art Pachter said the camp will take place sometime in late September. Watch future "BEACONS" For further information. Bookancl RacorclMart 11 S. Main St • . Ca, 1118111.oPre.o Old-Nam4 Barons To Change Name; Pachter Hopes For More Support In an attempt to attain the winning seasons he enjoyed in the past, Baron's owner Art Pachter has decided to start the 1980-81 Continental Basketball Association campaign with a new look. Pachter intends to give his "old name" Barons a new image which includes new personnel, new uniforms, a new name, and many new promotions and other activities for fans. Pachter is running a contest to determine a new name and new logo for the ball club. All entries may be sent to the 1708 Olive Street, Scranton, Pennsylvania, 18510. The deadline for all entries is September 10th. In the-case of identical entries, the one with the earliest postmark will be declared the winner. Pachter is even prepared in case two entries with ·identical postmarks are receivwed. If this situation occurs, a special football program and is an overall good team. As far as Ramapo is concerned, coach Schmidt and his staff has received no word on the team and know relativeiy little about its football program. There w-as room for . new opponents on Wilkes schedule this year because of the absence of Bloomsburg State. Apparently, the athletic director from Bloomsburg had scheduled another team in the scheduling slot that was supposed to be for Wilkes. Because of this, Wilkes had also scheduled another opponent and when the two schools tried to correct the situation, it was too late. In one of the local papers, Coach Schmidt was reported to have started this season by saying, "The whole situation depends oil how fate treats you - kindly or unkindly." When asked to explain what he meant by this statement, Schmidt simply replied, "Injuries! " He went on to describe how injuries can ruin a whole season. At the bigger schools where they have large recruiting programs, they have the replacements of their regular starters stated the coach. He continued that the replacements get playing time through various means, but at smaller schools, the drawing will be held to select the lucky winner. The person who sends in the winning entry will receive a weekend in either Philadelphia or New York, including tickets for an NBA game. In a recent Barons' press release Pachter stated, "For years, the name Barons has been known to many, many fans . But now, with the new working agreement that the CBA has with the NBA, with the new players coming into the league, and with the new teams being add· ed, we decided to go with the new, also. So, we're running a contest to determine a new -name and new logo for the club. This brand new look and identification might take some of the sour taste away from past years, and bring back our fans, which have kind of slipped away the last 5 or 6 years.'' Opening night for the "old-name" Barons will be Thursday, Thanksgiving night, at home against the new Philadelphia club which operated out of Lancaster last season. Former Philadelphia 76er great Hal Greer will coach the Philadelphia club this season and will be there to meet Art Pachter's on opening niruit. DECKOU R'S BEER Across from Bishop Hoban Ph. 822-7045 -r•- -Imported -Col«I BeerCall In Advance lot Kegs and Quarters (Must hove LCB Cord) Wllk...larre IOOICS-R£COROS-TAPES ffl-4767 diff and Monarch Notes lloUle Schmidt r'lfl Siflrflll r'llllJSfl • I\) ~ i1Jr [Jll rn llllfl flflis ~flrl SIJSiflfllS See Bob,John,and Mike MON. -THURS. 11 A.M .-9 P.M. TUES., WED ., FRI. & SAT. 11 :00 A.M.-5:30 P.M. 288-3751 . I.,," �September 4, 1980, The Beacon, Page 7 MEMORYLANE DO MEMORIES REALLY LAST FOREVER? Pictured aboye is a photo of a football practice from years gone by. Do you know when this photo was taken or who the coach of this team? Do you know some or even all of the players? If you do, send in the answers. Each week, an old photograph will · be published from the golden days of Wilkes athletics. Now is the time for all you alumni, faculty members, students, and long time friends of Wilkes sports to become a part of the "BEACON" sports pages once again. Along with the information about the photo, send in your name, class, where you are from, and your major. Identification of the photographs will not be published until someone responds. So, put on your thinking caps and NAME THAT PHOTO! ''SUMTHIN EXTRA" WANTED by Pete Steve Well, here we go again! I hope everyone is starting to adjust to school life this week even though we have only had three days of classes thus far. If you haven't adjusted as of yet, don't panic because tomorrow is the start of one of those. life-saving weekends which always tend to ease the pain of a wicked week. Before you start to wonder what kind of column I am writing, let me get some formalities out of the way. In case you haven't heard, my name is Pete Steve and I have the difficult task of filling the very big sneakers of Eddie " Between The White Lines" White as "BEACON" sports editor. Yes, that's right, you're not reading "Between The White Lines" but rather "Sumthin' Extra." What the heck is "Sumthin' Extra?" Let me explain. All summer while I was working at my pop's gas station, I tried to think of a name for my column. I wanted a title that would catch the reader's eye and yet, one that would be pertinent to sports. Slowly the summer whittled away and I still did not come up with a title. Finally, this past weekend while I was leafing through a baseball nickname book, I found the kind of title I was looking for. In a section discussing how Dizzy Dean's fastball went "foggin' through" past the hitters, "sumthin' extra" caught my fancy. The section described how Di:r.zy Dean reached back for "Sumthin extra" to impress his coaches and veteran teammates as a rookie. Whether or not Dizzy · Dean was the first to be connected with the term "sumthin extra" was irrelevant to m~ for all I knew was that I found a title for my weekly column. Just as a pitcher in a tight jam reaches back for that "sumthin' extra" to be successful, I too hope to reach back each week and write a sports column that will give the reader that little "Sumthin' extra" as far as sports reporting is concerned. Whether or not I achieve my goal is totally up to you. Anyway, that's where "sumthin' extra" came from and wliy I chose to use it as the name of my column. ·-As every journalist should, I will attempt to keep my sports stories free of bias and personal opinion. I beleive that each week when you open a " BEACON'.' and turn to the sports pages, you should expect to find stories that tell you what happened at the previous week's games, provide you with interesting statistics, and possibly inform you about somethign you · might not have known. Only in my column and no wliere elSf' should you find a personal flavor tied in with a certain sports topic. Along with many of the sports stories, I hope to include numerous photos that add to the report. I earnestly believe that a picture is worth a thousand words, and whenever I can, I intend to u~ as many photos as possible. One final point I would like to make concerning sports coverage is that there is limited space in the "BEACON" but there are many, many sports . Also, as I have so abruptly found oqt this past week, sports writers are hard to come By. Although I hope to cover every sport, there is a possibility that resources for such coverage will not be available. If this situation should occur, I hope every coach, athlete and person on campus who is interested in sports will cooperate with me to assure that every sport is covered, that every athlete is given the credit he-she deserves, and that every persons on or off campus knows what is happening in Wilkes athletics. . Out of the three pages of sports in the "BEACON" each week two of them will be designated for the usual sports coverage type of stories. The third page, however, though will be set aside for special features and commentary. This page will include things which are not only interesting to read, but are a lot of fun as well. One of the things included on this page which I am very excited about is the selection of an "Athlete of the Week." This feature allows credit to be given where credit is due, and it should produce some colorful if not controversial results. For more about the "Athlete of the Week" selection, I refer you to that feature in this week's issue. Do memories really last forever? This year in the sports section I have decided to try and find out. Each week a photograph will be published ha\1ing something to do with Wilkes' athletics. The part you play in this feature is very simple. All you have to do is identify the photo. This is a grand opportunity for all those "I never forget a face" people on campus to excel above their -usually "absent-minded" friends and colleagues. This "contest" should be a lot of fun, and for some people, it will be 'very rewarding. Rounding out this "catch-all" type of sports page will be WEEKLY sports quizzes, puzzles, a sports. up-date and calendar, and -of course "Sumthin Extra." I will try to position the sports calendar and up-date in such a way on the page so as to allow for its easy removal for future reference on the upcoming week's events. As for the quizes and puzzles, all I can say is I hope they entertain you and provide you with some bits of information you may not have known about previously. Basically, there you have it. I hope it sounds good to you. All I can say now is that I hope the "BEACON" sports pages inform and entertain you as they never have before. With everyone's cooperation, the change over from "Between the White Lines" to "Sumthin' Extra" can be an enjoyable one at that. See you next week. For the first time in a number of years, the "BEACON" sports deparment will have an assistant Sports Editor position. This position is being established in an effort to familiarize a qualified person with the responibilities of a Sports Editor. Anyone applying must be willing to devote numerous hours to the position, cover at least two sports, and be available for Tuesday night or Wednesday morning layout. Position can possibly lead to future 'BEACON" editorial positions. A brief interview process will take place before a final selection is made. Deadline for applications is September 11th. Anyone interested can leave their name, phone number, and three available time slots for the interview at the "BEACON" OFFICE (ROOM 27) Parrish Hall, or in the "BEACON" box at the library. SPORTS WRITERS-Anyone interested in covering sports this year for the Beacon or intramurals is asked to contact Peter Steve at extension 473 or stop by the Beacon office on the second floor of Parrish Hall. -Upset Predicted For Bjorn Borg At U.S. Open . The U.S. OPEN is big, noisy, Stadium when I heard a trementoo much to drink. One of them was bustling, successful, and dous noise on one of the putside really bothering McEnroe by callthoroughly New York. It attracts cou~. Billie Jean King and Maring him a bum and a brat. After large audiences, in person and on tina Navratilova were playing a awhile, McEnroe demanded that he the tube. It is played on an asphalt doubles match. The courts were be thrown out of the Stadium. Then surface that produced exciting, packed with people standing on a fan of McEnroe's gave the man a fences, crawling to get a seat. Billie ofts:n spectacular tennis. few choice words and in turn had From the fans point of view, the and Martina were making a com- . beer thrown in his face. A big fight Open is a truly remarkable ex- ·eback in the third set after being broke out and I saw Peter Fleming perience. There are always seats down 5-1. After they won the crowd trying to restrain McEnroe from available and the players can be went wild. getting into the action. spotted everywhere you go. Andrea A record audience showed up to The last match of the day was a Jaeger (youngest seeded player in watch Bjorn Borg in a night match mixed doubles match with LLie U.S. Open history) and her father against Peter McNamara. Borg Nastase and Renee Richards. The were standing a few feet from me was in trouble at times but he was crowd loves to see Nastase yell at when I first entered the Stadium . . able to win in four sets. When Borg an umpire or make some obscene Jaeger's father reminds me of the is in trouble he will reach back and gesture. Renee Richards is not the strict little league parent type. He find something extra that no athlete most popular player on the tour, but would yell at Andrea whenever she could even dream of. After the she (?) attracts a large audience. made a mistake on court. Now you match McNamara said, "The only Just when LLie was about to go into could understand why the younger way to beat Borg is to shoot him." his act the rains came and postponplayers act badly when they lose. An hour later I was able to shake ed the .match. Before I left the court I noticed the balls and drinks were I started to-watch a match in the Borg's hand and get his picture. left behind. I left the U.S. OPEN . .- - • - - - - - - - - . . . Even though Bjorn Borg is probably. the greatest athlete in the with three brand new cans of balls, world today, I think Jimmy Conplus the ones used during the nors will win his fourth Open title. match, and four bottles of Jimmy is an exciting player to Gatorade. watch. He hits the ball harder than · There are many good players in ARMY & NAVY anybody else on the pro tour. I pick the Open this year and before it's Cris Evert to win the women's title. over there will be many upsets. 113 South Main St. Before her practice with John Look for Pam Shriver and Andrea Downtown Wilkn-Borre Lloyd (ranked 48 in the world) Cris Jaeger to surprise a few people. In HOUIS: Dolly 10..• .-S:ll,.M. promised to take it easy on him .· the men's singles Bernie Mitton and - -In..... IOe.o, ..fp.• John McEnroe can not get Harold Solomon .will also be tough through a match without causing to beat. some sort of trouble. There were Bob Buchsbaum four men sitting next to me who had ~p•1-1 -- W,',qler ft:M1.1 DINIM-colDUIOT -PLUS- . MMYPANTI PAlffll PANIS fAIMII ..ANS SWUTlitms RAIINILIHall .....,.....At _,..., Prira - ·---- - - Chuck Robbins... Januzzi's Pizza and Hoagies 125 Academy Street . Home Delivery OPEN 7 DAYS 11-1 I SPORTING GOODS COMPANY We Accept Master Charge and Visa 39 West Muket Street Wilkes-Barre, Pa. 19701 Phone: 822-1333 free Parking at Hotel Sterling P-~- Burke.'69 --~prietor - - FIELD HOCKEY Fastest growing female sports in' terested in playing - join us. More ► information, I ONTACT MRS. MEYERS, ATHLETIC DEPARTMENT, EXT. 355 �TijGIR~~0l?f . ~ ~ ' Wilkes College Wilkes-Barre, Pa. 1/2 r1cesALE· Vol. XXXIII, No. 1 September 4, 1980 . ~btNt\tJ Uork litnts 1.ooklng for a way to enhance your education ••• to save money ••• understand more wordly events ••• Then try reading the NEW YORK TIMES this semester, at the low student discount rate of 15~, HALF THE NEWSTAND PRICE of 30~ a copy. This offer is avallable to all members of campus community-dorm, commuter students, professors, and administration personnel. · FOR MORE INFORMATION CONT ACT Jon Pliskin at SLOCUM H ALL or CALL 823-2635 / - DO THESE STAIRWAYS LOOI_{ FAMILIAR? - Or have you been away so long that you have forgotten? Take a closer look and you will see that this is the center lounge df New Men's Dorm. Our guess is that your guess was probably' torrect. � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 September 4th Date A point or period of time associated with an event in the lifecycle of the resource 1980 September 4 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/2c3681b2fcf8753165178e80395b6af7.pdf d1db3ec02b8c761d543ef4f0e7a52435 PDF Text Text C-0-ed Housing Not Seen Possible Until Housing Shortage Problem Resolved 1980-81 BEACON EDITORS - Senior members of the 1980-81 BEACON staff include from left to right, Margaret Scholl, Patti Sparlow, Peter Steve, and Louis Czachor. After much consideration by President Capin, the presidential staff, and the Board of Trustees, the proposed co-ed housing policy will not be implemented next year. President Capin stated that he consulted with his Staff, which is composed of Dr. Gerald Hartdagen, Dean of Academic Affairs; Dr. Gerald Wuori, Dean of Admissions; _Dr. Andrew Shaw, Dean of Management; George Ralston, Dean of.Student Affairs; Dr. Thomas Kelly, Dean of External Affairs and Joseph · Chisarick, Controller. After this, the proposal was brought before the Board of Trustees. The Board makes the final decision concerning any changes of college policy. He continued that the administration does not see the proposal as "Co-ed housing," but rather, housing alternatives. "Housing alternatives could Beacon Editorial Staff Ch_osen For 1980-1981 Academic Year The editorial staff of The Beacon has been selected and approved for the 1980-81 academic year. Patti Sparlow, a Junior communication studies major from Kingston, and Margaret Scholl a Junior business administration major from Edwardsville will assume the positions of Editor-InChief and Managing Editor. Since the selection committee found both candidates possessing equal capabilities, Patti will serve as Editor-In-Chief the fall semester with Margaret as her Managing Editor. In the Spring semester they will switch positions making Margaret the Editor-In-Chief and Patti second in command. .The responsibilities of both positions involve coordination of the efforts of the entire staff to publish a weekly newspaper throughout the school year. The Editor-In-Chief is the one who is ultimately responsible for all aspects of the publication. Patti has served on the staff for two years and was this year's Copy Editor. Margaret has also been on the staff for two years and has most recently served as the Op-Ed Editor. In the news department threeyear veteran Louis Czachor, a Junior mathematics major from Wilkes-Barre, has been promoted to the position of News Editor. He served this year as Asst. News Editor. Louis will be assisted by a newcomer to the editorial staff, Darlen_e Schaffer, a Sophomore communications studies major from Ashley. Darlene has been with the staff for one year covering Commuter Council. Lisa Gurka, a Sophomore Communications Studies and Sociology major from WilkesBarre, will take on the position of Copy-Editor. Lisa has been with the staff for one year as a reporter and is also a member of the WCLF-FM radio staff. Taking over the Sports Department will be Peter Steve, a Junior Communications Studies Major from Wilkes-Barre. Pete has been with the Staff for two years and served as this year's News Editor. Sports is nothing new to Pete, but writing about it will be a whole new experience. David Clanton, author of the column Campus Commentary, will be next years Op-ed Editor. He is a Sophomore from Deerfield, Illinois and is a biology major. Dave joined the staff j_ust this past semester but has proven himself as a capable editor. His assistant will be Mary Kay Pogar, a Sophomore biology major from Hazleton. Mary Kay has been on the staff for one year serving as a reporter. Her chief assignment all year was to cover the Inter-Dormitory .Council meetings. Rounding out the editorial staff, Vanessa Martz, a junior accounting major from Chambersburg, will serve as the business manager. She was this year's advertising manager. Michele Serafin· will be next year's Advertising manager. The sophomore accounting major from Dupont was this year's Circulation Manager. These selections were made after each candidate applied for a position and was interviewed by the selection committee. The committee members were as follows: Dean Arthur Hoover, Dr. Brad Kinney, Dr. Walter Karpinich, Mrs. Jane Manganella, George Pawlush, Dr. Lee Terry, Edward White III and Jim Edwards. ''Manuscript'' Staff Selected For Next Year The Student Publications Committee recently approved the staff positions for next year. The selection of the Manuscript staff is decided by an election process. Barbara Metroka has been elected by seven votes as editor-inchief of the college's literary magazine. Barbara, a junior art major, served as art editor this past year. She is a resident of Courtdale. Ellen Krupack brought in six votes which won her assistant editor for the second consecutive year. Ellen is a sophomore English and computer science major from Wilkes-Barre. Serving as Art Editor will be Lynn Taylor. She is currently a sophomore art major from Bayville, N.Y. mean men and women living on alternate floors or separate · wings," he stated, "Many people get the wrong idea when the term co-ed housing is used.'' There are many reasons for not making the proposal policy, Capin said. First, there is an acute housing shortage on campus, and this is a priority over a . change in policy. He believes that the inadequate number of housing spaces must be dealt with before any housing alternatives can be considered. Moreover, no firm decisions have been made for a new dorm. If the college does build a dorm, however, the discussion is always open for · possibility. This would not be a good time to change the housing policy, he stated, e1eplaining that the freshman class for next year has already been recruited under the present policy. ''This year would leave the Admissions Office open for criticism by some parents," he said. If a decision is made for housing alternatives, it would be made in the fall or spring for the year there after. For example, if an alternative housing policy was approved in April of 1980, it would be implemented in the 1981-1982 academic year. "This two year lead time is necessary to allow for the planning of putting the policy into action," Capin said. Many of the facilities on campus are not built to allow for alternative housing. Dorms such as New Men's are the best type for housing alternatives. The old homes, which house most of the females, are not well suited for a change such as this one. Finally, the Board of Trustees must approve the change before it is policy. "Many people have the misconception that because a <Continued on Page 10) Claerry Blossom Sclaedule FRIDAY , APRIL 25 Opening ceremonies on Chase Lawn, Wilkes Campus at 4p.m. Games officially begin at Kirby Park and Ralston Field 6 p.m. include: bat race, two people in a sack race, egg relay, three-legged race and a suicide relay. Many others. · "Nerd Party" in the Gym, I.D. card absolutely necessary for admittance. Music by THUNDERBIRD 9p.m.-1 a.m. A piano recital by Catherine Davis at Gies Tecital Hall-Music Bldg., at 8:15p.m. SATURDAY, APRIL 26 11 a.m. begins softball competition at Ralston Field. 6-9 p.m. continuing softball tournament in Kirby Park. Carnival and rock music in Ralston Field area from noon until 5:30. Games-all afternoon in Kirby Park and Ralston Field. These will include a FRISBEE ACCURACY CONTEST and TUG-O-WAR. EVENTS FOR SATURDAY-ON CAMPUS 7p.m. Church hall, Two plays by the Wilkes Theater Department, "THE IMBECILE" directed by Paul Kerrigan, and "I RISE IN FLAMES, CRIED THE PHOENIX," directed by Chris Lonstrup. 9p.m. on Chase Lawn a block party sponsored by Interdormitory Council and Commuter Council. I.D. necessary, Wilkes Students Only. AFTERNOON art exhibits·and demonstrations in the Courtyard at Stark Learning Center. Joint music recital by Lisa Robak and Maureen Stanks at 3:30 in Gies Recital Hall, Music Building. . Evening piano recital by Michele Millington Drago in Gies Recital Hall, Music Building at 8: 15 p.m. Art Exhibit by Robert Gaetano, Conyngham Gallery, River Street. Afternoon and early evening hours. A major Art Exhibit at Sordoni Gallery "Three Women" all day Saturday and Sunday. SUNDAY, APRIL 27 12-2 p.m. Softball championship in Ralston Field. Carnival continues 1-4 P.m. Cherry Blossom Run begins. 2:30-4:30 swimming competition for college teams at the YM-YWCA. CONCLUSION 7:00 awards presentation to the winning teams at the Wilkes College Church Hall. 7: 30 p.m. movies at the Church Hall. $.25 admission. Keystone Kops Charlie Chaplin 3Stooges Abbott & Costello 9: 00 Munnett Movie �Page z, The Beacon, April 2-1, 1!180 . Individual Award-Winners ListedBe/,ow •··································································· Annual Awards Luncheon Honors Outstanding Students The annual Student Awards Luncheon was held on April 22 in the Center for the Performing Arts. Dean Art Hoover made the introduction. Opening remarks were delivered by President Robert S. Capin, and Dean George Ralston gave closing remarks. The award winners are: Academic Awards Aerospace Studies Dept.-The Air Force Association Award and the · Armed Forces Communications and Electronics Association Award, Paul Miller; Reserve Officers Association Award, Christian L. Shippey; Daughters of the American Revolution Award and the American Legiori Scholastic Award, Dorothy A. Maguire. Art Dept. - The Artistic Mer.it Warren Bush; Art Scholar's Award Debra Yatko. Biology Dept. - Biology Scholarship Award, John Andrake; Biology Research Award, John Andrake, David )llumfield, and Julie Kent; Biology Club Sophomore Scholarship Award, Jill Winslow. Chemistry Dept. - The Professor Catherine H. Bone Award, Lynn E. Jones; The Professor Alfred W. Bastress Award, Jose A. Olivares and Michael J. Miller; Chemical Society Outstanding Freshman Chemistry Award, David Sedor and Award, David Varon. Earth and Environmental Science Dept. • Academic Achievement Award, Bruno E. Kolodgie; Copernicus Award; Polish Union of .U.S. of N.A. Dorothy Maguire. Small Gr-0up Participants Capture National Award Achievement, Engineering Joseph Rauscbmayer; Materials Engineering Achievement, David L. Sapak; J.J. Ebers Memorial (IEEE), Joseph Rauschmayer. History Dept. - Greater WilkesBarre Democratic Club Proficiency in History Award, John Blihar. · Dept. of Language and Literature - Frank J .J. Davies English Award, Davida Roberts and James Wallace: Theater Awards, Paul Kerrigan and Adele Tavella; M. Williams Scholarship, Maria Smigel. Math & CS Dept. - Mathematics and Computer Science Department Award, Lee Ann Earl. Nursing Dept. · Highest Academic Achievement Award, Carmella LaBuz; Highest Nursing Award, Sharon Weiss. Philosophy Dept. - M.D. Brandwene Award, Joseph Blizman, Department of Philosophy Award, Frank Sabatini; Phi Sigma Tau Awards, Patricia Conners, Cheryl Ann Zoni, Joseph A. Rigotti. Physics Dept. - Bachelor of Science Award, Dorothy A. Maguire; Bachelor of Arts Award, . Joseph M. Della Croce. Political Science Department Award, Fred Pierantoni and William Lewis. Sociology-Anthropology Department Award, Sue Isaacs and Bette Lynn Gardner. Operation Phoenix (Act 101) Academic Achievement Awards, Eugene Neary and Patricia Patrician. Appreciation-Merit Service-Awards Beacon Awards - Female Athlete of the Year, Diane Kendig; Male Athlete of the Year, Bryan Billig. Circle K Outstanding Service Award, David Blumfield and Walsh: outstanding IDC Representatives, Barbara Hamilton and Michael Stapleton. bara Hamilton, Lisa Mastrantuono, Lori Mieszkowski. Commuter Council Service Awards, - William Lewis, Dan Patronick, Marty Pezzner, Kenneth Rodgers, Robert Dinkin. Concert and Lecture Series Committee Cultural Award, John Andrake. Faculty Women's Eleanor Coates Farley Scholarship, Dina Sauer. Inter-Dormitory Council Awards - outstanding Senior Resident Students, Sue Isaacs and Larry Michael Sibilia. Journalism Society Achievement Award, George G. Pawlush. Letterwomen's Awards - Letterwomen's Scholarship Award, Sue Freda; Correen Santoro Memorial Award, Rosemary McMahon. . Speech Division Awards - David Evans Outstanding Debater Award - Davida Roberts; WCLH · FM Outstanding Broadcaster Award, Fred Pierantoni. Student Government Appreciation Award, David Blumfield. Women's Activities Association Awards; Donna Grontkowski, BarThe awards for Who's Who Ahlong Students in American Colleges and Universities were also distributed. Recipients and their achievements will be listed in the 1980 Commencement Program. WCLH.P rogram Director Claosen; George Saba To Assume Duties AWARD WINNING DEBATE TEAM - Pictured above are members.of this year's debate union. From left to right are Patti Sparlow, Celleen Gries, Nena Wl&ko ud Darlene Schaffer, who achieved honors in the natioaal discassion contest. The speech division has won another national award for the college. Members of the Small Group Communication class, under the direction of Dr. Bardford Kinney and the debate union · received notice that their taped entry in the 29th annual National Discussion Contest, hosted by Ute University of Georgia, has been judged one of the best three tapes in the nation. The contest was public discussion · on the topic: "Should all United States students be required to pass a standard subject examination to graduate from high school?" The tournament was conducted through the use of tape recordings and judged by some of the top communication educators in the country on the basis of technique and content. · It was reported last week that Wilkes moved through the preliminary rounds. The top 30 . tapes judged as the best advanced into the semi-finals. Wilkes was entered in the grand championship round. This round was conducted at the Southern Speech Communication Convention in Biloxi, Mississippi. The outcome of this event has not vet been determined. The award winning team consisted of Norm Witko, moderator; Colleen Gries; Patti Sparlow and Darlene Schaffer. Most contestants for this national tournament are coached and directed for between four and six months prior to entry. Dr. Kinney started bis group in February and sent the tape entry to Athens, Georgia in March. This left only one month for the preparation of the presentation. This tournament marks the second time that a joint effort between the debate union and an academic course has been attempted for national recognition. Dr. Kinney hopes that this will be the first of many opportunities for students interested in speech communication to gain experience and to sharpen their skills in discussion and debate. This award adds more honors to the speech program. Debate and forensics won 60 awards this academic year, including numerous honors in public speaking, debate, and now discussion on tile intercollegiate and national levels. There may be another position open due to the resignation of Les Nicholas. Pierantoni stated that Saba was the best candidate for Program Director because of his two year station experience. Coupled with his experl~c_e ~ . a D.J. and It was announced earlier this week by Fred Pierantoni, WCLH Station Manager, that George Saba was selected as Program Director for the 1980-81 fiscal year. ' Besides Saba, there were six other candidates vying for the position including: JohnSczcepanski, Bruce Nachlis, Stan Ray, Kendall McNeil, Ernie College, and Ron LaBatch. According to Pierantoni, it was a very close race for the second highest position on the executive staff, with much deliberation involved in making the final decision. Because all of the candidates were equally qualified, the second and third finishers in the interviewing process were elected to junior executive staff positions. These two station members are John Sczcepanski and Ernie Coll~ge. reporter, Saba also had the most impressive interview of all the candidates. Pierantoni commented that Saba showed a real interest in ,the station, and would be a definite assett to next year's executive staff. Peter Steve Januzzi's Pizza a nd Hoagi·es 125 Academy Street Home Delivery OPEN 7 DAYS 11-1 ,---:----------·-' r'IEI ~iEIIElll r'llllJ~EI II l1lOOllOO . I 1 I • -- ARMY & NAVY 113 South Ma in St. Downtown Wilkes-Barre · & Thurs. 10a.m.-9p.m I w., -~ I II · E::1--1 1' I 1 I I i I DENIM-CORDUROY . · - PLUSARMY PANTS PAINTERPANTS FARMER JEANS . SWEATSHIRTS FLANNEL SHIRTS . Boutique Fashions At Army-Navy Prices • I\) i1Jr HOUIS: Daily 10o.m.-5:30p.m. - ...., ...,. I I I I I ~~~,.....,,_,.,....,.....,,_,.~~~.._.i Ullflll]llflflfliS ~f)[I SIJSiflrDS See Joe, Bob, and Danny MON.-THURS. 11 A.M.-9 P.M. TUES., WED., FRI. & SAT. 11 :00 A.M.-5:30 P .M. 288-3751 . ~3:: z G) y ., )> ,=::: ', " ~ (/) az , . �April 24, 1980, The Beacon, Page 3 Extracurricular Activities And Probation Commuter Council Plans Discussed By Student Government Body Cherry Blossom ·Activities One of the main topics of discus- felt that there should be no "second ·replace bus tokens and park and sion at Monday Night's Student Government meeting was the proposal by the academic standards committee which states that "Any student placed on academic probation as defined in the College Bulletin will be ineligible to hold student governmental office, work on College publications, participate in College sponsored intercollegiate activities, or hold a position of authority or responsibility on campus." SG vice-president Marla Brodsky stated that she felt that the proposal should not be approved and she suggested that SG write a letter to the faculty asking them to reject the proposal. (For more information: see the letter to the editor, page 7 in this issue from Marla Brodsky and Gayle Lovering. It gives a detailed account of the point Miss Brodsky made at the SG meeting.) Joe Gallj, SG pre&ident, asked the representatives for their opinions regarding the issue. Ann Cardillo said that she agreed with Marla, and she made the point that although academics is important, athletics has its importance too. Freshman rep Elaine Kerchusky added that many students need other activities to help them make it through the school year. She continued by saying that she thinks many students would do worse if they were not allowed to participate in athletics and other activities. Brodsky made the point that the athletic committee agrees that the proposal should not be passed. Dean Hoover clarified Brodsky's point by noting that the committee class citizens" at the college. He added that if a student is allowed to be in school, he should be able to participate in all activities regardless of whether or not he is on probation. In conclusion he- said that the chairman of the athletic committee, Mr. James DeCosmo will express ..the feelings of that committee at the next faculty meeting which is on Thursday, May 1. Joe Galli ended the discussion by saying that He, Marla Brodsky, Ana Nunez and the SG advisors will prepare a letter to be sent to the faculty. In other business, Galli announced that next year's SG parliamentarian will be Ana Nunez. Also, he announced that committee chairpersons had been selected for next year. Ana Nunez and Dana Shaffer will chair the academic comittee. The publicity' and elections committee will be chaired by Chris Fellin and Rob Doty. Chair- _ ing the film committee will be Elaine Kerchusky and Joanne Rice. Corinna Bender and Leigh Major will be chairmen of the social committee. Finance committee chairman will be Tom Rooney, and the chairmen for the .concert commitThe IDC meeting on Sunday night tee will be chosen at a later date. began with Mike Stapleton turning Also, the SG body selected Dean over the meeting to President Hoover and Mrs. Barker as their Janine Tucker. Stapleton comadvisors for next year. mented that he wanted to express 'Under fund requests, the Struthis thanks to all the IDC reps and ters were granted $600 to help pay stated that he felt it has been a very for new uniforms. the request was good year and that he had enjoyed granted unanimously. himself. · Commuter Council also reCommittee reports were then quested funds. CC asked for $250 to given. Under the maintenance committee report, chairman of the committee Jon Pliskin stated that vandalism to the outside doors to the first floor of Pickering Hall had Janine Tucker Takes Over As New President Of IDC You'll be am~ at all the opportunities and advantages the Army offers men and women . with BSN degrees: • Excellent starting salaries and benefits, including a liberal vacation policy. • Real opportunity for advancement and professional growth-every Army Nurse is a commissioned officer. • No basic training for nurses; just ~ basic orientation course to familiarize you with the Army Medical Department. • The chance to travel; time to do the things you enjoy. • Opportunity to qualify for specialized roles, teaching or additional education. Call collect to See if you qualify. Th A 301-677-4891 N C PS :·~-l~,.~:~r---l)~S~____ ()~----·: 1 The Army Nurse Corps. : Northeast Region , U.S. Army Recruiting MD 20755 1 Fort George G. Meade, I 1 I : Ci ty. State. ZIP _ _ _ _ _ _ _ _ _ _ _ _ __ _ _ _ : : ~0_": -_-_-_-_-_-_-_-_- _- _-_- _-_-_- _-_- _ _-_-_-__-_-_-_-_-_-_-_-_-_ tfses-l N-E-RR-C ,_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __ __ , been discussed at the last meeting. It has been proposed that van- dalism to these doors had occurred because they were locked too early, so that students returning to their dorms late at night tried to break in the doors rather than walk all the way around the building to the main entrance to enter the dorm. As a result, it was proposed that the outside doors be kept unlocked until a later time. These would be the outside doors to Butler, Roosevelt and Warner Houses. It was noted that the possibility of theft occurring on the first floor would increase if these doors were left open, but since no rep was preNOTICE sent from any of the three dorms Any Student Government that would be affected, no decision representative who has not yet was made on the matter. Pliskin returned their constitution and stated that anyone from any of bylaws booklet are asked to bring those dorms should contact the them to the SG office as soon as housing office and express the opipossible. or pay the replacement nion of those in his dorm. fee. Under new business, it was stated that the mats that are used in the gym for parties will be cleaned this Thursday from 10 until 5, in back of Book and Gore Hall. SG President Joe Galli stated that he blamed the poor conRecord Mart dition. of the mats on the past . negligence of CC, SG, and IDC. He 11 S. Main St. also stated that $10,000 has been WIikes-Barre spent on the mats so they should be BOOKS-RECORDS-TAPES kept in better condition. Mike Stapleton noted that clean-up com125-4767 mittees for the parties in the gym Cliff and Monarch Notes do not have the necessary equipment to clean the mats well, which may account for their poor condi...of'"~ tion. President Tucker recognized Shep Willner for his four years on IDC as a rep, and commended him for outstanding service to IDC. Shep was given a round of applause -e • STYLING FOR MEN&' WOMEN in appreciation of his dedication to ; •HAIRCOlORING&CONDITIONING IDC. l • PERMANENT WAVING ~ ~ : ~~~Rli~R~~~~;~~~~fTMENT Tucker then closed the meeting with several comments. She stated •MANICURING• SHOE SHINE CAll FOR APPOINTMENT • she had "really enjoyed IDC FRANK•PETESARTOI\IO-PROP. 8 that this year,'' and was looking forto having a good year next 25 ward 11N ~!~~8 !~ year. ·- ~ ~. . . ~.·::.;.oK·~s~ ~ m· j I(a£?ii~i~~), 1 : : Name _ _ _ _ __ _ __ _ _ __ __ __ __ _ : 1 Address _ _ __ _ _ _ __ _ _ __ _ _ Apt. _ _ : 1 ~ lock coupons which were stolen from the CC office during Easter Commuter Council discussed its break. The request passed plans for the Cherry Blossom unanimously. Festival this coming weekend. CC Marla Brodsky requested $300 for will be sponsoring a team and will the CC-IDC block party which will also be manning a game booth. Exbe held this weekend in conjunction pected to participate on the team with the Cherry Blossom Festival. are: Maurita Gries, JoAnne BenThat request was also granted nick, Margaret Scholl, Amy Elias, unanimously. Molly Salmon, Carolyn Hannon, Two requests were made which John Moffatt, Charles Boyer, Bob will be voted upon next week. The Hinkin, Eric Johnson, Bill Stusnick, first came from the Biology Club. Joe Rubbico and Bill Miller. They asked for $125 to help pay for a In addition to participating in the trip to Virginia Beach. The second events, Commuter Council will be fund request came from the Ma- · sponsoring a Block Party Saturday jorettes. They want $500 to help pay night from 9 to 1 o'clock on the the costs of purchasing eight new Chase Lawn. The Blue Grass uniforms. Festival will not be a clam bake as The meeting closed after Dean originally hoped for because of the Hoover and Mrs. Barker commend-. CC robbery; food will however be ed SG for good job they had done served, and a folk band will perthis year, and thanked them for form. The block party is a nonselecting them as advisors for alcoholic event and students will another year. not be allowed to drink at the party. Louis Czachor According to Dean Hoover, "If we i ~.,r_.o--~..;CO"'J"J"_,......-.::ac-.:r.,...J00""' ✓ .,;. Mary Kay Pogar see someone drinking, we will have to ask him to leave." Admission is free and all are invited to attend. · Still under unfinished business, CC office hours will be restricted from 11 to 2 o'clock because of the robbery and a new security system will be obtained in the near future. Currently Peggy Jones is handling all CC transactions. The CC Decorating Committee, headed by Maurita Gries held a demonstration seminar before CC's meeting. Joe Knox, COPUS President announced that, "the committee is to be commended for an outstanding job of decorating the COPUS office into the new Wilkes College "Kennedy for President" headquarters! They did such a fantastic, terrific job that I have made a list of all those who participated and will make sure that I personally repay them for a job well done." President Bill Miller noted, "It only goes to prove that CC is a hard working group." It was also decided during Monday's meeting that John Moffatt and Bill Stusnick will serve on the SG Film Committee. The Committee will meet Uiis Friday afternoon in the SG office. Also, all members of the Council are reminded that from 10 to 5 o'clock today there will be a mat clean-up in the parking lot behind Gore Hall. All members are expected to attend. The meeting concluded with several reminders. Commuter Council will be appointing a parliamentarian. Anyone interested in this position must be an elected representative of the Council and should meet with Bill Miller as soon as possible. Also, the events sign-Up sheet will be in the CC office. Those that plan on participating on the CC team for the Cherry Blossom Festival must sign up. Finally, Admissions is looking for people to help with the phonathons this coming Tuesday (which will follow a Friday's schedule). A small get together will be held before the phonathons and help is urgently needed. NOTICE The class of 1981 will sponsor the first ever Car Smash April 30th in the Conyngham parking lot. The junior class challenges any ,one to damage an almost new car with a sledge hammer. The price will be 2 hits for $.50. All proceeds will benefit the Student Center for the acquisition of a stereo system. The car smash will start at 11 : 30 and continue until about 3:00 p.m. or until there isn't a car left to smash. NOTICE . There will be a class of 1983 executive council meeting Thursday at 11:00 a.m. in Stark Lobby. ,tclass meeting will follow. NOTICE All those who signed up to help clean the gym mats should be advised that the big wash day is today (you lucky people) . Be sure to report to the rear of New Men's to help with the cleaning, join in the fun, and get high on ammonia. �Page 4, The Beacon, April 24, 1980 S GAnalysis------------------------------ llllprOvement Needed Despite Strong Year Among the accomplishment of Student Government this year the greatest was building a strong foundation which can allow for expanded student services, better social activities, greater expression of student opinion, and improved organized student leadership in the future. It seems that this year SG got its act together and will now be able to push forward in making policies to meet student needs. SG had a good year, but there is still room for improvement. At times, a person trying to get in touch with Blumfield found it very hard to do so. An SG president should make himself more available to the students. Blumfield deserves much credit for completing an evaluation of the representatives so that everyone could see what kind of job each rep had done. No one person could evaluate each rep as Blumfield could because he was the one person who knew them well enough and had seen them all work. For the most part his evaluations were accurate and fair. COMMITTEES ed the tnree groups to work each meeting and provided some The academic committee, together for the good of the insight into what the admistration chaired by Ana Nunez, attempted students. was doing and why. to tackle the problem of teacher OUTSTANDING REPS Hopefully next year SG will conevaluations. Apparently the comMost of the representatives did tinue to move in a progressive mittee decided to do away with the an adequate job this year, but direction and offer more varied acevaluations, and there was never several did much more than what tivities. If SG can get more students announcement of any proposal to was required of them. Included to take part in campus activities. change the evaluations or establish among these outstanding reps are: student life can be greatly improva course advisory board. The Marla Brodsky, Joe Galli, and Ana ed. This year SG laid the foundation academic committee also tried to Nunez. for that improvement ; now it is prevent the faculty from passing Those doing an above average job time to build upon that foundation. the new withdrawal policy, but they are: Ann Cardillo, Laura Louis Czachor were unsuccessful. Danowski, Chris Fellin, Elaine KerPRESIDENT BLUMFIELD The film committee presented chusky, Tim Palmer, Tom Rooney, several good movies and many SG president Dave Blumfield proDave Samsel, Diane Seech, Sue FINANCIAL SITUATION were well attended. Chairpeople ved to be a capable leader in many NOTICE Suchanic, and Al Wirkman. This year SG had one of the best ways. He kept meetings running Janet Croft and Ross Mantione did In our evaluationatthe end of last Have you been away from camtreasurers in recent years: Joe a good job despite problems with orderly and smoothly. He ensemester, we asked for more pus life for a few years before Galli did a fantastic job of managprojectors breaking down. At the couraged all representatives to exdiscussion among the reps. That re- resuming your education? Ha ve end of last semester Mantione left press their opinions and take part in ing the money. Each week he quest was heeded and at times the you been looking for friends among the college and this made Croft's discussions were lengthy and bor- fellow discussions. Whenever necessary, presented treasury reports which students who share your injob more difficult but she managed he called special meetings of the enabled everyone to see how SG ing. However, many good points terests and concerns? Then come to to do well despite the increased body such as the meeting before stood financially. The reports were brought up by the reps. The the next meeting of the Over-theworkload. Christmas to plan a concert, and helped reps make decisions about major contributors at the meetings Hill Gang, a social and support The publicity and elections comthe meeting on the Monday"'° after fund requests were granted this were : Marla Brodsky, Ann Car- group just formed on campus for all requests were mittee did a poor job under the Easter where the budget was year-three dillo, Rob Doty, Chris Fellin, Bill students, full or part-time. day or withdrawn before voting and only leadership of Shep Willner and Al discussed. Keba, Ana Nunez, Dave Samsel, evening, of any major. Wirkman. Elections and nomina- Mike Stapleton, and Shep Willner. Among Blumfield's successes is four requests were not approved. Dolores Vida, acting president, tions for candidates were poorly the first All-College assembly in re- Lesser amounts than requested SGADVISORS invites all interested prospective publicized and there were often cent years. The assembly, at the were granted in two of the four One of the best things SG did in members to attend Friday evening, reports of irregularities at the pollbeginning of the fall semester, was cases that were not approved. The recent years was picking two ad- April 25, at 9:00 p.m. in SLC-333. ing places. The used bookstores well attended and expressed the op- treasury was so well managed that visors-Dean Art Hoover and Doris Summer plans will be discussed were also poorly run. It seems that timism and enthusiasm SG had for at the end of last week there was Barker, Register. Because of their including a family picnic and a little planning went into the this year. All who attended were still over $7000 left. Perhaps SG ev~ryday contact with students and theater group reservation. Dr. bookstore, and questions such as shown that this year's SG was in- should have put more of this money other members of the administra- Charnetski is advisor to the Overwhere it would be located, who terested in getting things ac- to use during the year, but even now tion they have been in a good posi- the-Hill Gang. would run it, and how it would be complished. But, when the second there is talk of using some of it for tion to help SG make wise decirun were never answered until the All-College assembly took place at the stereo for the Student Center sions. They kept the represenNOTICE last minute. the beginning of this semester few or some other project. It seems tatives thinking and active. They Happy Birthday to Dimples and a The social committee tried to imstudents attended-perhaps an in- ironic that with $7000 left at this offered constructive comments at Belated Happy Birthday to Doc! ! ! prove the social life of all students dication that many had lost interest time of the year that SG has approved a budget for next year by offering more and better acin what SG was doing. tivities. The committee, under the Early last semester Blumfield which includes a 100 percent indirection of Marla Brodsky and led SG In Initiating a campaign to crease in the activity fee. Also along the lines of money, in Diane Seech, sponsored several acraise funds for a stereo and largetivities, parties and coffeehouses. screen television for the newly order to encourage more clubs to Also, "Parties Unlimited" was opened student center. The idea have parties the maximum allowed chartered as a subcommittee of the was received enthusiastically at profit was raised from $30 to $50. PURCHASE WITH social committee so that there first, but donations were coming in Perhaps another raise would do . . _ . ... _ ... __ .,._,.. THIS COUPON would be parties in the student slowly and after Blumfield injured more good; a club could have a parcenter each weekend. his back during Christmas break, ty thereby providing social activity Ana Nunez chaired the he could not give as much attention and make some money and not Homecoming committee which to the project as he would have lik- have a request funds from SG so that huge increses in the activity helped to make Homecoming a ed. PU■LIC SCIUA■I 0■ memorable weekend for all involvBlumfield should be commended fee will not be necssary. Among Galli's other ac_ __-__ -·-MIN ...iLLII ed. Winter Weekend was successful for his repeated condemnation of and the theme of the Olympics was ____.......,,,................__....._....,....__..-.........._.....,....,....,.....,....,..~..,....,..~---·~.._..i vandalism on campus, but it is too complishments are his work on the a brilliant idea. At times, however, bad that steps were not taken to trip to Hershey Park last fall and it was evident that plans had not somehow lessen or prevent van- his coordinating of the Florida trip this spring. Both trips were sucbeen made for some of the events dalism. until the very last minute. Winter As SG president, Blumfield tried cessful and helped to set a preceWeekend chairpersons Marla Brodhard to express the views of the stu- dent for future years. Thurs. TRISH OTHER OFFICERS sky, Diane Seech, Tim Ryan, and dent body to the administration. He Marla Brodsky did an above seemed to get along well with the Dave Blumfield. The Cherry Fri. PETESCHAUMLOFFEL Blossom Festival has been in the ~ administration, but he was not average job. She was always full of planning stages for the last few always successful in persuading .·.life and ready to do any job that had Sat. PETESCHAUMLOPFEL i months and this weekend we will them to adopt the students' point of to be done. She learned to do her job view. However, he did show that the so well that she was elected to the see the results of that planning. i ' ~ Chairpeople for the Cherry administration is willing to listen to same position for next year. Show begins at 9:30 Recording secretary Theresa Blossom festival ae Corinna Bender i ~ ~ /J:. · and cooperate with the student j.._.......,...,.................,...,_....,...,_...~~..........,....,....,..~---...,.....,........... _...,,..._ and Bobbie Hamilton. leaders. Near the end of the year a Gabana took good notes so that the Ann Cardillo and Dave Samsel committee was formed to look into minutes of each meeting were acwere chairmen for the Red Cross student rights. If a written Bill of curate and complete. However, the Variety Show which took place last Student Rights is prepared this minutes of a meeting were not weekend. One of the biggest prosummer, SG should be able to work always ready for the following blems they had was getting with the administration better in week's meeting. Corresponding secretary Ana cooperation from some of the other following years. colleges involved in the show. An One of Blumfield's greatest Nunez did an excellent job. Many added feature this year was the Stufailures was in the area of com- times she brought up interesting dent Center Party following the muniction with the students. In his topics for discussion which helped variety show. election platform, he had promised keep SG on its toes. Although she Just bri ng in your resum e and we 'll do t he rest . IDC President Mike Stapleton regular newsletters, but the was extremely active in all aspects Typ ing , t ypeset ting , and co pying are available and CC President Bill Lewis kept newsletters were never written. As of SG she chose not to run for office the year progressed he began to for next year. SG informed of what their respecalong w ith a choice of t ypestyles , paper colors keep secrets from only the press Bill Keba, as parliamentarian, tive organizations were doing. This and paper we ight s. Stop in or call for more but in some cases from the SG reps. tried his best to make sure all enabled the three student governinformation . Even SG's executive council did not aspects of SG were taken ere of aping organizations to cooperate betalways know what was going on un- propriately. Also, he made sure ter. In fact, SG, along with CC and 37N . RI VrnSTREET til Blumfield announced it before that all new clubs submitted conIDC held a tri-organizational WILKES -BARRE . PA. 1--11--1everyone. stitutions that were fair and legal. meeting in November which allo~- .l '· I II If I I II m..,.._j EMERSON'S 4, l I Features: @ I I I I saa 3766 t �April 24, 1980, The Beacon, Page ! I DC Analysi• ---~~---------------------------- Changes In Staff Positions Pro_g ~ess ·S een In Several Areas Announced For Next-Year IDCAftershowed a slow start· last semester, participation can attributed to have received parking tickets for reasons. a significant improvebe several factors; greater interest Academic Dean Gerald Harting; Patricia Hoffer, Assistant Pro- ment in several areas. Under the shown by the reps, discussion of dagen announced changes in staff fessor of Nursing; Mary Claire leadership of President Mike more topics of dorm student inpositions for next year, affecting 26 Manganiello, Assistant Professor of . Stapleton, IDC became more interest such as co-ed housing and faculty members to date. Nursing; Mary Claire Manganiello, volved in planning social activities hpusing in general, and the enfor students, such as the Pajama The faculty members will either Assistant Professor of Nursing; couragement of Stapleton and Vice take new positions or not return due Catherine McKenna, Associate Party and CC-IDC sponsored President Mike Sibilia, and enevents. Stapleton also tried to imto retirement, leave of absence, or Professor of Nursing; Irwin Morcouragement which had been defiprove IDC internally by reorganizresignation. rison, Assistant Professor of Accient last semester. ing the constitution and by sugIn administration : Debbie counting; Nancy Onuschak, AssisAmong the more lengthy discusgesting that the newly-elected IDC Bergen Stratten, Assistant Dean of tant Professor of Nursing; and sions were those concerning the Admissions; John J. Chwalek will Bruce Weal, Instructor of Compresident be sent to the National housing situation on campus. Many Association of College and Univerleave the position of Director of munications Studies. reps expressed concern about the Placement, but he will continue to Also, Dr. Stanley Holden, Prosity Residence Halls conference in potentially crowded conditions next work for the college ; and Gene fessor of Physics, and Elaine . the summer. year due to the increased numbers The apathetic attitude that seemDomzalski will be reassigned from Slabinski, Assistant Professor of of residence hall students. Some ed so · prevalent last semester Associate Dean of Admissions to Nursing will take leaves of absence. reps also questioned whether the almost disappeared this semester Director of Career Planning. Dr. Clyde Houseknecht, Associate quality of the institution were being as more reps became involved in Those retiring , but continuing to Professor of Biology, will be on a sacrificed in the interest of quantidiscussions at meetings. This was teach on a part-time basis are : sabbatical leave for the fall ty. Michael Barone, Associate Prosemester. evidenced in the length of the One area where discussion was meetings; whereas the average · also very involved, but at times fessor of Education; Dr. Angel In addition, Assistant Professor meeting lasted 30-40 minutes last Belie, Associate Professor of of Aerospace Studies Robert Jennpicayune, was the expression of semester, meetings this semester Foreign Languages; Leota Nevil, ings left in January . ·Department complaints to the food committee. where seldom less than an hour Assistant Profe950r of Library Chairman, Professor of Aerospace Many times the reps brought up long, due to the lengthier discusScience; Dr. Charles Reif, pro- Studies Anthony Seizys i_s being complaints that should have been sions. fessor of Biology ; Thomas reassigned by the Air Force. handled directly in the cafeteria The improvement in the reps' Richards, Professor of Chemistry Department · Chairman line, through the use of the suggesMathematics and Computer James Bohning will be away on tion box or through Bruce Williams, Science; and Dr. Roy Williams, sabbatical leave next year. Francis NOTICE Food Committee Chairman, alone. Professor of Philosophy. Salley will serve as acting dep11rt.SG, CC, IDC, and the JuniorCI;ass Some of the more "picky" comThose resigning for various ment chairman. Sociologywill sponsor a FREE Block Party .plaints did not merit mention at the reasons include : Cecile Cham- Athropology Department ChairApril 26th from 9-1 p.m. on Chase IDC meeting. pagne, Assistant Professor of Nurs- man Daniel Goldman will also be Lawn. Bluegrass music will be proOverall, however, the food coming; Phyllis Cheng, Assistant Pro- leaving, and Dr. John Natzke will vided by "Back Mountain Strings". mittee accomplished a great deal, fessor of Biology ; Margaret Han- be the new chairman. Free food, and soda will be in that excellent relations were son, Assistant Professor of N~rsLouis Czachor available. · developed between IDC and the cafeteria management. Some im~1111111111;1111111111u11111nm111111m1111111111111111111111111111111111111111111111uu11111u111111111111mmuuu1111111111111m111111111uu111111m111n1111111~111111~ provements were made, but many more are needed. However, the important thing is that the management is working well with IDC, and is trying to better the service in the cafeteria. Williams is to be commended for his work in trying to improve the service and for his recep. liveness to student complaints. The Maintenance Committee, under the chairmanship of Jon Pliskin also showed great improvement over last semester. Several attempts had been made this year to make this a working committee, with little success. However, Pliskin helped to make the committee more organized and effective. Stapleton also attempted to improve IDC by revising the constitution and by setting down specific rules for the duties of each of the IDC committees. Although this may not seem to be of major importance, specifying the duties of each committee will guide the chairpeople of those committees and will give them definite goals for the year. This will eliminate the uncertainty as to the exact function of the committee. One improvement that will not be noticed until next year will be the resultant effect of sending the newly-elected president, Janine Tucker to the N.A.C.U.R.H. conference this summer. The new president will have the chance to see what other dormitory councils are doing and thus will bring back new ideas. She will also be able to become more secure in her position as president before the year even starts. Another future improvement suggested and started thi!: semester is the formation of the Parking ~ ~ DDearll1a at Kingston Armory, 4/24 · ~ ~ Grievance Committee, which is the § § l~ IBuy ,1 once En1oy ol a hfet,me Reco,ded musoc ;, your best enlertaonmenl ,alue Ma nagement Jerry Scholhng Ma nage;,,.nl . ~ ~ product of a brainstorm by Mike :E 5 ::::::: -~ Distributed by CBS Records © 1980 CBS Inc Produced by Bruce Johnston ·ces:!~~re trademarks of .CBS Inc 5 =5: Sibilia. This committee will § f.1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111ffi § hopefully be able to handle complaints from students who feel they ffi111111111m11111111111111111111111111111111111111111111111111111111111111111111111111111111111i11111111111111111im11111111111i11111111111;,·,11111111111111111111111111111111111111,~ ,a (It unfair Absenteeism decreased from last semester, especially at the first few meetings of the spring semester. However, more than a few dorm reps were absent from the last 2or 3 meetings, but this may be attributed more to "spring fever" than to any other cause. In other areas, IDC attempted to enhance campus life by sponsoring several events. The most recent was the Pajama Party in the Student Center, which IDC members felt was a success. With CC, IDC sponsored several parties; Halloween, Christmas, Valentine's Day and Saint Patrick's Day; all of which were quite successful. Also, IDC was partially responsible for bringing Hidy Ochai to Wilkes. IDC also put great effort into making co-ed housing a reality at Wilkes. However, the President's Staff felt that there was not enough time to institute co-ed housing for next year. Since IDC has brought the matter this far, the institution of co-ed housing at Wilkes should be one of the first issues considered next year. One more improvement seen in IDC for this year must be noted: a willingness and ability to work with CC, which helped to bring the two organizations closer together. One of the major issues at Wilkes has been the rift between commuter and dorm students. While the cooperation of CC and IDC on joint activities will not solve this problem entirely, it at least sel'.'Ves as · evidence that commuter and dorm students can work together well. Overall, then, IDC had a fairly good semester, showing improvements in many areas. Some of the more outstanding reps who contributed to these improvements, aside from Stapleton and Sibilia, were; Bruce Wiliams, Jon Pliskin, Janine Tucker, Shep Willner and Dina Campbell. Also worthy of special mention is Andy Haryluk, who was this year's treasurer. Haryluk kept accurate records and managed the financial matters well. With Dina Cambell, he worked as chairperson of the Valentine's Day Party which turned out to be a success. With the contributions of these reps, most of whom will return next year, IDC can.improve greatly. One improvement that could be considered is increasing the number of activities sponsored by IDC, especially of more diverse activities, such as the cross-country skiing day suggested by Sibilia which was cancelled due to lack of time and snow. It is also important that the entire executive council become more involved in discussions and in the enactment of new ideas. The assertiveness of the president will also be crucial in these matters. The chronic problem of absenteeism must also be dealt with, although this is a very difficult problem to solve. The IDC president might consider contributing to the SG newsletter proposed by Joe Galli, SG president. Not only would this inform all students of IDC activities, but it might also increase interest in IDC itself. Mary Kay Pogar �Page 6, The Beacon. April 24 , 1980 Looking Back OnA Helluva' Y~ar Walk-a-thon ASuccesWith HelpOfMony It doesn't seem possible that this is our very last issue of the To the Editor: If she wasn't dancing to Michael Jackson's latest hit, our I would like to thank everyone year; the 25th issue of The Beacon that ends another volume. copy editor, Patti Sparlow, gave her opinion on everything who made the March of Dimes It is at this time that we would like to review our acwhether it was asked for or not. Of all the staff members you Walk-A-thon a great success: complishments and speak freely about what we have learned. always knew where you stood with Patti. John Andrake To begin, The Beacon 's size grew considerably this year. We JoeGalli . For all intents and purposes, Margaret Scholl was our Leigh Majors added 4 pages allowing an additional page for sports, one for feature editor throughout the entire year. She was always Gloria Kovatch feature and two more for general news stories. Our coverage there to go above and beyond the call ·of duty for The Beacon Corrinna Bender on various topics expanded and we were able to write stories and had the magical gift of turning pictures into postage Mike Sibilia with some depth to them. Although some quality was lost with stamps. Maggie, you're amazing. Jim Murtha the increase of the paper's size, which we could never fully Sue Freda and Vanessa Martz took care of all our financial Debbie Mazzanti Lynn Paterson · overcome, we feel that the increase was needed to meet the matters. Sue was an excellent business manager and Vanessa BobLashock needs of the college. It was a gamble that we thought we might was indeed the best advertising manager for The Beacon that Don Burch fall with but we committed ourselves and came through. anyone can remember, maybe the best ever. Fran Scarantino Our editorial page was brought back to life with at least one Bob Gaetano was super. He had to put up with last minute John Perry editorial every week, a controversial column, and many letphoto assignments that were always handed down. he never Lena Borgstrom Debbie Prater ters to the editor. At times our editorials dealt with small once let us down and will be hard to replace when he graduates Adrian Pristas issues but we tried to give a comment, one way or another, this year. John Wischusen concerning all aspects of life at the college. David Clanton's That leaves Eddie White III, our infamous Sports Editor. He Chris Lain column titled Campul Commentary had a big following which is a four-year veteran of The Beacon staff and has worked on Tom Phillips Len Avery we are proud of. Although many of you disagreed with what he every single issue of the paper since he was a freshman, a total SteveVoyce had to say at least you reacted. That gave us complete of 100 issues. It is a miracle that Eddie has kept his sanity Keith Kolanda satisfaction. through it all. After May 18th Wilkes will not only be losing a Maureen Connolly With over 80 letters to the editor written and submitted this sports editor of the campus newspaper but also its Sports InTim Palmer year we also take pride in seeing that many of you see this formation Director. Eddie can not be replaced, he is an instituTom Rooney Joann Rice paper as THE communication link to the campus. 95 percent of tion. Some feel he belongs in one. Sue Suhamski the letters were constructive and offered valuable insight into Next year Patti and Margaret will head the staff with Louis Debbie Barling issues and campus events that we sometimes couldn't get and Pete right behind them giving support. Good luck you guys Donna Ruddy near. Let's keep those pens writing for next year. Letters to and we hOpe you can laugh through it all as we did this year. It Chris Woolverton the editor often prove to be the most interesting section of any has been great. Bill D-Dadta Mark Chichak newspaper. Jim Edwards Rob Wallace The Beacon grew and was finally recognized for its efforts to Editor-In-Chief Ruth McDermott find the truth to every story it covered. We worked hard. We DianeSecch NOTICE presented a paper that at times was exciting, controversial AllumniAnyone wishing to help out on and fun. We found out who we could trust and what adJackLoftus Orientation for next year is asked to please come to the Orientation Peggy Rentschler ministrators and faculty that would consistently lie to us. But & The members of HSC meeting on Monday. April 28th at most of all we had a lot of fun . 9:30 p.m. in SLC 101. If you cannot Sincerely, · During the past year we also had our share of mistakes. Trymake the meeting. but wish to work Steve Demko . ing to be as close to professional journalists as we possibly on orientation. contact Marla BrodHuman Services sky at Sullivan Hall, 825-5915. could we sometimes made decisions concerning the handling Committee Chairman of certain issues and stories that we thought were correct. When we were wrong we heard about it. Because we were trying to be controversial and hard-hitting we sometimes lost To the Editor: USPS 832-c»IO perspective to certain issues that should have been handled In regard to David Clanton's recent commentary on the Iranian other ways. We have no regrets in any of the editorial deciEditor-In-Chier situation, we are initiating a petisions we made because we put a lot of thought and consideraJim Edwards tion to the United States governtion into each one. This paper is an educational tool and a learment suggesting that he be awardning experience for its staff members. We often learned Sports 1-:dffer ed an all expenses paid trip to the Mauling F.ditor through our mistakes. Eddie White III land which he so dearly lQves. To BUITurcan compare the alleged 'crimes' of the The Beacon has now reached a point that it has the right to Shah, once a loyal and strong ally of cover every single solitary aspect of campus life. People may Op-Ed 1-;ditor Copy Editor NewsE4Hor the United States, to those of a Patti Sparlow Margaret Scholt PeterSteve get hurt through our coverage and criticism but remember, all lunatic and fanatic requires •an exnewspapers are viewed as a corrective force and not simply as traordinary imagination and a feean informational source. Asst. Op-Ed F.diter Aut.New1E.._ ble mind. Did the hundreds of Also at this time we would like to thank several people on thousands of bullets from KhoLouis Czachor · campus who have consistently supported us and encouraged meini 's Revolutionary Firing our efforts. Our advisor, George Pawlush, Public Relations Squad cleanse the souls.of the innoPhotographer cent odies in which they now rest? Bob Gaetano Director, heads the list. Whenever we were frustrated with our We say NO! Khomeini is the real Advertising Mani:.;er B ■sines& Manager weekly routine he could boost our spirits and place things in fanatic. The ideas which you pro- Sue Vanessa Martz Freda their proper perspective. He stood by us at all times and we pose, Mr. Clanton, really make us CirculaJion Manager want to puke. To see that any can't thank him enough. People like Dean Art Hoover and Dr. Michele Serafin American especially one Brad Kinney have also been a great help along with Jane . who goes tocitizen, Wilkes, harbors these Manganella, Assistant to the Public Relations Director; Doris beliefs, truly sickens our minds and REPORTERS: Cindy Ercolani. Lisa Gurka, Mary Kutz. Sue Loveitt. Barker, Registrar; Peggy Jones, Dean's Secretary and Keith hearts. The United States is _the Gary Mack, Bill Miller. Rich NordJ}eim. Ana Nunez. Mary ~ay Pogar. Martin, part-time professor and WBRE Anchorman. These greatest country in the world, and ·Darlene Schaffer. David Stahl. Advisor people helped us make decisions but never once told us what to we need not apologize to anyone for George Pawlush our actions, whether they be a past do. We appreciate that. or present. So, Mr. Clanton, we Parrish Hall The staff itself is such a mixed bag of personalities and it is hope that you now know what you 16 S. River St. can do with your Iranian symamazing that we can still laugh with each other. We have Bill Wilkes-Barre. Pa. 1Hil6 pathies. · Turcan who's sarcasam and humor can brighten any Beacon Published weekly during the school year from September te May except Signed, meeting. f• vaeatioe periods and semester breaks. Entered as secODd class postage Loyal Americans United Against In our news department th_e re is Peter Steve and Louis paid in Wilkes-Barre. Send form no. 357' to Tbe Beacon. Wilkes College, David Clantollah WIikes-Barre, Pa. 111711. Sultscriptioa rate to non-stlldents: $-1 per year. Czachor. Louie has never once missed a deadline in his three Advertisillg rate: sz.se per columa Inch. · EDITOR'S NOTE : Included with years on the staff. No one in the history ofThe Beacon can Pbo■e : (7171 82-l-1151, Ext. -173 this letter were 54 signatures of boast of such an accomplishment. Pete, the best writer on the · All views expressed are those of the individual writer and not necessarily students. Because of space, staff ·and Louie's boss, has never met a deadline. (Yes, Pete, el Ille pnUcatiM ol tile college. however, they could not be printed. the admissions office is open on Saturdays.) 'Loyal Americans' To Cuu,,ton's View ----tbe-:,:;,.b eaeon---- �April Z.f, 1988, The Beacon, Page 7 Fred Pierantoni Reflects ·Years With Radio Station perience of my college career. I For the past four years I have had . have learned more from managing the pleasure of being associated and being a part of WCLH than any with our college radio station academic . course could convey. I WCLH. With graduation only a few am thankful that I had the opweeks away, I feel it is my duty to portunity to be part of the "voice of publicly thank some of the many Wilkes College" and wish our people who contributed their time manager-elect Chris Kosakowski and effort to the betterment of and everyone involved continued WCLH. During the past few years I success. Fred A. Pierantoni witnessed the size of our staff WCLH Manager membership steadily increase. CUrrently there are more than 50 active members at WCLH. These people, our announcers, deserve all the credit in the world. They are the most dedicated people I have ever ' seen. They receive no monetary compensation and work with failing equipment, yet pel'.Servere and keep WCLH operating over 100 hours a week. Our announcers are To the Students, the backbone of WCLH. They are Faculty and directly responsible fer the success Administration: WCLH has had over the past year. I Thursday, May 1st will be the am grateful to each and every an- final faculty meeting of this nouncer and wish them continued academic year. At this meeting success. over 170 faculty and administrative I would like to thank the members ~ill be voting on a policy members of our Executive Staff, which may disrupt the extracurfor without their suggestions and ricular activities at Wilkes. The aid this year would not have been policy is stated, "Students parsuccessful. I would especially like ticipating in extracurricular acto thank our Program Director tivities at the College must be in Rich Nordheim. Rich has been like good academic standing. Any stua "co-manager" and helped me dent placed on academic probation, reach many key management deci- as defined in the College Bulletin, sions. will be ineligible to hold student I would like to thank the "behind governmental office, work on Colthe scenes man" Dr. Brad Kinney, lege publications, participate in our Director of Broadcasting Ser- College sponsored intercollegiate vice. Dr. Kinney has spent activities, or hold a position of numerous houf trying to continual- authority or responsibility on camly improve the quality of WCLH. He pus." has been "WCLH's VOICE" in Those who propose this policy faculty and administration feel that if students' academic and meetings. I speak for the entire extracurricular affairs are closely staff when I say we all admire his monitored, the standards will indiligent efforts. I know the station crease. If the standards are at queswill continue to grow and improve tion, then why were applicants acunder his guidance. The AD- cepted at .the College up until the MINISTRATION must allow him to day of classes? Such prestigious continue as the head of WCLH; he schools as Harvard, Haverford, and will do for the radio station the John's Hopkins, and many other same he has done for the Debate schools .do not implement a Team! I would also like to thank probationalextracurr.icular Dean Andrew Shaw for lending a policy. Also, a survey was taken "Helping hand" whenever he could. which showed that those students I would also like to thank the other participating in extracurricular acmembers of the faculty and Ad- tivities were better able to budget ministration, however few, who their time and did better have contributed to WCLH. I am academically while participating. also grateful to members of the The majority of the students at community and Wilkes College Wilkes participate in extracurstudents, our listeners, who made ricular activities. They are the the job worthwhile. I especially backbone of the school. Student inthank the members of the Beacon put is very highly respected and . for giving us more than our share of recognized. So much student input publicity. Also, I would like to thank makes this college unique; we . our engineer Joe Glynn, Joe does should try to enhance this opnot get much recognition, but he is portunity, not degrade it. the man who keeps WCLH on the If this policy goes into effect, we are not assured of higher stanair. WCLH is no longer the toy it was dards; and those students who four years ago because of the peo- won't be eligible to participate may ple I have mentioned. WCLH offers not spend the extra time on school a quality format and broadcasting work. 167 (8.35 percent> of the studay that could make any commer- dent population is on academic procial or public station jealous. If the bation. 21 male athletes . are on Administration would only offer academic probation, which is 12.5 more help and replace our failing percent of the total probational equiptment, we would be the envy population. You may not directly be effected of the valley, let alone College. WCLH could be a very effective by this policy, but your school will public relations tool, a recruiting be. Get out there and talk to your tool, an opportunity to develop professors and encourage them to practical experience towards a think about this policy before they career, a place to develop a sense of vote. Thank yon, team work and friendship and Marla Bredsky much more! Gayle Lovering WCLH has been the best ex- To tile Editor: New Proposal Upsem &Angers Marla&Gail Beacon Editors Give Thanks To Sr. members To the Editor, It is not often that editors of a newspaper .receive a letter of praise from their own staff, but we the members of next year's BEACON feel · there is a first time for everything. Working with an inexperienced staff is not easy in any business, but it is especially difficult in the weekly publication of a school newspaper. Without total · cooperation from everyone involved, chaos Is likely to occur. The senior members on this year's staff brought with them not onLy experience, but also the ability to mold "a bunch of rookies" into an adequate staff for next year. Although there were many problems throughout the publishing year, a real friendship developed between everyone. We would like to take this opportunity to sincerely thank Sue Freda for her smooth operation of the BEACON'S business department, Bob Gaetano for his fantastic photos, Bill Turcan because he was there when we needed him, Eddie White for being his boisterous but extremely enjoyable self, and Jim Edwards for his drive and determination to be the best! To Jim we would also like to say that Patti promises never to say another word for as long as ·she lives, Margaret will take a summer course on stamp collecting, Louis vows that he will follow the._ tradition of News Editor by handing his copy In late, and Pete wili fight to get the administration offices open for at least an hour on Sundays. In all sincerely though, we thank all of you for your help, experience and friendship. We wish all of you the very best, and hope that we do a job nect year that you will be proud of. Signed, 1980-81 BEACON Editors "Y" Tutor Prog. Seeks Volunteers And Give Thanks To The Editor: Wilkes College men and women who will be in the area this summer are invited to volunteer one hour a week, between 3-7 P.M. on Monday or Tuesday, and give educational assistance to one low to very modest income child in the YWCA Tutorial Program, 40 W. Northampton Street. · For most elementary school pupils there will be no "second chance" summer school. Last summer public and parochial school youngsters from six sch()ol districts, the BRIDGE, etc., who "barely passed" were referred for complete subject review. The Wyoming Valley United Way assists tutorial so that, with Continued on Page 10 Campus CommenJD,rg OlgmpicBogcott 'lbe question of whether or not to go to Moscow for the 1!8) Olympics has · become one whose proportions have spread into the entire world. 1be two chief sides in this question, the U.S.A. and the U.S.S.R., have made accusations and counter-accusations against each other as both have attempted to lobby for maximum support from other nations. In the middle of these two protagonists are other nations and for the first time since World War II many are finding themselves forced to define allegiances clearly and openly. . 1be whole question of the Summer Olympics raises numerous other questions, the most significant among these being the international codes of conduct, on international law and on the morality of nations, especially the big and powerful ones. Soviet action in Afghanistan no doubt calls for unequivocal condemnation and denounciation, yet in doing so, other nations, specifically European nations and the U.S., have to proceed carefully and with long term implications of their mode of protesting Soviet action in Afghanistan lest they themselves be caught in their own web in future. A boycott of the Summer Olympics by any nation automatically binds that nation, because such a boycott is in protest of the Soviet violation of not only the sovereignty and territorial intergrity of Afghanistan but of international law as well, to itself refrain from any future acts which may be even remotely inviolation of the sovereignties of other nations. 1bls raises a question pointed directly at those nations which have deemed it proper to boycott the Moscow games. The question is more specifically pointed at the super and what I will call "medium" powers; "Can any super-power or powerful nation continue to be such without at some stage or other and for some reason or other trampling whether directly or indirectly upon smaller nations?" 1be past has tended to numerously demonstrate that big nation in pursuit of what has often been called whether rightly or wrongly "national security" have activell interfered in the domestic affairs of other nations. Thus J maintain tba no big power can valldly adopt a "bolier than thou aWtude" towards any other big nation as all such countries have at some stage or other violated international codes of national conduct, and this is an established fact. What has differed between such nations has been the ways in which these violations have been perpetrated. In the case of the Soviet Union they have been open and blatant while in the case of Western powers these have been surreptitious and disguised under many cloaks, an example being the destabilization of governments who have fallen out of . favor and their subsequent replacement with those willing to tow the line. The cost of these destabilizations in terms of human lives has often been disregarded, and this carries us to the next point. Another reason which has ~ cited for boycotting the Olympics has been that Moscow is now holding Afghan citizens in brutal subjugation and in violation of human rights and the right of people to determine their own . destiny as a nation. Any nation which boycotts the Olympics automatically binds itself to refraining from any acts which might be deemed as promoting both imperialism and the holding of people under subjugation by unpopular governments. This is particularly true if these acts are dealings of an economic and military nature with such governments, for might held by the oppressor is a pre-~ite for any form of oppression. Yet the Western -world has, while bemg the spearhead of the bid to boycott the Moscow Olympics, regrettably enabled in many cases repressive governments to bold entire nations under subjugation by providing the economic and military means with which such governments have been able to perpetuate nefarious policies. Perhaps this argument will be better illustrated witli an example, that of South Africa. The West continues to further strengthen the White minority and racist government of South Africa despite full knowledge of the atrocities which that regime has committed and which atrocities have come to be on par with those of Nazi Germany in the Second Reich in their bl'lltality. "But," some have argued, "South Africa's policies are her internal affairs"-yet S.A. has numerously invaded the territories of her neighbors, especially Zambia and Angola, in violation of international law and in blatant disregard for the sovereignty of other nations and the sanetity of human life. Yet these violations have raised h~y a protest amongst the prime movers of the Olympics boycott, leading me to conclude that the issue of Afgbanlstan has come about as an outfling of the ideological struggles between the East and the West. The prime movers of the boycott have numerously frustrated the aspirations of South Africa's indigenous people to self detemination by.numerously blocking or vetoing bids to expel South Africa from the U.N. with the excuse that such action would signal the death threes of dialogue and peaceful moves to bring a transition of power to the Africans who comprise 71 percent of her population form the White population which comprises 23 percent of her population. With this, it is interesting to note that South Africa does not recognize U.N. resolutions whre it is In her nefarious interests to do so as her intransigence over the issue of South. West Africa which she continues to administer under the defunct League of Nations mandate system and in .defiance of the U.N. has numerously and adequately ~ - This example has often made a mockery of many Western nations' claim togenuine concern about violations of human rights. An Olympic boycott under other circumstances would pebaps have been an appropriate show of protest, but in these for which it Is being instigated such a boycott is hardly the wisest thing. If any group of nations is concerned about Soviet aggression in Afghanistan, it is neither symbolic action nor ideologlcal victories which will help the Afghans, but some form of concrete action. When the Olympics torch bums· in Moscow and athletes parade before the Soviet leadership, a few Western nations will be conspicuously absent, yet the Afghan landscape will still be rocking under Soviet ground .and air strikes. Whatever .victory will come out of the boycott will merely be ideological and thus be of a nature in wbicb the Afghans have little interest. To quote Otto von Bismarcb, it is not be speechifying that issues of the day can be solved, but by blood and iron. TNyD.Silliya �Page 8, The Beacon, April 2-t, 1980 Rea,iea,, · •••.·. · ·· ••••••· •••· ••· · •· · · · · ·· · · · · ·· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Freshmen Excel In"Angel Street" Production Betsy Kellar as Mrs. Manningham If Angel Street is an example of what freshmen can do, then theater's future · at Wilke's College promises to be " heavenly." Freshman director Jay Siegfried and his tro~pe ~f ~eralded freshmen actors turn m a performance which is fresh, exciting and as professional as we can expect. Freshmen honors are in order!! ! Exl)erience demand:; respect in IDraft Questi;;;ip~;~d Whenever nations have felt threatened by others or have embarked on aggressive policies, it is the youth of those nations who have been called upon to defend the motherland or to be the instruments of these aggressive policies. In the old days of chivalry, honor and great noble ideals, the call of the bugle to battle was often responded to without question or hesitation. Young people went into war without any thought about personal safety. To die or forever carry the scars of battle in the name of the country, king or some ideal were considered a great honor. The modern times have somewhat changed this situation. A close examination of the attitudes of young people in various nations towards war reveals that there can no longer be one formula which one can apply to the youth of all nations and their thinking. Different social, political and other trends have produced a whole spectrum of opinion in different lands. Of prime interest here are the opinions of some of the youth of America on the issues of war, of the merits and demerits of pursuing passive or pugnacious policies and on the wisdom or folly of acting as the policeman of the world, in short, it is the opinions of the youth on pursuing a course similar to that of President Truman's "containment policy." These questions have come as a result of a geographically rem_ote incident, the Soviet military thrust the theater, and none but the highest goes to Klaus Holm, not only for his beautiful, realistic setting, but also, for the masterful display of · stage lighting, which playwright Patrick Hamilton cleverly has wrought into the script. Particularly stunning is the imperceptible shift of . the outdoor light streaming in the window from late afternoon to twilight. The high standard of guest actor, John Chervak, provides for his colleagues the very example of diedication and humility, in his magnificent portrayal of Sgt. Rough ; the lovable, eccentric detective. John commands attention from his first entrance, and brings out the best of his fellow actors through the remainder of the action. His experience gains our respect unasked. Jay Siegfried, is no novice, to the theater, even though Angel Street is only his second attempt at the CPA. Once again he nudges us to the edge of our seats, with pounding. hearts, thrilled, if only that the hero remembers his hat ! Mr. Siegfried deserves, if nothing else, recognition for nurturing a freshman cast into a believable, highly respected troupe. Betsy Keller heads the freshmen with a portrayal of the abused wife, Bella, that we find exciting and sincere. Her vocal choices, with diligence, can eventually match the physical flex- Of Campus into Afghanistan, which has precipitated in the U.S. the possibility of the reinstatement of the draft and mandatory military service for all able bodied and young citizens. Since it is essenUally the young people that this issue affects and since most of the Wilkes College student body falls within this category, a randomly selected cross-section of the student body was interviewed on this matter. The responses to some of the questions asked were almost as many as the people who were interviewed. When asked what he felt about the draft, a sophomore student replied that he felt it was uncalled for. This student who we shall call Mr. X since he requested anonymity said he felt that what was happening in Afghanistan called for mere condemnation and not for frantic preparations for war which after ali, he said, would not come in the foreseeable future. When I asked Mr. X what he felt about the fact that the Soviet thrust had brought them within a few miles of the Middle East oil fields which are, in the words of President Carter in his State of Union speech of last month, a "vital interest of the U.S.," he replied that he did not think the Soviets were foolhardy enough to invite the wrath of the world community by launching what would clearly be a naked and unjustifiable act of aggression. "After all," said Mr. X., "the Soviets claim that they went into Afghanistan at the request of the Afghan government so ibility of her acting. Chris· Golanoski strikes an imposing figure as Jack, her villainous husband. Should he acquire Mr. Chervak's attributes, we anxiously anticipate his future work. The value of smaller roles to a · young actor is often overlooked. Lori Pritchard, displays her role as the coquettish Nancy with unabashed confidence and style. Certainly, her accent deserves more attention, but her overall presence onstage represents a talent with which to be reckoned. Liz Sarber and John Prater, as the Cook and Policeman respec- ' tively, could well learn this lesson from Ms. Pritchard, as from George Heid, who plays a Policeman with all his heart. If Ms. Sarber can command her body as she strongly shapes her voice, her career at Wilkes promises great things. Let ther be no mistake, Angel Street strikes us as a play with excellence in mind, but experience demands respect. No doubt, only time and hard w~rk will realize the very finest which we envision for the future of Wilkes College Theater. - , Like you've never seen the m before starring in alphabetical order: NADIA COMANECI • EMILY LITELLA • LISA LOOPNER JUDY MILLER • ROSEANNE ROSEANNADANNA CANDY SLICE • RHONDA WEISS I let them (the Afg,~ans} settle the matter themselves. Why should we get involved?" other students, while not being as radical as Mr. X., also expressed the opinion that reinstating the draft was unnecessary. A few felt that the U.S. had to be prepared for countering any assault on either the country itself or on its vital interests outside its boundaries. If the draft is to be reinstated, they felt, it should be in a form which will cause onJy minimal disruption of studies ~ other things young people are doing. Others within the group expressed the opinion that an unwilling army has little motivation and morale, and mandatory service would bring exactly this. Instead of attempting to achieve military preparedness by mandatory service, they felt the armed forces should increase salaries, benefits. and other things for servicemen as an incentive to people to sign up. While there were many other responses, space does not allow that all these be listed. What came from the interviews was the general conclusion that most students in Wilkes are opposed to the whole idea of the draft and mandatory military service. This poses a question. If the young people of a nation are totally opposed to the idea of war, is the world heading towards an era of tranquility or is this opposition merely transitory? Only time will tell. Tony D. Sibiya GILDA LIVE ~•- GILDA RADNER • FATH~R GUIDO SARDUCCI Frlday-Aprll 25th 2:1 S, 7:00, 9:00 and Late Show 11:00 P.M. R • • • • • tlESTtllCTED .-0, UIIDfll l1 RfOUIRU•ttOMPHllll6 l'AllflTOIIADULTCUARD IU EXCLUSIVE AREA ENGAGEMENT GATEWAY·TWIN CINEMA • • • • • • . .......................... .• • • GATEWAY SHOPPING CENTER•287-7200 ' z 0 Q.. ;;) 0 u ~ .,;;i = < ;) .,;;i < ~ MIDTOWN PIZZA York Pizza New S ty le We feature Sicilian style pizza squares, serve salads, hot platter5 and cold or hot hoagies. We ha ve specialties such as: Stromboli, Calzone, Sausage Roll and Parmigiana Turnovers Receive $1.00 Off on any large pie Expires May 30, 1980 VALUABLE COUPON ~ > r~ > = rr trj n 0 ~ ~ 0 z �April 24, 1980, The Beacon, Page 9 1 Outer §IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIY! Limits =· :::? , ...:Y·/·'·'·J ·', ., ,. .,. . ,. . . ~ tG o r-'G.lv\Tul.AT lO(-lS . CAVE. ~ ~£.Wl\SL'/ 1 0 lliE. ALU}'\N\ f°4 N.0 . COt(&'2.A., Llt..A-rtD!llS. GI V£ <c£.tlE\lOL\SL j TO T\-\t AU..\ MNI fll NO . CO NGRATUL I\TW'.> N ~ •• . '' ©[l~@® @[F ~®@ Grasp ~ Your Future. GRADUATE SCHOOL The University of Scranton One of Twenty- eight Jesuit .l nstituti~ns of Higher Learning. offering courses in: art education music education business administration english (thesis and non-thesis) american history and politics history (thesis and non-thesis) chemistry physics general science elementary education secondary education elementary school administration secondary school adm inistration solid state electronics reading . rehab ilitation counseling counselor education A variety of Correlated Programs are also available in Secondary Education . (NOTE : graduate level course taugh t at night) Septembe r 2,3 . ... . . .. ... . regi stration September 3 ........ semester beg ins For information on the U of S GRADU ATE SCHOOL Please call (717) 961-7600 or write: GRADUATESCHOOLOFFlCE University of Scranton Scranton, Pa. 18510 by Flash Gordo·n Back by popular demand, Flash has returned for a final time of the , semester. Hope everything is winding down very nicely for yous. Lots of things happening around campus this time of the yea_r. The Junior-Senior Dinner Dance was a success. Flash was there scoopmg the scene out. Had a good time. Went there weighed down with bucks, too a bad nothing was left in the pockets after the dance. Larry ...discovered that your new profession is going to be a pimp impersonator. Holly ...a wor~ to the wise, get a fire extinguisher the next time John wants a dnnk. · Mikey ...where did you get those stains buy your socks? Hey Meatball, how did you getthose stains? · Got a panic scoop that Emersons was burning down last week. Was relieved when Flash rushed there and found out that it was a false scoop and they were still serving that expensive beer. This weekend should be a real swingin' time. Hope everyone shows up for all the events because Flash will be around looking for possible scoops. Hey up there, lets have some good weather for Cherry Blossom Weekend for a change. Sorry to say that Flash will not.be around this campus for next year. Going to be forced into the Real World (Not Wilkes-Barre, but a job). To celebrate the joyous occasion (for some people who know the true identity of Flash) graduation presents will be given to share in this unbelievable event To: Jogalli: 50 gallons of Kaopectate. Doreen: A pink, purple, orange, red, green and blue, disco blouse that glows in the dark. Sandy: Afree membership for a free year atthe "Y". Chip: Free membership at Weightwatchers. Steve D. & Donna: Good grades for Stat. Leigh: Someone to take over for M.J . to beat you up. Holly: Aparking sticker. CarolR. : Another lapsittingjob. . Fish: Aprivate detective to watch over you. Arse: Anewplacetohanggrub. · Eric: Seasick pills and mops to swab the decks with. Pegs: Your own beach full of seashells. Spike: Abeat up little red leprechan from a roomie's plant. . Well, it has been loads of fun this year and the past 4 years at Wilkes. Have fun and always remember to watch over your shoulder you never know where Flash might be scooping the scenes. · s -·~ ,. i ~--= 5 5 i = 5· 5 5 5 5 5 5 ,_.,.._. 5 5 I 5 5 5 5 5 E • D)OY = The SUinfflef•f 5 5 5 s See y OU 5 5 5 i 5 5 5 5 5 5 5 5 s Next Year' 5!5 5 · 5 5 s The Beacon Staff 5! 5 5 -· ~,. , § 5 5 5 § 5 5 5 5 5 5 5 - 11),. , . /, :AU.-= 5 5 5 i 5 5 5 = · §j 5 5 5 5 5 5! 5 5 5 5 __...,'v\l.---.o 5 5 5 Flash Gordon illllllllllllllllllllllllllllllllllllllllllllllllllllllllllllii: �Page 10, The Beacon, April 24, 1980 Beacon Awards Beacon's Most Quotable Athletes-The Lacrosse "Bleep-Bleep" Team Least Recognized Sports Team On Campus-Swimming Team Most Over-Publicized-Wilkes Football Team Best Sports Captain-Don Patrick, Jim Edwards, Diane Kendig: tie cutest Wilkes Sports Personality-Kim Bush Loudest Athlete On Campus-Bob Matzelle Quietest Athlete On Campus-Joe Malatesta Best Sports Fan-Art Hoover Best Site For AHearty Training Meal- Andy's Diner (see Verna) Most Screwed Up Nickname for An Athlete-Carmen "Homer" f,Ol)resto, (who played football) Burt Reynolds Award-Bob Oliver - ~ Coed Housing Continued fro_m Page 1 . . proposal 1s made, 1t 1s automatically policy," stated Capin. "This is nottrue." 1==:,ac:=::x1-c::=:::,-11-c:=::,-a·-c:=::,-a~"c:=::,-a-c.=:::::,.-c 1 -c:=::,The future of housing alterThe las& presentation of the Concert and Lecture Series for this year will ~ natives is open. "The poli~y will ist of the debut performance of the Masterworks Chorale on April 29th probab!f be reviewe<! m the t 8: 15 in the Center for the Performini Arts. future, concl~ded Capm, but ~ . could not predict whether or not 1t _ would be approved. For the preStudent recitals include: Cathy Davis, April 25th, 8:30; Lisa Robak and ~ sent time, however, the housing Maureen Stanks, April 26th, 3:30; Michelle Millington Drago, April 26th, policy will remain the same. 8:15; Tonya Reeves, April 27th, 8:15; Mark von Reddington and Maura PattiSparlow Bums, April 30th, 8:15; Maureen Salley, May 11th, 3:30. All recitals will be~ held in the Gies Recital Hall. ~ The Wilkes College Wind and Jazz Ensemble will present a concert Sun- ~ ay afternoon, April 27th at3:30p.m. in the CPA. The Wilkes Chamber Orchestra wllL present a concert on April 28th, at 8: 15 p.m. in the CPA. Graveyard Award-Wilkes College Athletic Vans, Hopefully WorstAthletic uniform&rWhite(?) home uniforms of the men's basltet- >all team. Best Uniforms-Girls Swim Team Most Read Paper On Campus-Toilet Most Likely To Be President Someday-Bill Lewis "Blood and Guts" Award-Ed Eppler The Best Haina Award-Keri Pascoe and Peggy Butchkavitz-tie Denny Terrio "Dance Fever" Award-Larry "Guy" Walsh Best Quote of the year "I feel like an asshole" Joe Galli after the Jr. Sr. Dinner Dance Meeting Best Quote From a Letter to the Editor from Shep "Uri Geller is an exIsraeli parachutist who has the psychic ability to bend keys. Mosf Controversial Issue Discussed In The Beacon Is Colleen Gries a saint or not for the Juilior Class Surprise. Mosf Incriminating Picture the Beacon Did Not Print-Dave Blumfield SG President and Mike Stapleton posing by the Student Center Bar. Best Headline-Music Dept. Gets New Head Runner-up- Business Dept. Head Still Being Sought Best Headline that was not Printed-Moffatt Withdraws as'Miller Stands · i\lone-CC Presidential election story. . Best Kept Secret-Homecoming Queen and Court Best Beacon Photo-Marla Brodsky holding sign in the middle of South i;'ranklin St. that read "or bust" 'Best Sporting Moment-Megan Caverly shining a moon over Route 81 Best Filler That Never Made It-Sex Is Best Best Dressed Campus Leader-Bill Lewis The Beacon's Forbidden Word-Alcohol Most Frequently Misspelled name on Campus-Shep Wilner The Most Difficult Administrator to get an interview with-Dean Shaw (You have to make an appointment to make an appointment to see him.) The Smoothest Run Planning Committee-The Jr, Sr. Dinner Dance Committee Most Cooperative Faculty Members during interview-Dr. Louis Rigley Hardest Job On Earth-Writing Headlines Most Likely To Become The Next Major Cult Leader-Mark Sovyrda Best Quotable Coach On Campus-Steve Justice (basketball) Least Quotale Coach (Because we can't understand Him )-Earnest Lopez First Annual "I wantto come to Wilkes But..." Award-Bob Waskiewicz, Mt. St. Mary's College ·. . The First Annual Jim Edwards-Eddie White "Needle" Award-MikE Pawlush · . ·Eddie White Passes His "I hate Reggie Jackson"-Joe Amendola Howard Cosen "Telling Like it is" goes to the master of the Wilkes College Connection-Bill Scholl The Wilkes Madrigal singers will present a program on April 25th at 8: 15 in the Center for the Performing Arts. CUrrently on display in the Sordoni Art Gallery is the major exhibit, "Three Women". The show will remain in the gallery until April 27th. It ·vill be followed by Herbert Simon's exhibit entitled, "Sculpture: 1976-1980" .,egining May 3rd. .NOTICE There will be a planning meeting for all students who plan to do their student teaching daring the Fall semester 1980, on Friday, April 25, 1980 on the Second Floor of Boler Hall, at either 11 :OO a.m. or 12 noon. This is an important meeting. Please plan to attend. NOTICE There will be a class of 1!181 class meeting today in Room 1 of Stark. The car smash & part sponsorship of the bluegrass party will be discussed . ...., r �April 24, 1980, The Beacon. Page 11 CCAnalysis==============::::: Money Problems Need Atten~ion AMNICOLA CO-EDITclRS - Pictured are the 1980-81 Co-editors of the Amnicola, Mary Giblin and Maggie Bunnell. StaffFor 1980-81 Amnicola ncludes OJ-EditorPositions Barre. She will assist the co-editors in all aspects of the production of the yearbook. She is currently a freshman. Serving as photc;,grapher for the publication will be Frank Jeffrey. He is a freshman Nursing major from Bloomsburg. Chris Reilly will handle the duties of Art director for the publication. He is an art major from Westbury, N.Y. Business manager will be Dean D' Amico. Dean is currently a sophomore business education major from N. Massapequa, N.Y. The 1980- 81 Amnicola staff was recently approved by the Student Publications Committeee. For the first time in several years the Amnicola selection committee has agreed to have co-editors. Dean Arthur Hoover, the yearbook's advisor, felt that the positions of coeditors would be best for the 1980-81 school term. The duties of the two editors have been divided so that each co-editor is responsible for specific jobs. Chosen as eo-editors are Mary Giblin and Maggie Bunnell. Mary has been editor for the past two years and will be a senior next year. She is a nursing major from Palermo, N.J. Maggie served as business manager on the 1979-80 staff. She is a junior Nursing major who resides in Florham, N.J. ·Next year's Assistant Editor will be Kathy Keller. Kathy is a computer science major from Wilkes:_ Across from Bishop Hoban Ph. 822-7045 -Imported Beers-Cold BeerCall in Advance fot Kegs' and Quattets (Must have LCB Card) - -- --- Chuck Robbins ... I The five most dangerous words in the English language. SPORTING GOODS COMPANY We Accept Master Charge and Visa 39 West Market Street Wilkes-Barre, Pa. 19701 I I I Phone: 822-1333 Free Parking at Hotel Sterling I PATRICKBURKE, O~n_e!_ - - - - - Besides, having difficulties with groups on the selection of the band financial matters, Council also has and on the question of an open bar. a problem with contradiction. It The Blue Grass Block Party seems that CC is constantly striving scheduled for this Saturday receivfor student involvement, yet there ed a lot of attention and should be seems to be little apathy on the part one of the major attractions of of CC in a few of the school spon- Cherry Blossom Festival, and of sored activities. First, CC showed · the whole year. In addition to the little or no enthusiasm for winter block party, it is also great to hear weekend and for one of the three that CC will also be sponsoring a major organizations on campus not team and a booth during the to ha\le sponsored a team was real- Festival. As a student service agency, CC ly an indication of lack of interest. Lack of interest on the student's has one of the hardest jobs. They part has always been the scapegoat provide all the necessary transporused by many organizations in- tation materials, plus they offer bus cluding CC when an activity has tokens, parking stickers and parkfailed. Examples of this include the ing permits to a large majority of roller skating party held in the students. The Council handles all beginning of the school year and the commuting situations and has even second bus trip to New York joined the National Clearinghouse scheduled near the break. It seems for Commuter Programs in order to hard to believe that a roller skating more fully cope with these situaparty failed early in the year and tions. Further trying to unite all yet the roller skating party held at students, Commuter Council has L.S. Skate-A-Rama was a success. also been part of the TriIt is also hard to believe of a 45 Organizational meeting and the passenger bus in which 35 seats Joint CC-IDC meeting. The were filled on the first trip to New Newsletter, the Christmas CarolYork, that only 6 people would sign ing, the Senior and special awards up for the second trip to New York.' and the Junior Birdmen affiliation Was the real reason for these is only part of of the many importfailures a lack of student interest or ant facets of Commuter Council. In retrospect, Commuter Council lack of interest on the Council's.parhas had a very productive year and t???? Commuter Council has made indeed it has a better relationship now, more than ever before with some mistakes and hopefully they the student body and other will learn by them and with the very capable Executive Staff that organizations. It has proven that it is not only a party organizer. but a has been selected for next year, instudent service agency as well and sure that mistakes like these won't a major force on campus that must happen again. be reckoned with. Unfortunately, The Council has attained some the Council also has problems that outstanding accomplishments that must be overcome if it is going to should be noted. Commuter Council has shown that it can not only be a function even better next year. It is therefore hoped that these difparty organization, but a student ficulties will be overcome and that service agency as well. The parties CC will continue to be successful. have all been a success, even Darlene Schaffer though there had been some dissention among members of the various ttMaybe it will goaway!' DECKOU R'S BEER - It's that time of the year again. Time to put the year into retrospect and to critically examine the accomplishments and failures of Commuter Council. The critical examination is nothing more than a series of personal remarks based on · observations made throughout the semester. It will represent both the negative and the positive aspects of Commuter Council. First, the negative. Commuter Council has a money problem. About a week ago, a robbery occurred in the CC office in which nearly $700 worth of money, bus tokens and parking stickers were taken. In addition, the ledger that accounts for all CC interactions was also stolen. The office was not broken into, but rather entrance was made by a key and being that the robber(sl knew exactly where everything was kept is an indication that Commuter Council does not take enough precautionary measures to insure the safety of its funds. This is further emphasized if one would take into account that nearly two years ago, another robbery occurred to the CC office in which $100 was taken. In addition, there still remains a question on the disappearance of nearly $800 from the treasury of the Council from previous years. Currently, CC has a remaining budget of $274.46 on record and will be obtaining additional funds from a Student Government request. The financial situation will be having detrimental effects: office hours will be cut and it is estimated by new CC President Bill Miller that the cash on hand for summer business will be cut from $750 to $450. Maybe the Council should indeed examine its security in leu of the recent and not-sorecent events before being allocated next year's $6,500 budget. American Cancer Society! ., SC M>UR£0 {\\Af f\\E Al;)MINl~•W\"l"IOt\ IS Cl\iE.fUU.'( STUOYI rib 1rlE aun,--,or' of" ov£R<.\l.DWOn¥, \I'\ 1\\\S OORMITO~'I- Wt R.£Gtl\fH yoUR c.oOVE~ATl01'4 ~ROU6" 't"HI') f£~IOO of \~c.orW£N1£t-lC£. WM\¥-. '/OU. " �Page 12, The Beacon, April 24, 1980 Lacrossemen Travel To Swarthmore Saturday After battling seven lacrosse teams, the Wilkes College stickmen are still seeking consistency in an effort to finish above the .500 mark. Although the toughest adversaries are behind the Blue and Gold, the remaining schedule Bethpage, N. Y. found the range three time and assisted once for a total · of four tallies. Senior Mark Sanders, West Islip, N.Y. hit the nets three times, while Joe Burnett tallied once and assisted twice for three points. Sanders also pulled off shouldn't be considered a "piece of cake". The Colonels of rookie coaches, Brian Blesi and Bill Harris own a 3-3 Middle Atlantic Conference (MAC) slate and 3-4 overall record at press time. This Saturday the Wilkes forces will travel to meet Swarthmore College for a 2 P.M. encounter. Wilkes can dump the Swarthmore squad if they can manage to play a consistent game, including tough defense. Swarthmore took a 9-1 beating from powerhouse FDU Madison, while Wilkes dropped a 16-4 verdict. Lebanon Valley will be at Ralston Field next Wednesday for a 3 P.M. matchup with our Colonels. The Lebanon Valley team hasn't won too many matches but still can't be underestimated. The Lebanon team also played a mutual opponent, Haverford College and dropped a slim 10-9 decision. The Blue and Gold fell before the Haverford team 19 face offs for the locals. The Haverford goaltender made the difference for his squad, as he pushed away 15. The alternate goaltender tossed 20 aside on the Wilkesmen. The Haverford stickmen took advantage of the extra man three times of five, while Wilkes only capitalized once out of four attempts. Last Saturday's contest brought on more fans and much better luck for Wilkes as they turned back Upsala College in a 17-14 "offensive game". The Colonels got on the board early when Joe Burnett squeezed in a goal at 1:25. Burnett didn't score again until 1:51 into the second half, but registered four more tallies later in the game to rack up six points. Also placing high in the scoring ranks were Rich Modica and Billy Adams. Modica scored six times and assisted twice to accumulate a total of eight points. Adams garnered eight points too, with two goals and six · successful passes. Freshmen Alex Rae and Larry Buffaloe broke into the scorers as Rae scored a goal and Buffaloe assisted. Both should be topnotch players for next year's team, based on their varsity experience this annum. John Nordstrom, a sophomore from Whitetiouse StaUon, .N.J. and Tommy "T" Heller a senior from Carle Place, N. Y. chipped in one goal a piece. Blesi was able to give his reserves alot of playing time against the young Upsala team and freshman goalie, Sczepanski recorded 14 saves for the Blue and Gold. Dave Singer, a junior from Fairlawn, N.J. added seven saves in the game for Wilkes. Junior Pete Canine, Crofton, MD. has contributed consistently. Wilkes totaled 68 ground . balls and took 44 shots at the Upsala goal. Freshman Tracy Cloth filled in for Sanders in the mid-field Saturday and captured 15 out of 19 face-offs. Two outstanding freshmen to watch next year will be Larry Buffaloe, Hempstead, N.Y. and Eric Farber, Cherry Hill, N.J. Although they are not big scorers, they are quick and good playmakers. Also seeing alot of action against the Upsala squad were Jeff Harper, Kevin Cavanaugh, Carl Schulteis, Bill Bernhard and John McCarthy. Glenn and Gregg Pohorely, sophomores from Whitehouse Station, N.Y. once again played awesome defensive games for the Colonels. Since this is the last Beacon, we have to look ahead to the last game of the year. Instead of playing Franklin & Marshall College on May 3, Wilkes will be on the road with East Stroudsburg State College for its last game of tpe year. STICK NOTES: goals and six assists ... In the MAC Modica has 18 goals and six assists for 24 points ... Billy Adams has 23 points; 13 goals and 10 assists in MAC and OA ... Joe Burnett has 13 t.. llies; 10 g's and three assists .. !I g's were in MAC play ... Dave Singer notched 97 saves; 82 in MAC contests ...Sanders won 64 face-offs thus far ... I would like to use this space to thank George Pawlush for helping me to get involved with public relations and the BEACON and Eddie White for giving me the extra space to write these articles ... This is the last story I will be writing for the BEACON and the last photo's I will take... GOOD LUCK to my successor for covering soccer, wrestling, lacrosse and sometimes, plays ... Bob Gaetano After seven games Rich Modica leads the Colonel offense with 26 points... 20 ;~zT:EI~Mli ~s,m i·a········o·········x········1·····N········G········~ goal just :23 seconds into the first : half and maintained a 6-3 ad- • vantage after first half action. Wilkes exploded with five goals in the third quarter but the opponent tallied six. The Colonel lacrossell!en mustere~ two more counters m fourth penud play and held Haverford scoreless. Rich Modica, a sophomore from Plainview, N.Y. led Wilkes scorers with four goals and one assist for five points. Senior, Billy Adams, • Pocono Downs will hold its first annual "College Night," on Thursday, April 24. All college students producing their I.D. cards will be admitted free. In addition, there will be a handicapping contest with all students invited to participate. Prizes will be awarded to the top finishers. Plus, music will be provided by a locla rock band. For more information, contact Dale Rapson, public relations coordinator at the • Downs, ( 717 l 825-6681. • : • w I LK Es 2o : STUDENTS:• : • : • Tuesday : 8:00 p.,n. April 29 , Wilkes Gymnasium $1.00 all students Three Rounds To Support George Elliot Scholarship Fund ......•................................... ..... ~ FOOTBALL CO-CAPTAINS - Coach Rollie Schmidt has announced that d Mollahan (left) and Carmen "Homer" LoPresto will serve as coaptains of next year's football team. Mollahan is a junior from Dover, .J. and was recently named to the All-ECAC team. LoPresto is a junior rom Pittston and has received the All-MAC award the past two years. �April 24, 1980, The Beacon, Page 13 WILKES BASEBALL TEAM ON WINNING STREAK • At presi. time, the Wilkes College baseball team had seemed to have turned itself around to look like a bonafide title team. The Colonels have won four straight going into Monday's non-conference clash with Division II Bloomsburg State, to record a 9-3 overall mark. More importantly, the Colonels own a 4-1 slate in the Middle Atlantic Conference and a sweep over Juniata this Saturday at home would give Wilkes the MAC NorthWest title. The doubleheader is slated to start at 1:00, so let's have a big crowd on hand and cheer Wilkes to the MAC N-W championship. Bring the food and beer and make a day out of it! Yesterday the Colonels were supposed to meet those big, bad and ugly University of Scranton Royals who seem to always upset the Colonels. The Royals will host Wilkes later in the season in a ffiike-up game at Schautz Stadium in Dunmore. On April 29 Wilkes is scheduled to travel to Moravian College for a single game before hosting Division III power-house Upsala College in a 3:00 start on May 1. In addition to the one Scranton doubleheader, a twin-bill with Kutztown State will also be made up before Wilkes goes into (hopefully ) to the MAC playoffs, and then possibly the NCAA regional tournament. Since the last BEACON, the Colonels of head coach Dave Kaschak and his crafty assistant Mike Broda, have gone 5-1. The Wilkesmen started the week by splitting with Division II East Stroudsburg State College, winning 13-10 and losing the second game 98. In the opener, Steve Swanson picked up the win in relief of starter Ken Hodick and Tony "Sparky" Vlahovic, the Rolaids "Relie! Man of the Year," recorded his third save of the young campaign. Wilkes banged out 14 hits in the opener led by Chick Andrewscavage, who had three hits; Bob Brezenski, the hottest Colonel with two homers and another bleacher-reacher by Rick "Big DH" Marshall. In the second game, junior Jim "Rainbow" Kearney suffered the heart-breaking loss as ESSC's Bill Phillips hit two homeruns. Phil Marino wasted a homer for Wilkes in the losing effort. Then Wilkes traveled to Reading for a key MAC meeting with Albright. The Colonels returned home with asweep winning 2-0 and Then this past Saturday the Colonels traveled to Delaware Valley for a non-conference twin-bill and again came home with a seep winning 7-2 and 10-2. In the opener, Rainbow Kearney fired a one-hitter and soph Steve "Tugger" Swanson threw a three-hitter in the night- l Gold could have been undefeated at this time. AROUND THE HORN :... Colonel fans feel back-up catcher Sam Berto has the tools to be a great one before he is through ... he's still learning and Jim Morrissey is helping him out ... Morrissey, by the way, was 11amed as WNEP-TV's (Channel 16) "Athlete of the Week" for this past week and received a trophy ... Jim set a school record with six hits in one game against Susquehanna ...there is no truth to the rumor that Colonel Jerry "The Bull" Antosh is a professional dancer in the of-season ... Colonel pitching corp is very loose this year which seems to be helping them ..•Vlahovic has come on to be the "main man" in the bullpen ... he really puts the fire out ...hey Chickie, your bumper-stickers didn't come in yet...Broda is one of the top assistants in the MAC...Rich Borofsld and Bob Brezenski, both seniors in their last seasons, have been quietly enjoying very good years ... "Booger" Brezenski is really stinging the ball and is the main cheer-leader in the dugout...loyal fans Art Hoover and George Pawlush have been in attendance at many games this year... Chris DaRe is slowly making people forget Terry Schoen, he's going to be a good one, as will Joey Malatesta ... Colonel pitching has been super so far this year and to think, Kaschak still hasn't used some super freshmen ...Colonels will be loaded in next few years ...this is last baseball story ... good luck to Coach Kaschak and his team as they enter the playoffs. Eddie White III •••••••••••••••••••••••••••••••• ATHLETES OF THE YEAR Phil Marino Leads Off First. 10-3. Senior Carl DeFelice hurled a two-hitter in the opener to record his first win of 1980. Wilkes' only two runs came on rbi singles from Rich Borofski and catcher Jim Morrissey. Wilkes had a super relay play in the game as a Albright player hit a ball over Borofski's head in right field. "June-bug" retrieved the ball and fired to second baseman Chris DaRe, who in turned relayed to Chick Andrewscavage who pegged to Jim Morrissey at the plate who tagged 'the runner out. Tony Vlahovic garnered the win in the second game as Wilkes came from behind to Win 10-3. Joe Malatesta had two hits to spark the offense and Brezenski added three runs batted in. cap. Rich Borofski was instant offense in the first game, connecting on a grand slam homer. Rick Marshall also chipped in with two rbi's. In the second game, Phil Mariono played "long-ball," with a three run shot and George Kavulich added three rbi's and Malatesta added three hits to the cause. It seems like every thing is falling into place for Wilkes and with the easy wins, Kaschak is giving the young and talented freshmen a chance to play. The Colonels have shown consistent pitching so far in 1980 and are deep there. This will help in any post-season tournaments and Kaschak knows that. If Wilkes had gotten any kind of hitting early in the year, the Blue and Diane Kendig Bryan Billig Junior Diane. Kendig has repeated as the Beacon's female "Athlete of the Year," and junior Bryan Billig has been awarded the male "Athlete of the Year." it was announced recently by sports editor Eddie White. Kendig captured the award a year ago as a sophomore while it was the first time for Billig. Kendall McNeil earned last season's male award. The pair was selected by the Beacon sports staff. The Beacon "Coach of the Year," award will be announced at the athletic awards banquet. Kendig, a 5-4 guard on the Wilkes women's basketball team led the ladies to their best season ever this past year as they recorded a 16-10 mark. Diane hit the nets for a school record 600 points while averaging 25.0 game. She is Wilkes all-time scorer with 1,571 points after only three years of competition. She recently was named to the Middle Atlantic Conference first-team all-stars and selected as the league's MVP. She has also earned All-American (first team) honors for this past season. Billig came on this year for Coach John Reese 's wrestling team to have the best record with a 23-6-0 overall slate. He was 18-3 in dual events with ten pins, was 2-2 in the NCAA Tourney and placed second in the annual EIW A Tourney at Lehigh University. He led the Colonels to an excellent rn-2 slate which included a school record IS-straight wins. He tied former Colonel great Jim Weisenfluh's record of 14 overall pins in one season and also Al Zellner's single dual season mark of 10 falls. He also tied for the school record in 18 dual wins in one season. Both received their MVP trophies at the students awards dinner on Tuesday and both will be top contenders for next year's awards. a Da.,e Taylor hurls. a,hile Chicle Andrea,sca.,11ge a,atches the oction. �Page H, The Beacon, April 24, 1980 Between The White Lines ======BYEDDIE WHITE Ill= THIS IS IT! Well, this is it! My last sports column for the Beacon. This piece of print will be my final contribution after four years of writing sports for the paper. I'm proud to say that I had an article published in every issue of the paper during my tenure at Wilkes. It was a great four years here. I've met many different types of athletes and coaches. Most of them were just super and it was a joy covering them. I feel I liave helped advance the coverage of women's sports here at Wilkes and this past season gave the ladies the best sports coverage they ever had. We also brought to the Beacon sports pages the finest photos it ever had. And I thank the irreplaceable Bob Gaetano for that. Without "Gates," I never would have made it and he IS the best sports photographer this paper ever had. We also institued a new award to add to the annual "Athletes of the Year." Last season we had the initial "Coach of the Year," and that" ill hopefully be carried on for years to come. It was a pleasure to give the first coach.of he year award to Gene Domzalski, retired Colonel diamond mentor. Domzalski, now a member of Wilkes administration, was our favorite coach in our four years here. I enjoyed working with most of the coaches at Wilkes. but Domzalski stood out. Not only was he a strong · disciplinarian and an expert when it came to baseball, but he realized the function of the press and the role of public relations in sports. Domzalski was one of the few coaches or athletes for that matter. that would call you the day after a story appeared and offer a "thank you." I can count on one hand the number of "thank-you's" I received at Wilkes. He realized the theory that, "what good is it to be 3M if nobody knows it!" In my first year here, I served as a sports reP9rter and covered the·so-called "minor" sports and don't let anybody tell you some sports are not more important than others. In my sophomore year, I was named as the assistant sports editor before serving the last two as the head sports editor. In addition to that, I worked in the sports publicity department of the Wilkes public relations office. Therefore, I was forced to wear "two-hats" • one as a publicist, writing what the college wanted written and one as the reporter, reporting the facts. I enjoyed both and I can say my experience with the PR department and the Beacon made my years at Wilkes. We're all here for academics. but without the extracurricular activity, we are all lost. That is why, I take with great distress the recent announcement concerning the Academic Standards Committee and its passing of the proposal regarding academic probation and involvement in extracurricular activities. With this, anyone who is on ; probation, cannot take part in ANY activities. If this goes through, the college might as well do away with all sports, clubs, student government roles and the like. Let's bring back the homerooms and stay in class all day! Another controversial item which bas been in the limelight throughout our years here has been the Wilkes wrestling team. Mostly because they are Division I, the grapplers come under complaint from almost every Division Ill athlete on the campus. And that is expected. When a team is Division I. which allows scholarships, some people are jealous , and when anything wrong happens, it is usually the wrestlers that are blamed. John Reese has done a super job as the head coach of the wrestlers and just as good as AD. We would have liked to have seen most of the other sports go Division II, which would allow scholarships, but the key here is, who is going to give the money. For a sport to give scholarships. it needs a backer or club to pour out money to the athletes. The wrestlers have the "Grappler's Club." I guess if one · of the other teams got some financial support, they could move up a Division. This is no knock against Reese, but we still believe that all athletic directors . should not be allowed to coach. They should be a separate part form coaching and have no direct ties to any of the sports on the campus. We've had our disagreements with coaches and athletes over the years, but I hope the enthusiasm of coaches Nancy Roberts and Ron Righter rub off. Those two are headed in the right direction and are using Wilkes as a "stepping -stone." In a few years down the road, both will be at "big-time" schools and it will be a tragic loss for Wilkes to lose two coaches like that. As we look back on four years at Wilkes, I have to say the best TEAM I ever saw was the 1978 baseball team. It was loaded with talent and had AllAmericans all over the field. It was a team, with a team attitude and it was successful. That was Gene Domzalski's final year as a coach and the Blue and Gold finished with the best record EVER by a Wilkes baseball team -25-5. It is impossible to say who was the "best" athlete I ever saw. The word, "best," can be taken many ways. We"ve seen not-so talented athletes work hard to be. the "best." And we've seen very talented athletes let it all go to waste, which was really frustrating. There were just too many really great male athletes for us to choose. ONE as thee best! But with the ladies, there is no doubt, that Dian Kendig was by far the finest woman athlete to step on the campus in our four years here. She might even be the best girl athlete in the history of this school. We can also add a " most dedicated athlete," to that list and he was basehaller Carl DeFelice. Nobody worked as hard as Carl and took his or her sport with more seriousness and determination. Another sight we will • remember will be the fans. They were the same ones who turned out game after game to most of the sports. They would make the long footaball away trips an the baseball away games. They would be there at the EIW A wrestling tourney and at the NCAA Mideast Regional baseball tourney. Wilkes has some great fans, fans that come whether the team wins or loses. I thank the fans for their support for the team. I must also thank Wilkes sports for bringing me some personal happiness through its success. The most exciting sporting event that I have ever witnessed inperson involved a Wilkes team. It was this past season when the Wilkes basketball team downed King's College on the Monarch's home floor, 77-76, for the first time in God knows when. It was a thrill that will live inside me forever. I grew up in "dis val-e," and I'm proud of it. I've seen King"s get all the ink over the years, and to see an unheralded Colonel squad upset the then-invincible King's team was just, well, great! I will never forget it and either will this valley! When anyone leaves after a stay or retires from something, there are always the thank-yous to hand out. And this is no exception. I first must thank Tom Moran, former PR chief here, who was responsible for me being at Wilkes. I must also thank Art Hoover and Dean Ralston for all their help over the years and to those fellow reporters I have worked with over the years, I thank you for putting up with me. I know it wasn't easy! I have probably forgotten to mention alot of names and for that I am sorry. But there is one man that I owe a very lot to and I know I will never be able to pay him back. If I ever have any career in the sports journalism field, I owe everything to this man, who showed me the ropes. I'm speaking of current Wilkes College public relations director George Pawlusb, who taught me that to get somewhere, you have to pay the price. When people had shut doors on me, it was George who found a window for me to escape. George, it was my pleasure-to be your sports publicity assistant for the last four years and I'll never forget the experience. Now before I turn this into another "War and Peace," I'll end it. There are many of you out there who had disagreed with what I wrote over the years. But it gave us a chance to exchange our views and see what we were really like. It helped us to communicate! And people, isn't that what it's really all about. Keep it between the white lines! Netmen Drop King's; But Fall To E-town The largest crowd of the season came out to watch the Wilkes tennis team destroy long-time rival Kings in an exciting 9-0 victory. A sellout crowd of THREE fans (one more than last year) expected to see a close match with cross town rival Kings College. For many years both teams have played matches that were decided in the final point, no matter what the record. This year the Colonels didn't lose a set in a quick and decisive match · over the Monarchs of Kings Col- 1 lege, Last WedneSday Wilkes traveled to Lycoming in below-freezing temperatures. However the Colonels were not bothered by the lousy weather as they won another 9-o match to even their season record3-3. The blue and gold then had to face a team they have never beaten. The Colonels knew that if they beat Elizabethtown College they would still have a chance to win the division title. After the dust had cleared Wilkes had lost 7-2 to probably the toughest team they will face all year. The match was close at the start when Marcus Eckert and Bill Murtagh came through with big wins for the Colonels. The team almost split the singles matches when Mike Hromchak nearly came away with a win in an exciting three-set match. There is no doubt that Wilkes can compete with any top Division III team. They have lost many close matches that if given the chance, would have easily won. After getting off to a slow start the team has now won three of their last four matches. The remaining four matches are tough, but if the Colonels get their act together they will end the season on a winning note. DROP SHOTS ... Senior Kevin Obrien from Endicott, New York won two big matches against Kings and Lycoming ... Bill Murtagh has only lost one singles match for Wilkes... A thanks to Basketball coach Ron Righter for driving and coaching the team on their away matches ... Colonels take the road Monday under the lights at the Scranton University courts at 6:30 pm ... Bob Buchsbaum SPORTS WRITERS-Anyone interested in covering sports next year for the Beacon or intramurals is asked to contact Peter Steve at extension -173 or stop by the Beacon office on·the second (Joor of Parrish Hall. $ NEED EXTRA INCOME OR S.UMMER JOB$ Earn $5 to $8 per hour part time, $100 to $300 per week full time. Collect signatures for independent candidates anywhere in Pa. Meet at Burger Barn, on Public Square Saturday, April 26 10:00 A.M. Ask for Mike �April Z4, 1988, The Beacon, Page IS Golf Team Struggling: Lose To King's, Moravian under 90. ·The Wilkes College golf team loss Coach Schmidt said that he is not to cross-town rival King's for the worried about the slow start. But, second time this season, 417-430 last he admits it will be hard to Wednesday. Golfing the next day duplicate last year's acthe Colonels split: defeating Moracomplishments. Schmidt also noted vian, 423-429, and falling closely to he is very pleased with Lepore's Muhlenberg, 422-423. performance. In this year's home opener which This is the last column on the golf was against King's, the Monarchs' team in this paper for the year. Bob Rundle took medalist honors That also does it for my short with a 76. Mark Lepore followed with a 78. They were the only two writing career here. Thanks go out golfers in the 70's. Others shooting to all the coaches and athletes in the sports I have covered, and also the that day were Karl Blight, 82; Chris Reilley, who is in his first year of entire Beacon staff, especially Eddie White who gave me the op golf after playing two years of portunity to write sports . My only baseball, 86; Ray Ward 91, and regret about writing in this paper is Dave Samsel, 93. that I didn't start_ writing as a11 In the triangular against underclassmen. GOOD LUCK t(I Muhlenberg and Moravian, Captain the Beacon staff next year. Mark Lepore garnered the medalist spot with a two under lijlr 74 and . REMAINING GOLF SCHEDULE April 21 Susquehanna (H) was the only golfer in the 70's. April 23 east Stroudsburg (H) Rounding out the field for Wilkes April 25 Albright-Juniata (A) were Chris Reilley and Jack Gyler, May 1 Lebanon Valley-Scranto11 86; Karl Blight, 88 ; and Ray Ward, (H ) Joe Rubbico and Dave Samsel all at April 28 MAC's (Delaware Valley) 89. This was the first time this Rich Nordheim season . all Colonel golfers shot Good news intramural fans! Coach Dave Kaschak, head man of the Wilkes College intramural department. has announced that an indepth program for intramurals will be started next year. In the fall , Wilk~s will have for the men : flag football. tennis and volleyball. For the women : softball, tennis and basketball. And a coed tennis program will also be organized. . Iii the spring, there will be basketball and softball for the men. volleyball for the ladies and oo-ed volleyball. Some other sports are expected to added and this will be announced next season during the school year. Anyone interested in the outline of the program or anyone with any ideas is asked to contact Kaschak. who has done a super job in organizing Wilkes intra murals. Another possibility could be the champions of the sports meeting King's College' s champs for the citycollege intramural title. Go for It! •SOPHOMORES• LAST CHANCE ARMY ROTC means finanical assistance your last two years in·schooj and a good starting salary in either the Active Army or as a part time job _with the Army Reserve or National Guard. AN EXCITING, NEW TWO WEEK COURSE This summer can qualify you.but DO NOT WAIT FOR INFORMATION CONCERNING THIS offering, Contact Captain Bob Keenan, Room no.C, Sheehy Student Center, Kings College or Call collect {717} 961-7457 ARMY ROTC LEARN WHAT IT TAKES TO LEAD Softball Team Finally Loses, Travel To Marywoo.d Today "I'm very happy with the way the team in batting with a .520 day they are at Marywood before we've played as a . team this average (13-25) followed by Farrell traveling to the big bad U on Saturseason," commented first-year •.t09, Snyder .357, and Frail .360 ••• day for a DH with Scranton UniverWilkes College women's softball Johnson, Dayer and Farrell each sity ...on April 28, the girls will h ost coach Nancy Roberts. '"We have have eight rbi's behind the leader L.C.C. at 3:00 ... this is the last story really had some pleasant surWalsh with 11 ••• Dayer leads in exfor the year. good luck girls in your prises." Those surprises include tra base hits with four ... on Tuesday last few games. the excellent play of the freshman the ladies were expected to meet Gary Mack battery. Susquehanna in an away !lH -•"· Linda Dayer (5-1) and Cheryl "" Frystack (2-2) have really performed well under pressure. Add to that freshmen catchers Karen Johnson and Rose Shanahan, Roberts says, "They've been playing like seniors. not freshmen. The girls have really sparked the club and it helps as they play at the two important positions." Shanahan had to move in from centerfield when and injury forced Johnson out of the lineup. "Rose has done everything we could possibly ask for," says Roberts. "She is having some .problems offensively, but her defense has been super." Roberts also heaped. words of praise on clutch freshman performer Joyce Walsh along with sophomore slugger Mary Jean Farrell. Walsh has come up twice in pressure situations with the game on the Ione and delivered the big hit. Farrell has been tnoved from shortstop to second base and back again all season long. The Colonelettes have just finished a 3-3 week and now bold a 7-3 overall mark and a 3-1 MAC slate at press time. The first game saw the ladies meeting Misericordia in Dallas. Tbe visiting Wilkes squad squeaked out a 9-7 win. Behind 7-3 going into the final inning, the Colonettes loaded the bases and Joyce Walsh blasted her first collegiate homerun-a .grand slam! Johnson and winning pitcher Dayer followed with single runs to win. Big guns on the day were Farrell with four hits; Johnson, Dayer and senior captain Mary Jo Fr.ail with two hits apiece. The Wilkes women then traveled to Bloomsburg, only to lose both ends of a twin-bill. The first game Wo•en'• SoftballAction. score was 7-6. Frail was 4-4 while Stacey Leely and Dayer each added a single and double in the losing effort. Frystack was tagged with the loss. The second game was 1~ as nine different Colonelettes acThe Wilkes College Mixed League 7-26 Veterans Club I counted for at least one hit. Pam fJnisbed up its second half regular Midwest Division Snyder hit a homer and ·had two season last Friday as the 20-13 Aristocrats rib's while Walsh accounted for a Aristocrats and the Mother Brother 18-15 Assorted Nuts double and two more rbi's. Dayer joined Bud's and the Avengers in 14-19 The Force took her first loss of the campaign. the play-offs. Bud's finally nailed 1~23 The Pack The girls got back on the track down the Atlantic Division and will 8-25 Good News against Elizabethtown with a 5-4 be matched up against the Pacific Division win. Dayer got the win and Walsh Aristocrats, the newly-crowned 23-10 Avengers was the big hero with a two-out, Midwest champs, in one semi-final. 18-15 EE's · two-rbi double in the bottom of the In the other semi, the wild-card 16-17 Nukes last inning. Then OD Saturday, team-Mother Brothers-will play 16-17 Whippets Wilkes met FDU Madison and the Pacific Division titleists, the 14-19 Veterans Club II despite only four hits, the ladies . Avengers. The two winners will be 11-22 BS'ers scored 12 runs. Dayer and Farrell paired OD Saturday, April 26 for the each had two hits and Frystack was second semester championship and the winner. Farrell made a super the right to meet Poky's (first defensive play in the game and semester winners) for the over-all WHAT GOES ON HERE-Wilkes recorded ten outs. coaches are now turning into 1979-'80 laurels. The Awards BanWilkes ended the week Sunday maintenance workers. The spring quet will also be held OD the evening with a 7-2 loss to Upsala College in of the 26th; any league member can coaches are working on' the fields East Orange, N.J. Upsala is a still make reservations by calling when they should be coaching. If power-house in both men's baseball David Williams at 823-2406. the mentors don't get the field in and women's softball. Senior Lynn shape, no games are played. Whert Final Standings: Yecllock had a double and a single is the maintenance men? Some of Atlantic Division in the loss. The ladies, who left girls Bud's Compressor & Supply 23-10 the coaches have already complainon base in every inning, also com- Mother Brothers 21-12 ed to us · about the situation. mitted seven errors. 19-14 Poky's FOUL BALLS: ...Johnson leads 752Crew 18-15 ······BOWLING•······ �a t======================.:=========================-===========================================================:::::::::::::::::==========:::::::::::::::::::::::::::::::::::===:=======:=================:=====::::=:===•:•=•:•=·=·=·=·=·=·=·=·=·=·=·=•:•=·=·=·=·=·=·=·=·=•:•=·=•:-:-·❖=·=·=·=•:•=·=·=·=·=······························;;m ... .·.· N h 0 . • U ;~ a, ~! :.< """. :.< .... :.< ~ t ~)C= .!! 0"' ·a,~~. "'WW"' ..a .. 1980 Yearbook OnSaleNOWII a.st: $14($5 Deposit) An additional mailingfee: $2 On sale in the ca/eat dinner . ofattheAmnicolaofficeTues.&Thurs. 11·1 Limited Number Of Bookslll Also: Bade issu es o/ tlae Amnicola are aa,ailable at only$l0 percopy. lnquireato/fice. � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 April 24th Date A point or period of time associated with an event in the lifecycle of the resource 1980 April 24 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/9452ec4fa707bc994f8286e47d6a96af.pdf d7ef4d93b8a67c0088e1c9aa688cb8ea PDF Text Text $60 Activity Fee Included Ilise In Dorm Student Population InNext Year'sSGBudget Forces College To Lease YMCA 1 Abudget for clubs, organizations, the four classes, IDC, and CC was passed by Student Government on Monday, April 7 by a vote of 16 to four. The budget includes a $60 activity fee per student based on an enrollment of 1,975 full-time students. This means a 100 percent increase over this year's $30 activity, and before the increase officially goes into effect it must first be approved by the Student Activities Fee Fund Committee. If approved, --the new fee will go into effect next year. In addition to the budget with the new activity fee, an alternate budget with a $50 activity fee was prepared. Both budgets were formulated by the executive council of student government under the direction of former SG president Dave Blumfield and former SG treasurer Joe Galli. The executive council discussed both budgets and the one with the $60 activity fee was brought before the SG body and put toa vote. Tucker, Miller And Galli Win Presidencies Joe Galli, Janine Tucker and Bill Miller will be next year's student leaders. Their official victories were announced last Friday, April 11, after voting was held the day before. For Student Government president Joe Galli ran unopposed.Out of the 220 ballots cast he received 198. 22 votes were cast for various writeIn candidates. His candidacy drew roughly 10 ·; of the student population out to vote. Galli assumed the office of president at Monday night's SG meeting. His executive council was elected at that time. (See SG story) . The Commuter Council presidency was sought by one candidate. Of the 75 ballots cast Bill Miller was elected CC president with 38 votes. There were 37 writein votes which were predominately for George Bath, a local character. Miller, like Galli, assumed his position at Monday night's weekly CC meeting. This election attracted roughly 7 percent of the commuter population while Miller received a little more than 1h of the vote. The Inter-Dormitory Council presidential election ended in Janine Tucker's favor. She defeated Jon Pliskin by a wide margin. The final count was 108 to 37 with 5write-votes. Attracting 15 percent of the dorm student population, Tucker will assume office this week. Galli stated that the biggest reason for increase as being to allow an amount of money to budgeted specifically for concerts. This amount would be in the $9000$10,000 range. According to Galli, "the executive council felt that there was a definite want among the students for concerts at the school." However, because of the small size of the gym, which is where concerts are normally held, and because of the fact that SG almost always incurs a loss in sponsoring concerts, it was felt that there was a definite need to put money aside for concerts to cover any losses, and to bring in bigger and better acts. Also, the new budget takes care of things like the calendars that are printed every year. In the past, the administration shared the printing cost with SG, and in cases SG did not even know this. The money was just withdrawn form SG's account. Funds have also been budgeted for posters for activities. In the past, money for posters usually came from the Student Government Fund with covers expenses for supplies, phone calls, and other things needed to run SG. Increases have been budgeted for the accounts from which funds are allocated to clubs and organizations requesting aid. Galli pointed out that this does not mean that SG will give money to just anybody requesting It. The executive council also raised the class budgets because the classes have shown enthusiasm and Interest In sponsoring activities and getting students involved. Also receiving more funds will be the film committee and social committee of SG. The film committee needs greater funding because the (Continued on Page 3) ADDED HOUSING-The college has acquired space in the YMCA located across the street from Sturdevant Hall on South Franklin Street. Only the living quarters on the third, fourth and fifth floors will be used by the college. It is· most likely that the To help alleviate the increased female freshmen, although she need for housing, the college made would like to see upperclassmen an agreement with the YMCA to move into the new dorm space. lease the resident portion of the Three floors will be used for facility -for five years, beginning in residents. Reiter predicts that September 1980, according to Dr. there will be approximately 32 girls Andrew Shaw, Dean of Manage- • and one resident assistant per floor. ment. The college would have The people now living in the YMrenewable options after the five CA will vacate the facility by July years. 15, .1980. At that time, the college This will add 96 available dorm will be able to enter the facility, spaces for student residents. Ac- providing new furniture and any cording to Jean ]:leiter of the Hous- necessary renovations. Dr. Shaw ing Office, this facility will house stated, "The residency section will be sealed off from the rest of the building and the college will be doIng all of the maintenance during the school year." Also, a Wilkes College sign will be placed on the entrance. Although no rooms were no break-in damage to Weckesser available for Inspection, the first Hall was discovered, leads CC of- floor features a large lounge area ficials to believe that the theft was with a useable fireplace. "This area done by someone who knew the ·will be ideal for studying or receivsystem of the building. ing guests, " stated Dr. Shaw. Due to the burglary, a limited He explained that the rooms are supply of bus tokens and parking singles, with about one double per coupons will be available in the CC floor. "They are not large rooms, office until a better security system but they are comfortable," he said. Is installed. Miller commented that Bathroom facilities are present on a new system is already under con- each floor. sideration, although no details are Dr. Shaw believes the location is available as of yet. excellent, since it is so close to most Wilkes-Barre City police are campus facilities. He sees it as an presently Investigating the matter almost integral part of the campus. although because there is no way to "I would like to see it become a pertrace either the tokens .or the manent part of the campus, also," coupons apprehension of the guilty he stated. · party will be difficult. Projections show that next fall, · Peter Steve there will be a demand for approximately 1060 dorm spaces. There CC Of/ice Burglarized Over Easter Vacation Bus tokens, park and lock coupons and a small amount of cash was stolen from the Commuter Council office on the second floor of Weckesser Hall during a break-in over the recent Easter vacation. Discovered by Peggy Jones, Dean's Secretary, the first day back after Easter break, the CC office was not the onlyroom burglarized for the key to the Xerox room along with few other items were reported missing from the third floor as well. According to Bill Miller, next year's CC President, the key to the CC office was accessible In Peggy Jones' office, and apparently the alleged burglar knew exactly where the key was located. This situation, coupled with the fact that 96 single living units will be occupied by freshmen women. The ever increasing demand for housing space is making the need for a new dorm imperative. are 775 spaces on campus. The YMCA will accomodate 96 women. The Housing Office plans to pace the remaining 200 students in the Hotel. Dr. Shaw sees the Hotel as a valuable interim measure for housing, but one which can hopefully be phased out. . There is still the distinct possibility of a new dorm In the future of the college. The Department of .Housing and Urban Development will review the college's application for federal funds. If the money allocation is approved, construction would begin immediately. This would give the college a new dorm for the fall of 1981. "Despite the acquisition of the YMCA, we are still pursuing the construction of a new dorm," stated Dr. Shaw. Cafeteria Space With the added dorm students, space in the cafeteria will be even · more limited than it is ·at the present time. "There would be no problem feeding the students," stated Jean Reiter, "the problem is seating them." She explained that the Housing Office and the food service company, M.W. Wood, are presently working on the problem. Patti Sparlow NOTICE To all commuter students, positions are available on Commuter Council for next year. �Page 2, The Beacon, April 17, 1980 WCLHStation Manager Position Assigned To Chris Kosakowski It was recently announced by Dr. Bradford Kinney, Director of Broadcasting for WCLH radio, that Chris Kosakowski will assume the position of station manager for the 1980-81 fiscal year. Selected from a total of six nominees Kosakowski was interviewed by a committee comprised of Dr. Kinney; Fred Pierantoni, WCLH station manager; Rich Nordheim, senior program director; and David DeCosmo, station con- · sultant. Noting that Kosakowski did a commendable job as public affairs director over the past year, Pierantoni added that along with his staff experience and successful interview, "Chris was the best candidate for the position." · When asked what problems the new station manager mai face next year, Pierantoni stated, "Internally WCLH has grown to its full potential. I feel it will be a fairly smooth change" of leadership next year. The senior manager went on to add that if there will be any problems at all, they are likely to occur because of falling equipment or the possible movement of the station to a new location. Kosakowski said that he was extremely happy when he learned of his promotion for the coming year. He continued that although he was very confident about being chosen as manager, there was no doubt in his mind that he would still work for the station to the best of his ability In any position. Asked about his intended relationship with next year's staff, the manager-i!lect commented, "At first I must be hard. I intend to weigh everything out and if something has to be done, then it NOTICE All SG representatives are required to return their constitution and bylaws book to Bill Keba in the SGoffice. Pierantoni (left). Ph. 822-7045 -r- -Imported Beers- -Cold Call in Advance fot- Kegs'and Quattei's (Must have LCB Card) on, "Fred has been the best manager the station has ever had. I only hope I can do at least as good a job as he has done. I hope to get more members involved and extend our membership from 60 to 80 members. I hope to do a good job, and I want people to proud to be members of WCLH. I'm very optimistic, and I extend an open invitation to anyone in the college who thinks they can help us.'' will be done." He strongly added that he hopes to establish one common policy between himself and Dr. •Kinner,which will ensure station unity. Commenting on the increasing popularity of WCLH, Kosakowski pointed out that the station has a great amount of community support as well as a large campus audience. He explained that, "We pull people away from other stations" . because "We try to play what people want to hear." In an effort to increase the listening audience, the new manager said that there will be some changes in the programming ·format although the one the station presently has is very good. Kosakowski would not comment on the exact changes under consideration. Eagerly looking forward to his new position, Kosakowski said that he hopes next year will be even better than the one the station is presently experiencing. He went ~ ~ Across from Bishop Hoban "We literally got screwed." That's how Commuter Council President Bill Lewis described the robbery that occurred at the CC Office during the Easter Break. The break-in was reported to the police on Tuesday morning and an estimated $700 worth of cash, c~ecks, bus tokens and parking stickers were taken. Lewis also noted that the office was not broken into, but rather the robbers had a key. In addition to the merchandise taken, the ledger that accounts for all CC transactions was also taken. "We have nothing to go on; whoever the robbers were, they knew exactly what they were doing." A similar robbery occurred to Commuter Council about two years ago and about $100 was taken. As a driect result of the robbery, Comuter Council will be forced to Umit its office hours from 11 o'clock to 1 o'clock each day. In addition to the cutback in hours, CC will also be investing money into a safe with only a few members of the Executive Coucil and the administration having knowledge of the combination. "It's a shame and it will unfortunately affect our level of service." Executive Council Elections were held during the meeting. Installed were: President, Bill Miller; Vice President, Maurita Gries; Treasurer, John Moffatt; Recor- . ding Secretary, JoAnne Bennick; and Corresponding Secretary, Joe · Rubbico. In addition, Commuter council will also be participating in the CHRIS TAKES CHARGE - WCLH-FM announced its new station manager for the 1980-81 year. Chris Kosakowski, a junior business administration major from Hunlock Creek, will succeed former manager z 0 DECKOU R'S BEER CC Pre~ident Reports On CC Office Robber 0 u ~ ~ = < ;;) ~ < ;_. NUMBER9 SHOP Ii 9 W. Northampton St. Wilkes-Barre, Pa. 18701 I I Boutique•Jewelry•Clothes J Layaway Availab_le i i We Accept Master Charge & Visa - New Style We feature Sicilian style pizza squares, serve salads, hot platters and cold 9r hot hoagies. We have specialties such as: Stromboli, Calzone, Sausage Roll and Parmigiana Turnovers ~ > t~ > = t~ (;) Receive $1.00 Off 0 on any large pie Expires April 24, l980 VALUABLE COUP,ON 0 ~ ~ z illr [Jl)rJlI)llfl flfliS r.r1[1 SIJSiflrns i ~ i i L..,..~.__....,.........;..___.........,...,..j MIDTOWN PIZZA York Pizza NOTICE Joe Knox, President of the Coalition of Independent Colleges and University Students (COPUS> would like to thank everyone for all the help in the writing, phoning and petitioning campaigns. Your help was deeply appreciated. It really did make a difference. . - ~.,....,_....,_...__...._...__.,...,.,..,..~~.__.....,.._.~ i i NOTICE A companion is being sought for a drive to Tucson, Arizona in August. Willing to share expenses. Call Debbie at 288-3011 . lBimSirifflll r.l]IJS(I Peter Steve Ii interested in being part of the Council's team or helping out with their Ring Toss booth is asked to contact the CC office in Weckesser Hall. Also, the results from the survey taken by the CC-IDC Social Committee on "what you want to see at a party for next year" will be tabulated after school is out. As a token of their extreme dedication, certain members of Commuter Council and of the Junior Birdmen Society of Wilkes College presented the out-going CC President Bill Lewis with a series of awards. Some of the awards include a Junior Birdman T-shirt, a poster, a pair of goggles and a pair of orange flippers. Cake and bird seed were served and the Junior Birdman Alma Mater was sung. All who attended found this CC meeting the best one so far this year. Darlene Schaffer See Joe, Bob, and Danny MON.-THURS. 11 A:M.-9 P.M. TUES., WED., FRI. & SAT. 11 :00 A.M.-5:30 P.M. 288-3751 ,.... I _ -.- e&:I -a~r 10% DISCQUNJ OFF ANY PURCHASE WITH THIS COUPON '·_.,..,.. I .UA■IO■ IIU■LIC . ..,_ �April 17, 1980, The Beacon, Page3 ~11111111111111111 Ill lllRI Ill 11111111111111111 Ill 11111111111111111111111111111111111111111 Ill Ill Ill Ill lU 1111111111111111 lllll 1111111111111 i1111111111111111111111111111111111111111 Ill Ill II~ I Minors Approved In ·17 Disciplines; I New Officers For Next Year I= Sociology Dept. Reorganizes Major I Selected At S. G. Meeting . i Minors in 17 disciplines were approved by the faculty on Thursday, April 3. The minors program will go into effect at the beginning of the fall semester of 1980. In addition to the already approved minors, proposals for minors in political science and philosophy have been passed by the Curriculum Committee and will be brought before the full faculty for 1al approval on Thursday. May 1. Nith the approval of the minors, ·'. ociology-Anthropology depart.. ::at will no longer offer a combined sociology-anthropology major or anthropology major. The department will offer only a minor in sociology, a minor in anthropology, and a major in sociology. The approved minors are listed below along with a description of the requirements for each. Students planning to minor in any of these areas are urged to . con~lt with faculty members of the department in which they wish to minor. They will be able to answer any questions about the minor. Approved Minors Art-18 credits consisting of six courses beyond the 100 level. Earth and Environmental Sciences-18 credits including no more than six credits at the 100 level. History-18 credits in history. The history 101-102 sequence should be included. Biology-23 credits consisting of Biology 201, 202, 203, 204, 205, 206, 207, 208, and one three-credit biology course from the 300 level. The level course should be selected with the help of biology faculty members. the minor. · Chemistry-22 credits including . Anthropology-18 credits inChemistry 115, and 116 or 118. · eluding Anthropology 101 and at Accounting-Students must comleast one of the following: Anplete Accounting 101-102 before thropology 270, 271, 272, or 273. In starting a minor in accounting. The addition,. practicum 399 may be minor consists of 18 credits~Acconsidered. counting 111-112 additional credits. Sociology-18 credits including Seconday Education-25 credits Sociology 101 and at least one of the consisting of Education 101, 102, following : Sociology 255,370, or 380. 201, 202, 203, and 380. In addition, Practicum 399 may be English-18 credits including considered. English 151-152 and 12 additional · Business Education-24 credits credits in courses beyond the 100 consisting of Math 111-112, 202, 211 level. or 212, 311 or 331, and a three or four Theater Arts-A minor in theater credit 300 level math elective. arts consists of theater arts 141 and Computer Science-21 credits 15 additional credits for a total of 18 consisting of Computer Science 123, credits. Theater arts 101 will not 124, 223 or 224, 227, 322 and one of count toward the minor. the following pairs: C.S. 262 and Modern Foreign Languages-18 321, C.S. 320 and 329, C.S. 323 and credits in one language beyond the 327, C.S. 323 and 328, C.S. 324 and 102 course in that language. 325, C.S. 326 and 327, or C.S. 328 and Co m m u n i c a t i o n s 364. Studies-Students majoring in other disciplines may choose any ., C 1 one of the communications concenContinued from Page 1 trations as a minor (see current cost of films has gone up. The social student bulletin for descriptions of - committee will be budgeted $2000 to these concentrations). The student be used for coffeehouses and one should include Speech 101 and Com- . major event. munications 101 in · his program. The executive council backed the Students choosing the concentra$ 60 activity fee because the budget tions in organizational communicawith the $50 activity fee would tions, journalism, or broadcasting eliminate the posters. calendars, may substitute any advanced comand decrease all accounts by $500 to munications course for com$lOOO .. munications 252. Galli pointed out that as Psychology-18 credits including treasurer he has seen what goes on Psychology 101-102. Also, no course with accounts. He has seen the can be substituted for Psychology limitations placed on Homecoming, 102, and Sociology 255 and EducaWinter Weekend and the Cherry tion 202 will not count toward the Blossom committees because of minor. Psychology 215 will be the their budgets. only required_ advanced course in He says that with the increased fee SG, "can increase activities, satisfy more students, and not worry what our back pocket looks like." He anticipates that some students will ask what if they do not participate in activities, and he 125 Academy Street Act, .. ,·ty ree lncre1a•ed Januzzi's Pizza and Hoagies BROOK'S BARBER ~Ii.OP -- - - : I~ - -- I •ADMISSIONS COUNSELOR• ~ noted that to those students he will reply, "we have always encouraged students to be actively involved in campus activities, and if they don't want to take part in these activities, they are at their own disadyantage." Galli concluded that the $30 activity fee Wilkes had been charging was way below the activity fees of comparable colleges in Northeast Pennsylvania, most of which have activity fees ranging from $50 to $90. Louis Czachor NOTICE There will be a meeting of the Cherry Blossom Committee tonight at 9:38 in Stark 101. Anyone who is interested in helping with preparations for the Cherry Blossom Festival is asked to attend this meeting to help organize the events. fJ ~000000~~ Home Delivery OPEN 7 DAYS 11-1 ·- Student Government elected officers at Monday night's meeting after outgoing president Dave Blumfield turned the meeting over to SG's new pr~sident, Joe Galli. · Four representatives were nominated for the office of vicepresident but incumbent vicepresident Marla Brodsky was the only one to accept the nomination. Chris Fellin, Rob Doty, and Al Wirkman were also nominated, but they declined. Brodsky received 16 votes and three write-in ballots were cast. For the office of recording secretary Tim Palmer, Chris Fellin, and Carol Benek were nominated, but Fellin declined. Palmer, with 13 votes, defeated Benek who had seven. · Tom Rooney, Al Wirkman, and Rob Doty were nominated for the I NOTICE ~~~ ..,, • STYLING FOR· M;N & WOMEN • HAIR COLORING & CONDITIONING • PERMANENT WAVING • HAIR STRAIGHTENING • SCALP & FACIAL TREATMENT • MANICURING • SHOE SHINE __!;All FOIi !,~INTMfNT FilANlt • PETE SAIITOl\10 • PIIOP. . 2325~ ( .:~l:t~-) 824- ' . MAIN FLOOR 15 5. IRAMr.llN SI .. WII KES -eAH[ • Any students interested in serving on a Student-Faculty committee may pick up an application in the bookstore, library, Deans' Office. registrar's office, Housing Office, student center, or cafeteria. Membership on these committees is open to all students. All student govemment representatives are reminded that they must apply for membership on one of these committees. . Entrfi level position with involye~ent 1n a 1 asQects of adm1ss1ons:.. ~t=ttt:ft=:=t)t=:=ttrrrttttttrtIItrrrrrrirrrrrtttU~ recruitment. Full-time, twelve-month II D -EMOCRATS appointment. ResRonsibilities include recruiting and in erviewing students: high school visits, college day-night 1111 - - ELECT - lilll Erograms and other related admissions : PREGNANT? unctions. Extensive travel. Stron~em- l §basis upon communication s ills. achelor's degree required. Position available June 1, 1980. Send resume and letter of application Ill/Ii to Dr. Geor~ Wuori Dean o Admissions, Chase all, Wilkes College. · : :1111 ililli ~:tttttt=:=It:=:=:=:=:=:=:=:=Ii=i=trrr:rttittrrrrtI:::fftttttttttt~ ~~~~ It .., office of treasurer. Rooney was the only one to accept the nomination and he won the election with 20 votes. Al Wirkman was elected to the.of. fice of corresponding secretary. Peggy Butchkavitz, Elaine Kerchusky, Carol Benek, and Theresa Gabana were also nominated for the office, but they declined the nomination. Galli announced that the position of parliamentarian will be decided by appointment this week. Also, chairpeople will be appointed for all of the SG committees. Committee Reports In other business, sophomore representative,Ana Nunez noted that the Academic Standards Committee passed a proposal regarding academic probation and involvement in extracurricular activities. According to the proposal, "Any student placed on academic probation, as defined in the College Bulletin will be ineligible to hold student governmental office, work· on College publications, participate · in College sponsored intercollegiate activites, or hold a position of authority or responsibility on campus." The proposal will go before the full faculty for final approval at the next faculty meeting, and, if passed, will take effect one year after the beginning of the fall semester. Under other committee reports, the social committee announced that a certification from the United States Olympic Committee in appreciation of the $440 donated by the Winter Weekend Committee has been received by SG. The certificate will be framed and placed - in the trophy case in the gym. It was also announced that the · Sophomore class will sponsor a roller skating party tonight at Roller King in Kingston. Also, they will show the movie "Night of the Living Dead" on the last day of classes, Tuesday, April 29 at midnight. Both events will be funded through the remaining money in the Sophomore class treasury. In other business, a vote of con-=fidence was given to begin planning for another Hershey Park Day for next year. Also, last week, a vote of confidence was given to Dave Blumfield to look into the possibility of having a student seated on the Board of Trustees. Galli closed the meeting by offering congratulations to those elected to the executive council of SG. He noted that he is looking forward to working with them, and he asked that everyone take a bigger part in discussions at meetings. Louis Czachor Donna Lever 22-E ml GRONTKOWSKI !Iii ~;~~~~?~;: DISTRICT DELEGATE ~~~~7·:6~~:~~· i ~,Q>~tQ>~ �Page 4, 'lbe Beacon, April 17, li80 eo·ed Housing? The Inter-Dormitory Council had been working on the possibility of coed housing for next year. Former IDC president Mike Stapleton investigated and researched the issue extensively. He wrote to several colleges that are comparable to Wilkes seeking information and read much material on the issue. A report, not a proposal, was drafted and presented to the administration for consideration. It had passed through several channels and was receiving favorable re.action. IDC has learned, however, that there will be no coed housing next year. Someone had killed the idea. Coed Housing used to be a controversial subject but it has become more and more accepted today. The reason is simple, many college administrations realize that the benefits far outweigh any Uabilities. It is a fact that vandalism in coed dorms decreases significantly. It is a fact that on the average the social maturity level of participants in coedhousingis higher than those who de;> not. It is a fact that students of coed housing learn to respect one another and tend to develop brother-sister relationships. It is a fact that coed housing does not affect grades like many assume. Many administrators of coF leges where coed housing is offered have concluded that living experiences gained through coed housing are very valuable and practical in preparing a student socially for the real world. All these facts are documented in the report that was presented. It was extensive and complete. What IDC was aiming for was an alternative lifestyle. The dorm students could have the option between coed housing or not. If Wilkes did implement-coed housing there would be no guarantee that it would follow along with the trends cited above. The only way to find out is to give it a try. If after a probationary period coed housing 'didn't seem workable for this campus it could be disc-0ntinued. IDC was asking for a chance to prove themselves and they were denied it. We feel this is a grave injustice on the part of the administration. Although we do not know the exact reasons why coed housing will not be offered next year we feel it reflects a very narrow minded attitude. As quoted in the college bulletin, "An educated man seeks truth, for without truth there can be no understanding." The truth about coed housing for this campus can not be understood until it is experienced. Wilkes, like many small colleges,must now compete for high school seniors to keep enrollment up. Coed housing, as an alternative lifestyle, could be a feature that will attract students. Sooner or later the administration will realize this. We hope it won't be too late. Next year the college will lease the local YMCA for 96 additional living units. Estimates have been reported that over 200 students will be living in the Hotel Sterling. The need for a new dorm is growing stronger every day. If construction ever starts for the dorm it should be built with the idea of coed housing .in mind even if no one · cares to think so at the moment. ''Over The Hill Gang'' Club Holds Initial Meeting The "Over the Hill Gang" of Wilkes College bad its first meeting on Thursday, April 9, at 8 p.m. The club was formed for the benefit of those returning to college after being out of school for a few years. Acting officers were elected: Dolores Vida, president; Dennis Hannon, vice president; Barbara Babowicz, Beeretary; and Terry Hincken, treasurer. Dr. Carl Cbarnetsld was appointed as the group's advisor. The next meeting will be on Friday, April 18 at 9 p.m. in SLC 333. Any student or member of the Wilkes College family (faculty, alumni, faculty spouses, employees, etc.) who would be interested in joining Is welcome. Willner Writes ForConcem ToPropertg To The Editor: This letter reflects the comments made by Mr. Raspen In his letter concerning student irresponsibility on campus. I also share his disgust that each member of the college family must contribute to the replacement of a misshappen "sculpture" of a fork and a spoon. Somehow, there are students who like to imitate Uri Geller's feats of telekinetic metal bending but by physical strength, instead of mental powet. (Uri Geller is an exIsraeli parachutist who has the psychic ability to bend keys.) Another phenomenon I am thoroughly disgusted with is the epidemic of glass breakage that is associated with ''Spring Fever." . The main reason I don't care for damage is because the said vandalism is inflicted on property used by students to publicize events on campus, namely the glass covered multi-sided bulletin board outside the cafeteria. Another reason for my latent disgust is the - damage to the glass panel of the SG Bulletin Board outside Chase Hall. In case the students out there didn't know, I am the SG Publicity and Elections Committee Chairman. One of my principal duties is that of posting materials publicizing all-college events. Among the places utilized by the committee are the two bulletin boards I have previously mentioned. Furthermore, students see the senseless need to sprinkle the letters used to publicize these events, as well as putting up stupid and nonsensical messages. 1n short, all I am asking in this last letter to The Beacon is that students top this senseless damage to college property, or "ourproperty." SbepWiHner Class of 1988 SG Rep. and Publici- ty and Elections Committee Chairman NOTICE M. Alexander bas a number of slide cul;es for a Bell & Howell pro- jector which she will give to anyone who can use them. She can be contacted through the Nursing Department. · Campus Commentary LetUsNotRun Away From History One need not sympathize with or condone acts of the fanatical. extremist, religious authority. resurrected in Iran, to understand the wish of the Iranian people to bring the Shah back. How would Americans have felt if, after W.W. II, some country, say Iran. had harbored, for any reason, Hitler? Surely, we would have demanded his return for judgement of his war crimes and genocidal acts. Suppose Russia's (terroristic) security forces infiltrated our government, in the early 70's, and placed King Richard (Nixon) on the throne? Would the indulgent American people, here in the Land of the Free and the Home of the Brave. tolerate such a gross act of injustice and .diplomatic desecration? It is clear that the crimes of the Shah and his secret police against Ira- • nians have been brutal and massive. That the Shah is entitled to medical treatment, like anyone, even if accused or convicted of a crime, is not the issue. The issue is whether he is to be judged for amply documented murders and torture on a large scale. The problem of the United States Government arises from its complicity in these crimes by its reinstallation of the Shah, through the CJ.A.. on his throne in 1953 and by its continued support of him. If there is any doubt that tbe Shah was our boy, the statement of an American diplomat that "we used to run this country" should dispel that doubt. Perhaps, one needs to consider these facts next time you see a 'Free The Hostages' sticker. History makes our current position awkward, not to say hypocritical. If the U.S. really wishes to aid the Shah on humane and medical grounds, let it prove this by taking the following position : Let it propose that the Shah return his massive personal and family fortune, really stolen from the labor of and based on the oppression of the Iranian people, to Iran In full. Let it be distributed to his victims and their families. Also, the Shah (and those individuals who conspired with him l must be brought before an international world court of law, to stand trial for his horrendous criminal acts. The truth must always be given a chance to speak her Peace. The United States would gain in many ways by such a proposal. It would, as honesty requires, acknowledge that the Shah's wealth is ill gotten and was obtained under the patronage and false disguise of the United States. Our country would gain in world opinion and bring strong pressure for the release of the hostages. It would demonstrate that we truly put life above property values, something _not at all evident in our current and past policy in Iran. It would inject at least a minimum of consistency into our position that our current policy towards the Shah is based on purely humanitarian considerations. Each day, J pray for the safe release of the hostages (everywhere l . In addition, I sympathize with, support. and love those Iranians in America, who are being unjustly harassed. These individuals are being wrongly persecuted for the policies of their nation. When I travel to distant lands, I don't want to be held responsible for America's "schizo" foreign policy. Revoking visas, imposing economic sanctions. and breaking diplomatic ties with Iran, fall far short of attempting to achieve world peace. If America can strike big wheat bargains with Russia (our nuclear enemy? l, surely, other avenues of negotiation can be paved in Iran. Consider the converse: If we fall to acknowledge our complicity in the Shah's brutal regime ·through, for example, such a proposal, we associate our present policy with our past policy. If Mr. Carter really wishes to emphasize human rights, let him disassociate himself from the past. Let him acknowledge truth in the best way; by commencing Immediate restitution. In closing, I thank Robin W. Briehl (N.Y. Times - 11-13-79) for contributing much of the information contained within. FRIENDS. Today is the Future: World Peace is within all our grasps if we reach out with our minds. And the beat goes on. Keep the faith y'all. David Clanton i Run-OffElection Today For JDC Vice-President Here are results of the voting held this past Tuesday, Apr! 15, to elect the Executive Council of IDC and the Outstanding Male and Female Senior Dorm Student. Vice-president: Valerie Van Dyke 59 Ivan Sbidlovsky 59 • The nm-off election will be held today in the cafeteria lrom 4: 306:30 p.m. Trealllftl': Andy Haryluck 107 Write-in 6 Rectnlhlg Secretary: Dina Campbell.. 93 Write-in 13 c.rres, 1rdisg Secretary: Cindy Casper 76 Brenda Taylor 31 Write-in 4 Outstanding Senior Male Dorm Student I..arryWalsh 25 Mike Wilson 21 Dave Blumfield 20 Mike Sibilia 19 Shep Willner 18 John ANdrake 18 Oatstarding Female Senior Dorm Stadea& Sue Isaacs Doreen Swiatek Peggy Barletta Sue SUcbanic Jerry Ann Smith Holly Derr 36 27 26 21 14 . 13 ,. forthe Candidate of Your Choice �April 17, 1980, The Beacon, Page 5 r~~~~~~~~~~~~~~~~~~~~~~~~~~, t OpeningReceptionApril·J.9tla . I Yatlco/FOster Art Exhibit t t , ' StudentCenterParty l Folloa,s TalentSlaoa, t t On this Saturday night, the Red & Cross will present its annual varie' ty show in the Irem Temple, on North Franklin Street at 8 p.m. 6 Musical groups, comedy acts and , magic tricks will abound as & amateur performers from local col' leges put their talents on display. The Wilkes segment of the show, which was coordinated through student Government, will feature two , acts from the college as well as a , party in the Conyngham Student & Center afterward. ' The show usually attracts some of the best talent the local colleges have to offer and the competition for the top awards is always close. & Representing Wilkes this year are ' Steve Demko and Storm Feigles who will perform mal!ic tricks and t & ' t t t f & '& ' t 6 , t t t t t ~ Missy Smith who will one of the featured singers of the evening. Besides just these acts from Wilkes, King's, Misericordia, and Luzerne County Community College will also send acts to perform at the show. The party which will be held after the show at 9:30 in the Student Center will feature disc jockeys Rick and Rob and will also have cold cuts and refreshments. Tickets for the party and show will be on sale in the Student Center and the Cafeteria. The first 100 tickets will be sold as a combination ticket, "Two ·for the price of one" at the cost of only $2. All proceeds from the show will benefit the Wyoming ValleyChapteroftheRedCross. Bill Miller l I collegiate crossword t t t t & t ' t It t t t t in the gallery until April 25th; gallery hours will be I p.m. to 6 p.m. daily. Debbie has received the Manuscript Art award and been on the Dean's list three times. Beth is currently pursuing a double major in Art and Elementary Education. SENIOR ART EXHIBIT-Debbie Yatko and Beth Foster will simultaneously show their works in the Conyngham Art Gallery. The combination of their works will include pottery, watercolors, oils, drawings, sculpture, photography, prints and mixed media. The opening reception will be held Saturday, April 19th from 7 p.m. until 10 p.m. The show will be . ~~~~~~~~~~~~~~~~~~~~~~~~~~~ . _Maggie Says- & , & , t -9 Poet W.S. Merwin What's Happening UToReadApr.22 44 48 r Nk Mk ➔- ➔- Wk - The Junior-Senior Dinner Dance will be held this Friday evening, April 18th at the Woodlands. A cocktail hour from 7:30 p.m. until 8:30 p.m. will be held in the " 25th Hour" . A Prime Rib dinner will be served at 8:30 p.m. The band " Cloudburst" will play from 9:30 until 1:30 p.m. There will be a discount cash bar throughout the evening with free beer, wine and soda; drink prices will be approximately $.60 for a standard drink and $1.00 for creme drinks. Tickets will be sold until 2:00 p.m. on Friday afternoon. No tickets will be sold thereafter. Ticket price is~ $25.00 couple. ~ ~ The Theater Department will present "Angel Street" Apnl 17th, 18th and 19th in the Center for the Performing Arts. Curtain time for all performances is 8 p.m. This smash Broadway hit tells the story of the Manningbams of Angel Street in the 19th Century. Two complimentary tickets are available to students, faculty, administration and staff members. More informa~o~ ~~b..:,o~t:~~by callin~the box office. The Red Cross Variety showwillbe held Saturday evening at 8:00 p.m. at the Irem Temple. Wilkes is just one of the local colleges participating in the event. Wilkes will sponsor a Student Center Party in conjunction with the show starting approximately at 9:30 p.m. --------- ~ ~ ~ Debra Yatko and Beth Foster will give their senior art exhibits simultaneously in the Conygbam Art Gallery. Miss Yatko's works will~ include watercolors. oils, drawings, sculptures, photography and prints. Miss Foster's exhibit will show pottery, watercolors, and mixed media. The opening reception will be held Saturday, April 19th from 7 ~ p.m. until 10 p.m. The show will be in the Conyngham Gallery until April 25th and the hours will be 1 p.m. to 6 p.m. daily, . --------- Student recitals during the time period April 17th until April 23rd include: April 17th, John Ralston, trombone recital; April 18th, Cynthia Possemato, organ recital; April 18th, Jayne Grim, soprano, and Scott Thomas, trumpet, 8:15 p.m.; April 19th, Cynthia Possemato, organ . recital, 3:30 p.m. First Presbyterian Church; April 20th, Holly Hogan, soprano, 3:00 p.m.; April 20th, Randall and R 0 ··•-1;· ~erry, piano and ~ voice, 8: 15 p.m.; April 23rd, joint piano •v'-'1tal, Barbara Finkelstein and Charles Hampton 8:15 p.m. All recitals will take place in Gies ~ Recital Hall unless otherwise noted. ~ HP Mk ►M ►► "V ◄H ◄ The Wllk~s College Poetry Series will conclude with Pulitzer prize winning poet W.S. Merwin, who will read from his works at the Dorothy Dickson Darte Center for the Performing Arts on April 22, at 8 p.m. Merwin, who was a resident of Wyoming Valley, is a graduate of Wyoming Seminary. He left the area in 1949 to travel and write. In addition to poetry, Merwin has written numerous articles and scripts for BBC and journals. In 1970 be wrote "The Carrier of Ladders", for which he won the Pulitzer prize in poetry. · Critic Anthony Hecht wrote of him, "His poems are in (in "Carrier") mysterious in the most fundamental and ancient ways that poetry bas always striven for. The mysteries are touching and human but they are also majectic and awful... .... W.S. Merwin is, quite simply a first rate poet." A reception will follow the reading. The public is cordially invited to both reception and reading without charge. NOTICE To all commuter students, positions are a.vailable on Commuter Council for next year. Interested members of next year's sophomore and junior classes should contact any member of,Commuter Council or come to the CC office on the second Door of Weckesser Hall. 52 7 59 ~ Edward Julius, 1978 ACROSS 1 7 13 15 16 Rows of cut gra i n Actress Mason Shav i ng creams Vocalize s Big Eight team (2 . wds. ) 18 Estrange f r om a habit 19 Spanish gold 20 Part of Fred Flintstone phrase 21 Military branch (abbr.) 22 Fastened wi th a pin 26 Map part 27 ·Part of a golf game 29 Smearers 31 Conference with the . enemy 32 Accompany 33 Everything 34 Bout decision 35 cord 38 Fishing nets 41 \~ithout exception (2 wds.) 42 Hemingway, et al. 44 Surmter in Sedan 45 47 48 50 51 52 57 58 59 60 Collegiate CW78- 3 r ing Sympathy' s partner New Testament book Range type Shouts of discovery Cl ass i c TV comedy series (2 wd s. ) Poe gi rl , et al. Name for a te r r i er Born , fi rs t Movie part (2 wds.) DOWN 1 Decelerate 2 Sees the light (2 wds.) 3 National league team 4 Comparison word 5 Amused expression 6 Se 11 out sign 7 Telephone-dial trio 8 From Z 9 Round: Fr. 10 Gym shoe 11 T. Gillis 12 Analyzes 14 Like Los Angeles 15 Tristan ' s beloved 17 Neighbor of Uruguay (abbr.) 22 Heretofore (2 wds . ) 23 Width of a narrow road (2 wds . ) 24 Well-known airline 25 Being evasive 28 Prepare for 30 Fess Parker role 35 Pitcher Paige 36 Make believe 37 Sills 38 Earthquakes 39 Art lover 40 Candle fat 41 One of famous musical group 43 Talked disrespe ctfully 46 Scarlett's closing word 49 Brake part 51 Feed the kitty 53 Ei thers' partners 54 Part of NNP 55 Calendar abbreviation 56 Expression of wondennent. • • • • • • • • • • • • • • • Answers On Page 6 �Page 6, The Beacon, April 17, 1980 Environmental Science Dept. Offers Two Field Courses The Earth and Environmental Sciences Department announces two field courses for the near future. They are part of a series-of trips which started last year in the Pocono Mountains and continued this year at Assateague Island. The first course is a three-week canoe trip. The gorup will launch near the headwaters of the Susquehanna River in upstate New York and dock in Wilkes-Barre, camping on the shores along the way. Major emphasis will be on study of the changing physical and biological properties of the river as it flows through mountains, farm lands, and urbanized areas. The trip is scheduled for August 1-21 at a cost of $275. (including canoe and all supplies, excluding tuition). Mr. Case will lead this three-credit course (E. & E.S.-394). Enrollment is limited to nine. The second course is a 4-day camping and hiking tirp to tbe Tubs, a recently acquired 550-acre nature preserve near Bear Creek. A data package will be created on the area, including information on air and water quality, flora and fauna, geologic history and evolution, and current land use practices. This group effort will culminate in the Music Department Schedules Recitals writing of a park develpoment master plan. The tirp is scheduled for the fall semester break (Oct. 1821) at a cost 01$30. All E. & E.S. Departmental staff will participate (assisted by seniors Mike Stapleton and Kathy Ochs) in this one-credit course (E. & E.S.394). Enrollment is limtied to 25. For further information on either course, contact any faculty member of the Earth and En.vironmental Sciences Department. Answers To Puzzle s w LA 0 w .....t:..:.~~-- ES S LE EL STUDENT RECITALS. April is a busy month in the Music department with most of the student recitals taking place. During the time period of April 17th through April 23rd, there will be seven recitals taking place. Thomas Ralston will give a trombone recital on April 17th at 8: 15 p.m. Jayne Grim and Scott Thomas will hold a joint recital on April 18th at 8:15 p.m. Cynthia Possemato will give an organ recital at the First Presbyterian Church, 97 South Franklin St .. Wilkes-Barre at 3:30 p.m. --- --· -• ---• Joint recital by Pamela Samuelson, mezzo-soprano, and Glenn Ryman, piano starting at 8: 15 p.m. Holly Hogan will give a voice recital on April 20th at 3 p.m. Beverly and Randall Perry will give a joint recital on April 20th at 8:15 p.m. On April 23rd another joint recital with Barbara Finkelstein and Charles Hampton will take place at 8: 15 p.m. All recitals will take place in Gies Recital Hall unless otherwise noted. Siegfried's Second Play, 'Angel Street' Opens To College Audience Tonight Patrick Hamilton's "Angel Street", the third production of the year, will open to the college audience tonight at 8 p.m. The play, originally presented under the title "Gas Light", has proved to be a success in most places that it has been performed. Jay Siegfried will be directing the production ; this is his second for the the year, the first was "When You Comin' Back Red Ryder". The play is basically a mystery thriller in which one of the characters, Mr. Manningham, tries to torture his wife to insanity. The game of mystery begins when a police inspector tries to uncover the convicting evidence on Manningham. Siegfried chose the play for several reasons a few being: the cast is made up of seven characters, relatively small ; the production is set in the 1880's which has given those involved the opportunity to research the time period concerning costumes, set props, and general attitudes expressed at the time. The set is also unusual for the production; this particular type has not be used yet this year, thus adding variety to plays performed this year. The set is a box set which is a three-walled set with an imaginary foruth wall. Because of the nature of the production-a suspence-mystery- the set design, lighting, costumes and such will play an extremely important part in lending to the atmosphere. Siegfried explained that it is the type of Angel Street play that most people think of when they think of plays. A curtain will be used to hide the sets from the audience until the curtain is raised adding to the mystery of the play. The director also felt that the play Is mystery at its best. The play does Is clo~ to the genre of the television series Columbo. Vincent Price at one time played the villain. The main characters of the play are Chris Golanski as "Mr. Manningham," Betsy Keller plays "Mrs. Manningham,' and John Chervak portrays " Inspector Rough'. " Curtain times for the productions will be 8 p.m. on April 17th, 18th and 19th in the Center for the Performing Arts. Wilkes College students are able to obtain 2 free tickets with the tickets being · $1.50 after thereafter. Administration, faculty, staff are given 2 free tickets with the price set at $2.50 thereafter. After tonight's performance the audience is invited to meet the cast and crew In the lounge upstairs. NOTICE Theta Delta Rho Sorority will have a hoagie sale on Thursday April 17th: The cost will be $1.25 and tickets can be secured from any member of the sorority. Pick-up for the hoagies will be in the student center from 11:00 until 1:00 on the 17th. THE VILLIAN. Chris Golanski plays Mr. Manningham, the demonic husband trying to drive bis wife insane in "Angel Street." l I I GOLDEN ACCE NT KE NSINGTON JEUNESSE Thepertectwaytoshow your love when it's for keeps ... A Keepsake diamon d reflects your love in its brilliance and beauty. It's guaranteed perfect in clarity .. .for fine white color ... and precise cut. You can choose no finer diamond ring. · Keepsake® Registered Diamond Rings CARLYLE & Co. Fi11e jewelers si11a 1922 The people keep coming back. American Express, . Visa, Master Card Rings from $200 to $10,000 or our own Custom Charge Plan AcceptGd T rade. Mark Re-1. �April 17, 1980, The Beacon, Page 7 Pi Kappa Delta Tournament·= == =================== Debate Union Captures 28Awards The Wilkes College Debate Union established itself as one of the strongest forensic-debate schools on the east coast this past weekend, while participating in the annual Province of the Colonies (Pi Kappa Delta National Honorary Forensic Society) Tournament. The members of "Kinney Kids" won 28 trophies at this tournament. No school in the history of the Province of the Colonies has ever won that many trophies at one time. Pi Kappa Delta was founded in 1913 and is the largest national honorary forensic-debate fraternity of the United States. The society rotates its toumaments every year - one year it holds a combined national tournament (including schools from all states) and then the following year it holds province tournaments. Pi Kappa Delta has 8 provinces throughout Jhe United States. The Province of The Colonies covers the states from Maine to West Virginia (12 Atlantic states in all). Wilkes has been a member of Pi Kappa Delta for only four years but has firmly established itself as a forensic power with its impressive victory this past week. The Debate Union had represen- tation in all divisions of competition. Working with a very small number of students and a moderate budget Dr. Kinney's debaters and public speakers not only set a tournament record but brought back to the campus a wide variety of awards. The debaters captured the title of Number One School in debate. Fred B.K. Deets won a 4th place overall individual award for his debating skills, with Colleen Gries and Patti Sparlow capturing the 5th place awards. Karen Orlando completed the Wilkes sweep with an overall finish of 6th place. In discussion competition Wilkes was awarded an overall second place. This marked the first time Wilkes has entered this field of tournament competition. Three Wilkes students entered and all three came out with awards. Jon Pliskin won a 4th place overall award for competition. Darlene Schaffer and Norm Witko also received honors. However, it was in the individual public speaking events that Wilkes brought home the ''pot full of gold.'' Colleen Gries, in addition to her debate award, won a second place in extemporaneous competition, a Just bring in your resume and we'll do the rest . Typ.i ng , typesetting , and copying are available along with a choice of typestyles , paper colors and paper we ight s. Stop in or call for m ore information . 37 N. RIVER STR EET WILKES-BARRE , PA . second place in oratory and a third place trophy in informative speaking. Jon Pliskin won, in addition to his discussion award, a 4th place trophy in extemporaneous, a 4th place in impromptu and honors in informative speaking. Fred Deets continued to show his speaking skills from debate and won a trophy for extemporaneous speaking. Davida Roberts walked away with four individual trophies - a 5th place in rhetorical criticism, 3rd place in persuasive oratory, 2nd place in after-dinner speaking, and a 4th place trophy ,tor prose interpretation competition. Darlene Schaffer won a 4th place in rhetorical criticism, honors in prose interpretation competition, and an impressive 2nd place in informative speaking. Norm Witko got honors in prose competition, Patti Sparlow moved into honors in impromptu, and Darrell Lewis secured honors in the field of informative competition. The top speaker at the tournament (out of 100 speakers) was Colleen Gries. Wilkes was edged out of the overall first place team award by one point - first place going to the very large delegation from West Chester State College. With just nine students Wilkes secured the overall second place team award and brought the College to the attention of the entire tournament. Wilkes went into the competition ranked 19th in the East and 10th in the nation. The tournament was co-hosted by Shippensburg State College and York College. The actual tournament was held in York, Pa. In addition to all the award and honors won by the Debate Union another recognition to the College came when Dr. Bradford Kinney was elected to the office of Lieutenant Governor of the Province of the Colonies. Dr. Kinney and Prof. Susan Miskelly (Governor) of Bridgewater State College, Bridgewater, Mass. will be in charge of the development and coordination of forensics-debate activities for the twelve-state area for the next two years. Dr. Kinney was also recognized as the best "twister" at the annual Pi Kappa Delta Dance Contest. To add to their list of victories, Wilkes just two weeks ago received national recognition when Davida Roberts was recognized as a qualifier for competition in the American Forensic Association's Championship Individual Events Tournament. The senior along with her team mates participated in District Seven competition of the AFA at George Mason University, Fairfax, Va. Davida was the qualifier from this tournament for rhetorical criticism and became one of twenty-four to receive a bid to participate in the AF Atourney. The awards won this past week raise the number of awards won by the 1979-80 Debate Union to 58 for the year and overall to 336. Debate and forensics is coached by Dr. Bradford L. Kinney of the Communications Division. NOTICE The Act 101 and E.O.C. programs have invited doctoral candidate Sherryl Garrett, who teaches at the Reading-Study Skills Center at Lehigh, to speak to students on April 22nd at 11:00 a.m. in SLC Room 380. Her topic will be "How to Get Ready for Finals." She'll discuss preparation procedures for finals and test taking. She has made the presentation at several schools including Allentown College. Act 101 and all other students are invited. Notice Anyone wishing to volunteer their services in preparing for the March of Dimes Superwalk scheduled for April ze, 1980, sponsored by the Wilkes College Human Services Committee may do so by contacting Steve Demko, IIZS-5695, ext. 405, or Lynn Patterson, SZ,..9842, ext. 400. 2ndAnnual Visitation Day Held 822-3766 ..---EVER CONSIDER---REAL ESTATE ? Ontu~ ~ m21® POOL REALTY CO. The nation's largest real estate organization invites you to attend out Real Estate CA REER DAYS DURING THE MONTH OF APRIL If you ' ve been curious about r eal estate as a career ••.• get the answers. 1. What's i t REALL Y like to sell r eal estate? 2. How much can I EARN? 3. Will I be M Y OWN BOSS? 4. Do I fill the profile of a SUCCESSFUL sales associate? 5. What kind of TRAININ G do I need? 6. What kind of LISTIN G and SALES aids are available ? HEAR about CENTUR Y 21 real estate training and mass advertisi ng. LEARN why CENTURY 21 is the fastest growing real estate organization in the world. Find out why at CENTURY 21 being a real estate agent is MORE than being a salesperson. F or a private interview, call Leo S. Kopec, Sales Manager . CENTURY 21 POOL REALTY CO. KINGSTON ' DALLAS ----287-1196-----675-2159- . PROSPECTIVE FRESHMEN TOUR THE CAMPUS. This past Sunday was the second annual Visitation Day. The purpose of Visitation Day is to give students an introduction to the college's faculty, administration, student body, facilities and programs. The day began around 9: 15 a.m. with registration in the gym. Robert S. Capin then addressed the students and their families ; they were able to tour the campus and listen to speakers participate in various program happenings around campus. Several faculty members and administrators addressed groups of students on, such topics as "Transfer Policies, " "Academic Standards and Expectations", sli_.e present11tions, and a student personnel panel discussion was open to all freshmen. Members of the faculty and student body were set up in the Stark lobby to answer questions that the students may have. Those clubs and organizations that were present in the lobby were out in full force to acquaint new students; there were quite a few clubs that didn't bother to send representatives. Close to 1000 people were present on the Wilkes campus to guide and introduce the incoming students. More student were present than last year and the Admissions Office considers it a definite success. �Page 8, The Beacon, April 17, 1980 Captures Four Ot,cars • • • • • • • • • • • • • • • • • • • • • • • • • • • • Housing Situation Discussed At IDC ·~~ll That Jazz,, Seen As Brilliant "It's showtime!" - this Is a line used throughout the movie 'All That Jazz' and Is probably most prevalent in the vocabulary of Bob Fosse. Fosse is a well-known choreographer-director on Broadway and has most recently brought his expertise and brilliance to the screen in the interesting and different hit movie "All That Jazz." Fosse has won a Tony Award for his work in his Broadway creation "Dancin" and "All That Jazz" was nominated for nine Academy Awards; the film won four Oscars including Best Art Direction, Best Adaptation Score, Best Costume Design, and Outstandini Film Editing. .These awards alone show the high quality of technical merit · contained in "All That Jazz." "All That Jazz" is largely autobiographical and the character Joe Gideon, played by Roy Scheider, Is a perfect stand-in for Fosse himself. Fosse has written and also directed the film which includes the staging of his own death scene and an actual filming of openheart surgery. Gideon, a writer, choreographer, film director, womanizer, is somewhat like a high-flying moth slowly being drawn to that allconsuming flame. In the film, he never slows down, not even while hospitalzied. Gideon seems to have an obsession with death and to him death has taken the form of a beautiful woman played by Jessica Lange. Death finally calls him ·in the last number, "Bye, Bye Life." Ann Reinking, the dazzling dancer in "Dancin' " turns in a stunning performance and proves herself more than a dancer. The musical numbers in the film are excellent and show Fosse's versatility; they are not only unusual and dazzling · but . are performed with precision pace and rhythm. Whether or not you bring any of Fosse's personal life into the film, you can still enjoy the totality of the film and experience its great scope and dimension. What's vital about the movie musical of Fosse is the driving choreography and Roy Scheider's excellent performance of a director at the end of his rope. NOTICE cl■bs and organizations are asked &o take down their old posters · and sigas from b■Ueti■ boards and All walls. RA Selections Posted Due to the vast number of seniors graduating this year, the largest amount of incoming RA's was selected by the Housing office. Applications for the positions were received at the beginning of the semester, with all applicants undergoing an extensive interviewing selection process. · · Responsibilities of an RA include management and coordination of life in .the dorm facility. Each RA is compensated with free room and board and an unconditional single. 1980-1981 RESIDENT ASSISTANTS NEWR.A.'s Maureen Connolly Paula Devaney · Mary Giblin Susan Harris Cathy Hoferer Maribeth Kofira Chris Lain Deb Macek Peggy Mascelli GeriMcAfee Susan Menapace Gail Powers SueTomalis Janet Vierbuchen Dina Wasilewski MAJOR Nursing Business Ad. Nursing Biology Nursing Nursing Psychology Nursing Business Ad. Nursing Biology Nursing Psychology Nursing Biology Hometown Branchville, N.J. New Providence, N.J. Palermo, N.J. Floram Park. N.J. Taylor. Pa. Sussex, N.J. New Brunswick, N.J. Wilkes-Barre Norristown Mt. Carmel. Pa. Ironia, N.J. Camp Hill, Pa. Bridgewater, N.J. Forest City, Pa. RetumingRA's (female) Beth Hathaway Jane Hibbler Gerry Knopic Gayle Lovering Lisa Prokarym Sandy Tomko Cathy Updike Nursing Nursing English Nursing Accounting Nursing Nursing Syracuse N.Y. Dunmore, Pa. Scotch Plains, N.J. Rockaway, N.J. Old Forge, Pa. Conyngham, Pa. Randolph N.J .. NewRA's (male) Michael Gould John Keating Robert Lewis John Perry Tim Ryan Paul Scalliti Charles Sherman Ivan Shidiovsky Barry Spevak Michael Stapelton Thomas Urosevich Tony Vlahovic SteveVoyce Robert Wallace Chris Woolverton Computer Science Biology Chemistry Biology Psychology Business Ad. Chemistry Biology Accounting Env. Science Chemistry Psychology Biology Biology Biology Brodheadsville.Pa. NewYork,N.Y. Shavertown Endwell, N. Y. Elmhurst,N.Y. Doylestown, Pa. Oswego, N.Y. ColtsNeckN.J. Syracuse, N. Y. Easton, Pa. Hazleton Whitehall, Pa. Simpson, Pa. Cedar Grove, N.J. Trenton, Pa. Psychology Elec. Engineering Accounting Psychology Art Hawley, Pa. Scranton, Pa. Drums.Pa. Ashley, Pa. Westbury, N.Y. Returning RA's (male) James Adams Richard Chapman Steve Demko James Morrissey Chris Reilly would be done by the R.A.'s in each dorm. The Parking Committee will pass out the applications for dorm student parking to each R.A. at the beginning of each semester. The R.A. will also be responsible for informing those people in their dorms who receive stickers. Sibilia also stated that concrete rules for determining which students receive parking sticker will be worked out by the Parking Committee, and included in the me constitution. The Parking committee itself will consist of four me reps and one member of the executive council of me. Nominations and elections for the oustanding male and female senior JDC reps were held at the meeting. In the category of Outstanding Male Rep, Shep Wilner and Mike Sibilia were nominated, and Sibilia won the election. Bobbi Lou Hamilton ran unopposed for Outstanding Female Rep. Sibilia also reminded reps that the elections for all offices of me except for that of president would be on Tues, April 15. On the same day, elections for outstanding senior male and female dorm students would be held. Sibilia also acknowledged the newly-elected ·me president, Janine Tucker. Under advisor's comments, Paul Adams reminded reps that the $50 deposit with the dorm contracts is due on Friday so that dorm students may participate in the room selection process. Adams also stated that any dorm student who is not on the meal plan and who would like to remain off the plan next year must re-submit all the necessary documentation to the Housing Office. MARY KAY POGAR At IDC's Sunday night meeting, run by Vice President Mike Sibilia in the absence of President Mike Stapleton, a lengthy discussion concerning campus housing took place. Housing Director Paul Adams stated that approximately 1100 students will be housed in on and off-campus residence facilities next year. With only 841 on-campus spaces available, many students will have to stay in the Hotel Sterling next year. However, other possibilities are being considered, and some changes are being implemented, such as converting several of the larger single rooms into double rooms. Mike ·Sibilia gave the Parking Committee report, stating that the handling of the applications for parking spaces for dorm students USPSll32.- Ediler-la-Chief Jim Edwards Sports Editor Manap.g Klli&or Eddie White III BillTurcan Op-Ed Editor Margaret Sclioll Copy Editor Patti Sparlow NewsE4k PeterSteve Asst. Op-Ed Editor Aat.News~ Louis Czachor Photographer Bob Gaetano Advertising Mana.;er B■sians Manager Vanessa Martz Sue Freda Circulation Manager Michele Serafin REPORTERS: Cindy Ercolani. Lisa Gurka, Mary Gary Mack, Bill Miller. Rich Non.i,.eim. Ana Nunez. ------------t Kutz, Sue Loveitt, ... Mary Kay Pogar, Darlene SCbaffer, David Stahl. Advisor George Pawlush Panishllall II S. River St. WIikes-Barre, Pa. lllill weekly tluillg die scheel year from September to May except ,_ • - - - perW■ utl ■eaeaer breaks. Eatered as secoad clau postage pull la ---.Barre. SeN f•m ne. 3511 to Tbe Beacea. Wilkes C'ellege, Wlan-Barft. Pa. 11l'1tl. S-Crlptioa rate to DOR-st■dents: S-1 per year. Atlftrtl■lllg nte: SUI per cal■m■ l■ch. . . . . . _ : (717) IZ-1-IGI, •;xt. -173 · Ml Yins esprasetl are tllose el tile i■dividaal writer a■d not necessarily P■Wi■IIN tltlle ........ tltlleallele. Dial ~icial Wilkes Students On~ . HEADLINE~ 33 W. South St. W-B for appointment call 825-4123 Shampoo, haircuts, blowdry $5 College I.D. Required asummerjob: 800-331-1000 Work as a Manpower temporary. Flexible schedules. Good pay. Assignments available in your college town or hometown. Please call, toll free. o~· �April 17, 1980, The Beacon, Page 9 Colonel Netmen Lose First Three; Come Back To Down Juniata After losing its first three matches of the 1980 campaign, the Wilkes College tennis team came back to defeat Juniata College 7-1 at the Ralston Courts on Saturday. Last week the Colonels of Coach Tom Rokita lost a strong Scranton University team by a score of 9-0. The Colonels, however, played remarkably well without the services of first-seeded sophomore Dave Battle. Coach Rokita was forced to alter the lineup therefore the Colonels lost some tough matches they would have probably won had Battle been there. Junior Stan Manoski and freshman Marcus Eckert played tough, smart matches against two of the top college players in the area. Rokita expects the ~am to do much better when the Blue and Gold take on the Royals on April 21. Wilkes then took to the road· for the first time against Susquehanna University. Both teams have a reputation for playing close tough matches. SU had a 4-2 lead going into the double matches. After winning the first two, the Colonels needed only one more match to take the victory. However, the netmen were downed and suffered a 5-4 decision. Shocked and upset over their 0-3 slate, the Colonels let out their frustrations by downing the Indians of Juniata from Huntingdon, Pa. Wilkes took the win with a 7-1score. Under threatening skies and a gusty wind, the team rolled to its initial victory of the 1980 campaign. Gaining points in singles competition were Dave Battle, Mike Hromchak, Stan Manoski, Marcus Chuck Robbins ... BY EDDIE WHITE III TUNING UP, Shown are two members of the tennis team practicing for the upcoming roadtrip. Eckert and Bill Murtagh. Manoski and Eckert, and Barry Sweeto and Murtagh took doubles wins for the Blue and Gold. The Colonels were expected to have an excellent season and beating Juniata may be the last hurdle the Blue and Gold will have to face. Coach Rokita said after the match, "a win is just what this.team needed at this point in the season." DROP-SHOTS: ... Stan Manoski showed his anger by eating six jumbo hamburgs after the Susquehan- THE Wilkes College golf team opened its 1980 campaign with a loss to archrival King's, 408-425. The Colonels then had a triangular involving another archrival, Scranton and Upsala. Scranton defeated Wilkes, 413-433, while the Colonels won by forfeit 39 West Market Street Wilkes-Barre, Pa. 19701 Phone: 822-1333 Free Parking at Hotel Sterling PATRICK-BURKE, Owner '- ~--------·_;I .· ·- ARMY & NAVY 113 South Main St. Downtown Wilkes-Borre HOURS: Doily 10 o.m.-5:30 p.m. Mon. &Thurs. 10o.m.•9 p.m I f!1 :- -J:-ja' -J--- .,.e- na match .. . the Colonels lost EIGHT three-set matches in a row before beating Juniata ... basketball coach Ron Righter made the trip to Susquehanna as a driver ... senior co-captain Biull Murtagh has the highest winning percentage on the team ... Wilkes begins a long road trip against Elizabethtown College on April 19, Scranton April 21, and Albright College Lions April 26. Bob Buchsbaum Golfers Lose: We Accept Master Charge and Visa I Well it's official, I think. President Carter has announced that he will do anything in his power to stop any athletes from going to the Soviet Union to participate in the upcoming summer Olympics. That is one of the few issues we agree on with that old peanut farmer from the south. Still can't figure out how the United States Olympic Committee keeps insisting it is very interested in the American athletes and would like them to participate. They come into the spotlight now, but where were they when Bob Seagren had his poles taken away from him? And where were they when two American sprinters were not told the right time for an event? We agree with Howard Cosen when he says the problem isn't with the president or the athletes themselves, it's with the U.S. Olympic Committee. They better straighten themselves out or we might never be in an Olympics again! You have to admire the stand taken by the greatest lady to ever touch a basketball - Nancy Lieberman. She quit the United States Olympic team saying, she agrees with the president and thinks that we are all Americans first, and athletes second. It took a lot of guts for her to do that, and she should be credited. Now if only a few others would have enough sense to realize what a serious problem this is and back our country. 408-425 To King's SPORTING GOODS COMPANY II I Book and Record Mart I ll S. Main St. WIikes-Barre II I I BOOKS-RECORDS-TAPES 125-4767 Cliff and Monarch Notes over Upsala. Against King's, Coach Schmidt felt the golfers did "better than expected." Copping medalist honors in that meet was King's Bob Rendle with a 76. Colonel captain Mark Lepore followed closely behind with a 77. Rounding out the field for the Colonels were Chris Reilley, Joe Rubbicco, and Karl Blight with 88's and Ray Ward with a 94. In the Scranton meet, Mark Lepore and Scranton's Mike Gonski copped top honors with 80's. The other Wilkes' finishers" were Chris Reilley and Karl Blight at 87, Ray Ward, 88, and Jim Fialko, 91. Wilkes, now 1-2, was to travel Monday to a triangular at FDU also featuring King's. Then on Wednesday they were to meet King's again, in the home opener of this season. I--·------------------.,.---------~~~~~'ii$ii.-t II!! Features: EMERSON'S~ l Thurs. Rolling Rocks I tG d . i Ii ~ ra win i i Sat. Pat Godwin I I ::f=s I ---':~~~t:' ____I L Ji i · __________________________________ . ~ Show begins at 9:30 I_ - I DEN•~=~ROY ~ . ARMY PANTS PAINTER PANTS r:, • .r Tl. D O 1 1 FLANNEL SHIRTS BETWEEN THE WHITE LINES \ J Oil a,. One guy who you might see smiling because of the United States boycott is WBRE-Radio's Joe Gries. Gries told this writer, that if NBC does not cover the Olympics, {and they won't if we don't go ) then the WBRE Metro Intercollegiate Conference {MIC ) dinner will have a topnotch NBC sports personality as its speaker. Hey Joe, if you can't get Al McGuire or Billy Packer, we'll settle for Bob "gibby" Gibbon. The Wilkes baseball team looks like it has regained the great pitching that long-time Colonel followers will remember from the days of Stehle and Kresky. But where has the "lumber company" gone? If anybody knows, please contact Dave Kaschak before he goes bald! The Colonels are just not hitting in the key spots and Kaschak has done everything with the lineup except insert assistant coach Mike Broda and himself in the order. Hey, that's not a bad idea! Former Wilkes College pitching coach Jerry Bavitz, who set the ground-work for the success of the year's Wilkes hurlers, is now head • coach at Nanticoke Area High School. Bavitz,known as the "bear" had his coaching debut last week in a 9-7 loss to .Bishop Hoban.The Trojans are not expected to be that tough this year.but Bavitz's bunch showed they won't be a push-over as they came back against the Argents after being down 9-0 at one time. Former Wilkes College men's basketball coach Rodger Bearde is now head baseball coach at Lake Lehman High School. The Beardmen should have a good year. Remember," "Roger the Dodger" was a bonus baby out of high school, signed by the Pittsburgh Pirates! Our sources say the Colonel cagers next year won't get new uniforms. It figures! Don't you think anybody in the big white castle would realize how embarrassing it is for the team, and the college with those ugly white old home uniforms. They don't care, all they want is their picture in paper. Another source of ours tells us the King's College school paper should be in great shape, sports-wise, next year with Matt Engel leading the way. Matty is a good one, who is.always attending sports events -either at Scranton, Wilkes or King's. Matty reports the Monarchs will be tough to beat next year in basketball as Ed Donohue is hot on the recruiting trail and should come home with some top-notch prospects. We send our best wishes out to a super 1,1thlete in Diane Kendig who this past week earned first-team All-American status. It's a tribute to her, the team and Coach Nancy Roberts who did a super job in her first year of collegiate coaching. New coaches Roberts and Righter have brightened up Weckesser Annex. You have to admire the hard-work of Wilkes women's athletic director Doris Saracino. She's always on the go and is one of the folks we're really going to miss when we leave here in May. Without Doris, the Wilkes women's program would have died. Who's that tanned young "Italian Stallion" walking around the campus? Why its Wilkes football co-captain Carmen "Homer" "Meatball" LoPresto, who just returned from a vacation to the Bahamas. We received some hassle over our comments on Luzinski and Jackson in the last issue. Well the slim-downed Bull blasted a three run homer his first time up this year. If there is a full season, look for the Bull to garner the MVP with 40 homers, 130 rbi's and a .345 average. Reggie . could not do that in a decade. How can you call somebody who has yet to hit .300 in his career, a super-star? Bob Waskiewicz reports that Mount Saint Mary's has recruited two top players and will tough to stop next year in Division II basketball. Jim Phelan does a super job there for the Mounties! �Page 10, The Beacon, April 17, 1980 Colonels Finally Open 1980 Campaign· Believe it or not, since · the last Beacon, the Wilkes College baseball team HAS PLAYED! Yes, our beloved Colonels own a 4-2 overall mark and a 2-1 MAC slate at press time. This does not include Tuesday's non-conference twin-bill with East Stroudsburg State. Today the Blue and Gold will travel to Reading to meet Albright College in a 1:00 doubleheader which will count in the MAC standings. On Saturday, Wilkes will travel to · Doylestown to meet Delaware Valley for two games before returning home on April 21 to host Division II Bloomsburg State in a 2:00 double-heder at Artillery Park. ·And on '«ednesday, April 23, the Blue and Gold will host Scranton University at2:00. After seeing two straight The Colonels then took Its 2-1 overall slate into a MAC doubleheader with Elizabethtown on the road. For the second time this year, the Colonels wasted excellent pitching in a 1-0 opener loss. Soph Dave Taylor was the victim here. Wilkes came back to take the second game 3-2 behind the topnotch hurling of sophomore Steve Swanson and Vlahovic, who record~ ed another save. This past Saturday, the Colonels hosted MAC foe Susquehanna University in what was supposed to be a doubleheader. Well they played 14 innings, but it wasn't two games. The two clubs locked horns a/ in a four and one half hour, 14inning marathon in the opener and never had enough time to play the second game. The Blue and Gold took the game 9-8 behind the offensive play of Morrissey, who had a school record six hits including three singles, two doubles and a homer. He also had two rbi's and three runs scored while catching all 14 frames behind r the plate. Way to go Jim! As if we had to tell you, reliever Vlahovic came on to pick up the victory. Wilkes, behind the hurling of ace DeFelice took a 3-2 lead into the seventh frame (last inning). But SU . tallied three runs in the top of the last with two out and Wilkes was down 5-3. But the Colonels came back to tie the game at 5-5 after seven. Again, Susquehanna took a 7-5 lead in the 13th inning, but Wilkes tied it again. , And then in the 14th, SU took a one-run lead 8-7. Morrissey knocked in Rich Borofski with a single to give Wilkes the win. Borofski had tripled in Brezenski who had walked with the tying run. The Wilkes baseball team is better than its overall mark of 4-2 indicates, but the reason for the close games and two losses it no hitting. The Colonels are not getting the clutch hitting and have left more men on base these six games than almost all of last year. On the other hand, the pitching has been super. The team era is 1.70 and the worst era on the staff is a 3.00. Not too shabby, and to think there are some tough pitchers who have yet to hurl in 1980. Hopefully the offensive attack will pick up and some bench-men will get a shot where others have failed. Remember, if one guy does not do the job, another has to take his place . •••••••••••••••••••••••••••• BOWLING RESULTS •••••••••••••••••••••••••••• 1 Coach Kaschak doubleheaders get rained out, the Colonels finally opened the year with a single game at home against Muhlenberg College. Bolstered by homers by Chris DaRe, Phil Marino and Chick Andrewscavage, the Colonels downed the Mules. Jim Kearney got the win. · Then came a non-conference doubleheader with cross-town rival King's College at the Monarchs' home field in Swoyersville. King's shutout Wilkes 1-0 in the opener, defeating Wilkes ace Carl Defelice. It was the first time in 109 games dating back to 1976 that Wilkes had been shutout. The last time that occurred, Elizabethtown shutdown Gene Domzalski's Colonels 1-0. Wilkes managed only four hits in the opener against King's in a game which typified the Colonels' attack so far in 1980. Where has the "lumber company" gone? The Colonels saved some respect in the nite-cap coming back to win 3-1 over an under-rated King's squad. Big hit for Wilkes was a booming opposite field homer by senior catcher Jim Morrissey. Senior Ken Hodick picked up the win for Wilkes but needed relief help from · sophomore Tony "Sparky" Vlahovic, who has really come on to shine for Wilkes. At press-time, Vlahovic had accumulated two saves, recorded his first career win for a 1-0 slate and owns a era somewhee around 1.50. SuperjobT.V.! Two teams are definitely in the play-offs, while four more are left to fight for the two remaining berths ·as the Wilkes College Mixed League neared the end of the regular season last Friday evening. The Avengers (Lisa Prokarym 442) clinched the Pacific Division pennant by sweeping the EE 's 3-o while the Whippets (Craig Jackson 172460) were able to take only two of three from The Force. Bud's clinched at least a wild-card slot, dspite dropping all three contests to the Mother Brothers (Guy Zehner 199505 ), by virtue-of Poky's losing two of three to the 752 Crew. Bud's magic number for clinching the Atlantic Division remains at two. In the Midwest Division showdown the Aristocrats picked an opportune time to complete their first sweep of the year; led by Ed Salley's excellent 222-574 and Steve Levitski's 510, the Aristocrats humbled the Assorted Nuts to take a two-game lead over those Nuts. STANDINGS: ATLANTIC DIVISION Bud's Compressor & Supply 2-8 Mother Borthers 20-10 Poky's 17-13 752Crew 16-14 Veterans Club I 7-23 MIDWEST DIVISION Aristocrats Assorted Nuts The Force The Pack Good News PACIFIC DIVISION Avengers Whippets EE's Veterans Club II 17-13 15-15 i3-17 10-20 8-22 20-10 16-14 l5-15 14-16 Nukes 13-17 BS'ers 11-19 Others: Bill Petrick 205-575 Jack Kijek 548, Joe Pelchar 539,' John Joseph 203-514, Greg Pypiuk 500. me cured of cancer. Myboss didn't. My boss didn't under· stand that I was healthy again. So I was let go A lot of people are like my boss. They think that everyone dies of cancer. I thought so, too. Until the American Cancer Society, through one of its service and rehabilitation programs. helped me return to a normal life. The ACB also has local Units that help Americans who've never had cancer understand it better. Today. more and more. cancer is a curable disease. Ign9r¥}ce about cancer is curable. too. i-~~.. CARRYING A BIG BAT. Pictured above is Jim Morrissey connectinE! for one of his five record setting hits. BEACON SPORTS QUIZ 1.) When was the first Rose Bowl game played, what two teams participated and what was the final sc:ore? 2.) Who was the winning coach in the fifth Super Bowl? 3.) Name the first team George Mikan played with in pro basketball? 4.) What college or university did George Mikan attend? 5.) Name the only team to win the NIT title and the NCAA title in the same season? 6.) Who coached that team? 7.) This is the only man to be named to the Basketball Hall of Fame twice, as a player and coach? 8.) From 1964 to 1974, UCLA won every NCAA title except one. Who won it that year? 9.) Name the race horse that is the all-time leading money w;nner? 10.) Only two men ever retired as undefeated heavyweight champion. Who are they? 11. Only one boxer in history ever held the heavyweight, lightheavyweight and middleweight titles at different times during his career. Who is he? 12.) Everybody knows Pat O'Brien played the lead in "Knute Rockne - All America." What other famous coach did O'Brien portray and what was the name of the movie. 13.) . Who played Babe Ruth in the "Babe Ruth Story?" 14.) Who played the title role in "Jim Thorpe, All American?" 15.) A lot of pictures have been made about famous athletes with actors playing the part of the sports star. But three famous athletes played themselves in movies about their lives. Who are they? 16. One National League player has hit two grand _slams .in one game. Name him? 17.) Name the only person to have ever been named to both the professional baseball and football hall of fames? 18.) Since 1900 only one team in all of baseball has played the entire season without being shutout. Name that team and the year they were not shutout. 19.) Who hit two homers on the same day he pitched a no-hitter? 20 . .Who was the only quarterback to win the Heisman Trophy as a junior. answers I.) 1902, . Michigan over Stanford 49-0 2.) Don Mccafferty 3.) Chicago American Flames 4.) DePaul University 5.) City College of New York (CCNY), 1950 6.) Nat Holman 7.) John Wooden 8.) 1966 Texas Western 9.) Kelson 10.) Gene Tunney, Rocky Marciano 11.) Bob Fitzsimmons 12.) Frank Cavanaugh in "The Iron Major" 13.) William Bendix 14.) Burt Lancaster 15.) Bob Mathias, Elroy Hirsh, Jackie Robinson 16.) Atlantia Brave Tony Cloninger, July 3, 1966 17.) Robert "Cal" Hubbard 18.) N. Y. Yankees, 1932 19.) Rick Wise, Phillies 20.) Roger Staubach �April 17, 1980, The Beacon, Page 11 LACROSSE TEAM DROPS THREE STRAIGHT; COLONELS HOST UPSALA SATURDAY AT 2 After a strong start, the Wilkes College lacrosse team of Coaches Brian Blesi and Bill Harris is having trouble staying on the winning track. Wilkes started the season with a 5-4 victory over Widener College and reached the 2-0 mark with a Maryland forces returned shortly after to even up the sides. Adams is currently sharing the top scoring position with Rich Modica, a sophomore from Plainview, N.Y. Both have contributed 8 goals and 3 assists for a total of 11 points in MAC contest's. Modica hit f r decisive 11-5 win over Dickinson College. But the past 3 contest's brought bad news for the stickmen and they are currently 2-2 in the Middle Atlantic Conference (MAC > and 2-3 overall. The Blue and Gold was hoping to garner a victory over Western Maryland or FDU Madison to remain in the race for a playoff berth, but fell both times. The Western Maryland match was played before a large cheering section which did a fine job at riling the coach but couldn't shake up the players. The Western Maryland squad withstood the seven-goal Wilkes rally to edge out a 12-11 decision. With the Colonels trailing 11-4 entering the second half, the explosive 7-1 scoring spree wasn't quite good enough. Wilkes had a three man advantage late in the fourth period and was only able to generate one goal with the time running out. Senior Billy Adams, Bethpage, N.Y. found the range with 1:40 remaining, but the the nets three times and assisted once against the Maryland team. Senior Mark Sanfers, West Islip, N.Y. added two goals and an assist while Joe Burnett, a senior from Binghamton, N.Y. found the range once for our Colonels. Goaltender Dave Singer, a junior from Fairlawn, N.Y. turned aside 19 Maryland shots. Also breaking the scoring ranks for the Blue and Gold were Freshmen Larry Buffaloe and Eric Farber, junior co-captain Pete Canine and sophomore John Nordstrom. Buffaloe, a freshman from Hempstead, N.Y. is one of the Colonels quicker players and tallied an assist in the game. Farber, a good attackman from Cherry Hill, N.J. registered a goal, while Canine, and Nordstrom, Whitehouse Station, N.J. each had an assist for the locals. Wilkes didn't have any luck on Saturday either, dropping a 16-4 verdict to FDU Madison on the Wilkes field. Rich Modica registered two Wilkes goals, while Sanders and Adams had one a piece. Burnett added an assist to the Colonel cause. Although Sanders was winning most of the face-offs in the mid-field position, the FDU team was too strong. Wilkes just didn't play up to its potential Saturday as the numerous spectators concluded. Several times the opponent stole the ball from behind and made it look easy. Coach Blesi noted, "I was disappointed at first, but realized we were outweighed in talent against FDU". The FDU stickmen are ranked 15th in the Division III competition, behind Williams College and number 13 Western Maryland. Blesi pointed out that the first period score was 1-0, favor FDU and the half score was 5-2, but our guys really played hard in the first half and ran out of gas in the second. "The defense was tough the first half, with the Pohorely's Glenn and Gregg and freshman phenomena Larry Buffaloe. The Pohorley's, sophomore's from Whitehouse Station, N.Y. are two of the Colonel's big guy's, as Glenn tips the scale at 205 and Gregg is 185. The second mid-field of freshmen Tracy Cloth, Kevin Cavanaugh and Alex Rae have been showing promise and will probably see a lot of action in the future. Also battling for a starting berth is junior Jeff Harper, who is in h1s second yer of lacrosse. The Colonel lacrossemen have brighter day's ahead as the schedule ·is going to get easier as they go on. On Wednesday, Wilkes was slated to travel to Haverford College in an effort to avenge a one goal loss of ayer ago. On Saturday, Upsala College will be in town for a 2 p.m. encounter and the Blue and Gold will have an open date on April 23. Looking ahead, Wilkes is on the road to Swarthmore April 26. Bob Gaetano INTRAMURAL SOFTBALL Softball Team 5-0 Rookie coach Nancy Roberts has ln the first Keystone Junior Colpicked up in softball right where lege game, Farrell blasted three she left off in women's basketball. hits with Shanahan and Yedlock Her women's softball team is off to each chipping in with two safeties a fine 4-0 start behind some ex- apiece. The game was marred by 14 cellent all-round performances. errors, nine · by the visiting "All the girls are playing well," Keystone. Cheryl Frystack picked said Roberts. We're playing as a up her first career collegiate victeam." So far this season the tory In the contest. Wilkes women have trounced BapIn the nite-cap, Dayer led the oftist Bible 35-o; beaten King's 4-0; fense with two hits including a triand Keystone Junior College 13-2 ple. Freshman standout Stacey and 11-1. · Keeley and Karen Johnson along Two freshmen pitchers have with junior Pam Snyder all had two thrown very well for Roberts and hits apiece. company. Linda Dayer has picked The pitching corp has been throwup three of those wins including a ing exceptionally well giving up onone-hitter against King's College. ly nine hits and three runs in the Cheryl Frystack earned the other first four games, for an earned run win over Keystone Junior College. average of under one run a game. Against Baptist Bible, Mary Jean The Colonelettes were expected Farrell, Kareµ Johrison, Pam to meet a rival Misericordia ColSnyder and Joyce Walsh all ac- . lege on Tuesday afternoon. The counted for three hits each. ladles will host Division II power Farrell, ala Lou Brock, added six Bloomsburg State COllege today at stolen bases and three rbi's while 2:00 in a doubleheader at Kirby Johnson chipped In with five rbi's. Park. On April 22, the ladies will Rose Shanahan had two singles travel to Susquehanna University and four runs batted in to aid the of- and on April 24 they will be on the fense. In the King's contest, winn- road at Marywood College for a ing pitcher Dayer had two singles 4:00 start. and two rbi's. Snyder chipped in After a April 26 away twin-bill with two · safeties while Lynn with the Royalettes of Scranton Yedlock contributed two singles University, Wilkes will return to the and a rbi. Johnson and senior slug- friendly confines of Wyoming ger "Sudden Sue" Freda each add-- Valley to host L.C.C.C. on April 28 edaslngletothecause. to3:00. Pass the word, the Wilkes College campus is the home of an AllAmerican. Junior Diane Kendig of the Wilkes women's basketball team was recently named to the first-team Division III All- Gary Mack Junior-Senior D'•nnerD'nnce : -- American squad selected by the - - - - - - - - - - - - - - - - - - • - - - - - - - - - • • • • ~~ricanWomen'sSportsFounda- : Only one other player from the Middle Atlantic Conference earned first &eamJulie honors and that was Juniata's George. Kendig, already the school's alltime leading scored, also earned the MAC's MVP award this year. She led the Wilkes ladies of Coach Nancy Roberts to its best season ever - 1•10. THE BEACON sends its best wishes to a super athlete! -- U .-.-----.... Music: ''Cloudburst'' • - : : ----Discount Cash Bar • --:- April 18, 1980 $25 :-~-------------------------------- !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! : Pocono Downs will hold its first annual "College Night" on Thursday, April %4th. All college student pndacing their 1.D. cards will he admitted free. In addition, there wll he a handicapping contest with all students invited to participate. Prizes will he awarded to the top finishers. PIIIS, music will he provided by t!;e local band, "Two Plus Two," Juing the evening. Pocono Do\. ..s is locattd on Route 315 past the Woodlands. I, - : - Prime Rib - �[=:J ':S"'""\ ~-~\;) 'f'' the◊beacon 1~ Wilkes College Wilkes Barre, Pa. Vol. XXXII No. 24 April 17, 1980 ~t ' , I ~ ~ __ ;~ ) (/ f/J / /;} , -.-==-11 .,'!'Li f0,.1// }'' !) IT'S YOUR DUTY TO '~ esidential Primary April 22nd ~ J .. � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 April 17th Date A point or period of time associated with an event in the lifecycle of the resource 1980 April 17 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/e0166e906b472c9eff5b0aaa7131b3a2.pdf 94475cd47f60e65fab1f580fcde4d66d PDF Text Text .: _GalliSoleC~ndidate ll Removal Of Majors From Diplomas . . • . 1 r.-~.;- cor SG ,Pre••.d- ency 1. Leads SG To Define Students' Rights I .m ! ., §_ :_:-: ~ ,.,. I Nominations for president of Student Government were held this past Monday at the weekly meeting . of SG. Five students were nominated, but Joe Galli was the only one to accept the nomination. The four other students who were nominated but declined are Marla Brodsky, Rob Doty, Ana Nunez, and Mike Stapelton. Before the nominations, SG vicepresident Marla Brodsky read the rules for nominations of officers and the duties and powers of the president. After the meeting, Joe Galli was asked to answer a few questions for The Beacon. Galli commented that he wants to be SG president because he enjoys working with the students and with the administration. He pointed out that he would like to see more interaction between the students and faculty. He added, "I enjoy working for the benefit of students and for the betterment of student life." Galli cited communications as a ::Jl!~S~a~: ':o:::l~~:~· :!: more communication between the representatives and their constituents, so that the reps will be expressing the views of the students, and not necessarily their own individual views. He stated that he would like to see better communication between the executive council and the rest of SG as well as with the student body. In order to help improve communications between SG and the students, Galli hopes to be able to encourage more students to attend the meetings, and he is considering publishing a newsletter. Galli sees the communication gap between the SG body and the administration as the biggest problem concerning the students of the college. Among his other priorities, Galli .lists passing next year's budget with a $60 activity fee included. He noted that the increased fee will allow more availability of funds for campus activities including concerts and other similar events. Also high on his list of priorities is better advisement to studenti; through their faculty advisors. Galli was asked to comment on t~e work done by this year's president, Dave Blumfield. Galli began by saying that Blumfield did an excellent job. "He had to start from the ground base and work upward," commented Galli, and he went on to say that Blumfield did a lot to improve the integrity of SG. He continued by noting that Blumfield has been very authoritative and "he has shown aggression when aggres.sion was needed. ' ' He pointed out that Blumfield's leadership abilities were excellent, {li if._; J: i . ~.. ' , Joe Galli " but at times he was too possessive." He elaborated that by "too possessive" he meant that Blumfield was always talking in !~~~~ ;~ihi~~~1t~~~f:..1!t;: Galli. He also pointed out that Blumfield did not consult with the other officers enough. He explained that many times the officers had not been as well informed as they should have been. The election will be held next Thursday, April 10 in the Student Center from 11 a.m. to 1 p.m. and in the cafeteria from 4 p.m. to 6 p.m. Seniors will be allowed to vote. All students must have their college ID card. Louis Czachor · A heated discussion between nounced that the administration of several SG reps and Advisorthe college has been aware of the Registrar Doris Barker erupted at need for a written form of student Student Government's Monday rights, and the matter will be purnight meeting concerning a prosued during the summer and stuposal to fo~ a committee to look dent input will be used. into student rights, with special Mrs. Barker expressed her opiconsideration of the removal of manion and put an end to the discusjors from diplomas. sion. She said, "As an adMrs. Barker explained that her ministrator I thought that I can reasons for dropping the majors make a decision. It is just too bad are: the diploma will look more att_hat the administration cannot tractive without the major ; upmake a decision at Wilkes." She wards of 80 percent of the colleges then added that her comments may in the country do not put majors on have hurt a lot of people's feelings, the diplomas; and, "the college was but she felt they were necessary. never chartered to give a degree in · Dean Hoover pointed -0ut that anything. It was just chartered to students are represented on -all the give a Bachelor of Arts or Bachelor faculty committees, but just of Science." because .they do not always get Senior representative Ann Cartheir way they cry foul play. dillo commented that the students In other business, the newly get no say in what goes on their elected representatives were prediplomas or in the choice of the sent at the meeting which was the commencement speaker, and it is · first regular meeting after the electo the point where "the seniors feel tion. The reps elected for next year that they are just there {at gradua.... tion) to fill up the chairs." Mrs. Barker responded by saying that the college puts a lot of time and ef~~~th~t:t~::~~tion a nd it is done .1•• Marla Brodsky mentioned that one of the things noted in the evaluation report by the Middle States Association was the lack of any kind of written student rights on campus. After some discussion it was decided that rather than form a committee to focus on the removal of majors from the diplomas, a temporary committee be formed to look into student rights. A motion was made to form such a committee,, and it was put to a vote which passed unanimously. At this point, Dean Hoover an- are: from the class of 1981-Carol Benek, Marla Brodsky, Rob Doty, Joe Galli, Tim Palmer, and Dana Shaffer; from the class of 1982Theresa Gabana, Chris Lain, Pat Murnin, Ana Nunez, and Tom Rooney; and from the class of 1983-Corinna Bender, Peggy Butchkavitz, Chris Fellin, Elaine Kerchusky, Maureen Morrison, and TerryShemo. In an election-related matter, the campaign policy was a mmended by an unanimous vote to curb illegal soliciting. near the ballot box by candidates. The new rule states that there shall be no campaigning or loitering within a 30 foot radius of the ballot box by any candidate or his or her supporters. If any violators are caught, the candidate will be automatically disqualified and will be unable to run for office for a full year or term following the election. Louis Czachor ,,er Stands A Ione In cc Pres. Election Editor's Note: Since Monday afternoon's Commuter Council . meeting John Moffatt has decided not to run for the office of President. According to the CC constitution, the president of CC cannot . hold any other elected office during his term. MoffaU is currently the treasurer of the Class of 1981. He has decided to stay with that post. We are running the interview bet- . ween MoffaU and Bill Miller below to offer some insight into the election._ Nominations For All IDC Offices Held; Pliskin And Tucker Duel For Top Spot · · Nominations for all offices of IDC were held at the IDC meeting on Sunday night. .For the office of president, two people were Janine Tucker His goals for IDC include: bringing nominated, Jon Pliskin and Janine CC and IDC closer, but also increasTucker. ing activities sponsored by IDC Jon is junior business administration major from Cherry Hill, New <Continued on Page2J Jersey. He is a member of the college's forensic team, a student member of the Steering Committee for the upcoming Visitation Day, and a member of the college's bowling league. He has also established a small business of his own on campus-that of selling and delivering the New York Times. While on IDC, Jon has been a member of the Parking Committee and of the Maintenance Committee, of which he is now chairman. He has been an IDC rep for 21h years ; first representing Butler House, and then Slocum11all. When asked why he wanted to be IDC president, Jon stated that he • feels he can do a good job as presiJon Pliskin dent, and that it will be enjoyable. Bill Miller Nominations for Commuter Council President were held on Monday night during the regular meeting of the Council. Nominated for CC President are Bill Miller and John Moffatt. Two questions were asked of each candiate: 1. "How successful was Bill Lewis as CC President" and 2. "What is your political platform." Bill Miller said of Bill Lewis, "I feel that Bill Lewis in his position as Commuter Council President has accomplished many positive features for the Wilkes campus as a whole. The establishment of the Joint Commuter CouncilInterdormitory Council Social Committee, which planned the four major parties by cooperation between the two groups was a major plus . Another positive accomplishment (Continued on Page2) �Page 2, The Beacon, April 3, 1980 • Final BloodDay Plislcin, Tucker, Vie For IDC President Continued from Page l alone ; continuing work on the IDC constitution and continuing development of · the committees. One specific way in which he intends to bring CC and IDC closer is by joining the newly formed IDC Parking Grievance Committee with a similar committee from CC. Jon would also like to have other IDC reps attend CC meetings with the IDC president. Jon feels he is qualified for the office of president in that he understands " the workings and the administration of Wilkes,» due to his work with the New York Times on campus, and through his position as chairman of the Maintenance Committee. He feels he can handle himself vocally because of his experience on the foref!Sic team . Jon also stated, "I feel I relate well to the students." Janine Tucker is a junior business administration major who transferred from Roane State Community College in Tennessee. She has been an IDC rep for one year; fifst as a rep for the Hoterwomen, then as a rep for Weiss Hall. She is a member of the CC-IDC Social Committee and is the chairman of the JDC Pajama Party. In other campus activities, she is a member of the Accounting and Business Club and works in the Admissions Office as a student tour guide for visitors to the campus. Janine decided to run for the office of IDC president for several reasons. She feels it presents an op- portunity she has nC?t yet explored, and she has also noted that there has never been a female IDC president. Some of her specific goals include: putting committee reports given at each meeting in writing so that a record of these reports can be kept; getting the reps more involved, especially the freshmen, who she sees as a major resource for IDC. She would like to see the freshmen get involved and " mature in IDC, and perhaps hold an office as they mature." At a more general level, she would like " to build on the accomplishments of this year.'' Janine feels that one of the qualifications she can cite for the job of president is her experience as both a commuter and a dorm student. While at Roane State Community College, she was a commuter for those two years. She feels that, "I can help the dorm student and the commuter student relate, and I can be more open-minded and understanding. " Having lived in the Hotel Sterling her first semester at Wilkes, she believes she was able to " meet all different kinds of dorm students- I think I get along with almost every kind of personality, arid listen to all complaints." Concening c«Hld housing, both Jon and Janine feel that it is necessary at Wilkes to have this alternate lifestyle available. Both would like to see the Hotel recognized as c«Hld. Jon is also in favor of creating c«Hld housing in Pickering Hall by floors. Janine stated that she is in support of the proposal to make Miner Hall a women's dorm and Sterling Hall a men•s ·dorm for security reasons. When questioned about their impressions of IDC this year, both nominees expressed a positive attitude. Jon stated that IDC " has been fairly active this year," and that the council has accomplished a great deal. Janine believes she has " gotten a lot out of it, " and that it has helped her to become involved in different activities at Wilkes. Nominations for the other offices of IDC were also made at the meeting. For the office of vice president, several reps we re nominated but only two accepted the nominations; Valerie Van Dyke , and Ivan Shidlovsky. Valerie is cur-rently serving as the recording Bobbi Hamilton and Corinna Bender, co-chairpersons of the Cherry Blossom Committeee announced their upcoming schedule of events. On Friday, April 25, there will be a series of games slated for com~ petition as well as· a " Nerd" party to be held from 9 p.m. to 1 a.m. Price for a ticket to the party will 1'fi I I er Uncontested In CC Race Continued from Page 1 ANTONIO'S PIZZA - HAS WILKES BASEB~LL FEVER Grob o Pizzo or o bite to eat while watching the game. • We're right down the -rood1 in the Gateway SUBS-STROMBOLI-SICILIAN . rnone :llHJ•/bbJ or :llm-7bb4 · for advance orders ''._NUMERO UNO" "Oven Fresh" Blood Donor Day is just around the corner. It will be held on Tuesday, April 15th from 10 to 4 in the Wilkes Gym. This will be the third such drive this year. Steve Demko was displeased with the attendance at the other donor days, "Attendance at the last two was poor. There were only 75-100 people who donated at the last donor day. " According to him the number of donors from Wilkes should be much higher. " I'd like to see from 200-225 people donating blood on April 15th." he adds. Demko believes that blood donation is very important, " Blood is in high demand now. These drives are the only way there is to get the needed plasma." He further states, "Anyone who has given blood cannot be refused blood if they are ever in need of it - and they do not have to pay for it. " Cherry Blossom Event Schedule Announced At CC Meeting can of his tenure has been the associahandle complaints about parking tion of Commuter Council with the tickets." National Clearinghouse for ComBesides being concerned with muter Information. These two _ parking, Bill Miller had this to say, specific improvements helped, I "I would like to address the quality feel to make the Commuter Council of commuter life on the whole. By a more intergal part not only of planning such activities as a lunch Wilkes, but of all commuter time coffeehouse, or other imstudents nationwide.'' provements in the Student Center, John Moffatt also spoke in praise we may be able to get more comof Lewis, "Bill Lewis was a very in· muting students involved in camteresting Commuter Council Presipus life. I would also like to condent. He tried to get the Council tinue the trend began this year conmore active this year and overall I cerning more interaction with IDC think he has done an adequate job. on major issues facing all Wilkes Commuter Council and Interstudents. I have seen as chairman dormitory Council are closer this . of the JDC-CC Social Committee year than in the past and I credit how much can be accomplished Bill Lewis with this." when the two groups work When asked what his political together." platform was, Bill Miler had this to When asked what his political say, "If elected to the position of CC platform was, John Moffatt replied, President, I would like to first ad"I will put out a real effort to make dress the problem that most comsure parking stickers will go to muters face everyday, that of park-· those who deserve them. I will coning. By continuing and expanding tinue to try to bring CC and IDC the present services of Park & Lock . closer. I will still sponsor the social coupons and bus tokens, we can events, but I will also try to get the reduce the price of commuting for Council more active on the all students. Another way I feel we academic issues. Commuter Councan help with parking is by the cil should not be strictly a party establishment of a parking organization; it should represent grievance committee, designed to the students on all issues." secretary for IDC, while Ivan has represented the Hotel Men. Andy Haryluk was the only rep to be nominated for the office of treasurer. He is IDC's present treasurer. For the office of recording secretary, Dina Campbell was the only rep_ nominated. She has served as a rep · for the Hotel Women and for Weiss Hall. Cindy Casper, this year's corresponding secretary, is seeking re-election to this position. Since the offices of treasurer, recording secretary and corresponding secretary each have only one nominee, nominations for these offices will remain open. Elections for IDC president will take place on April 10, while elections for all other office will be run on April 15. All officers will assume their positions on April 20. Mary Kay Pogar Elections for Commuter Council President will be next Tuesday, April 8 in the Student Center. Darlene Schaffer NOTICE Joe Knox, President of the Coalition of Independent Colleges and University Students <COPUS) would like to thank everyone for all the help in the writing, phoning and petitioning campaigns. Your help was deeply appreciated. It really did make a difference. be$.50. On Saturday, softball games, a rock jam, a carnival, plays and a block party will head the main events. The fun will conclude on Sunday with the softball finals, swimming competitions and a coffee house. Awards will be given. In unfinished business, it was reported that the Block Party scheduled for April 26 has gained additional support from IDC and SG. Originally, the party was to serve cold cuts, but because of the interest in it, clams will also now be served. In addition to the band, the "Back Mountain Strings" was also suggested to perform. Admission to the Block Party will be free. CC, IDC, SG and the Cherry Blossom Committee will pay the bill. At last week's commuter council elections, the majority of representatives were re-elected. However, there was some confusion centering on a write-in campaign in the class of 1983. According to Bill Lewis, President of the Council, "the (Publicity and Elections) Committee failed to list the votes on the ballot of the write-in campaign. " An investigation by Lewis is ex- peeled. Nominations for Commuter Council President were also held on Monday night. Bill Miller and John Moffatt were nominated. Elections will be held on Tuesday, April 8. The meeting concluded with several reminders. The Red Cross Variety Show will be held April 19 at the Irem Temple. A Student Center Party will follow . Also, Dean Hoover is looking for people who will volunteer to work as graduation ushers. Interested people should contact the Dean's office in Weckesser Hall. Darlene Schaffer Pait Time Modeling for a group of professional artists who have set up a studio in W-8. Must be 18 and available to work for a month . Set up an interview today by sending name, phone and photograph to: P.O. Box 2043 Wilkes-Barre, pa . 18703 ~~ Chuck Robbins ... DECKOU R'S BEER Ph. 822-7045 -Imported Beers-Cold BeerCall in Advance fot Kegs' and Quarlets (Must hove LCB Cord) I .. -~HOP ~ , .,,,. t1 • I ST YLING FOR M;N & WOMEN i • HAIR CO LORING & CONDITIONIN G I ~- • PERMANENT WAVING • HA IR STRAIGHTENING • SCALP L FACIAL TREATMENT •MANICURING• SHOE SHINE CA LL FOR APPOINTMENT - • sS ~~ BA-RBER I( - FRANK--. PETE SARTOIIIO . PROP. a:g~~l:ibG,) MAIN FLOOR §§ I §§ s8 824-2325 ~~ 15 S. fRAt-lWN SL - Wll <ES-BARR[ 39 West Market Street Wilkes-Barre, Pa. 197Q1 ~• S. Main St. Wilkes-Barre Phone: 822-1333 BOOKS-RECORDS-TAPES Free Parking at Hotel Sterling Cliff ond Monarch Notes 825-4767 PATRICK-BURKE, Owner go:~....o-.r..O"".r..,....,.....oc,"''1 -§ BROOK'S § I1S Book and Record Mart We Accept Master Charge and Vis~ Across from Bishop Hoban I COMPANY SPORTING GOODS ~ &,✓.,0-.AO"'"..cGO'"" ...... ~..Q. I' ,.,.... 1. I 10% DISCQUNJ OFF ANY PURCHASE WITH THIS COUPON . . �April 3, 1980, The Beacon, Page 3 Mr. Galli ,s Presidential Platform Deans' Secretary, Peggy Jones; Bright Spot In Weckesser Hall NAME: Joe Galli HOMETOWN: Peckville, PA. CLASS : 1981 DEGREE: B.S., Accounting CUM : 2.86 S.G. EXPERIENCE: If you are ever driving down South Goodwin Avenue in Kingston and see a sprightly figure on the roof of one of the houses replacing the tiles, it would most probably be our own Peggy Jones, secretary to Deans Hoover and Ralston. A secretary who is also a part time roofer? "Sure, I also do all my carpentry and fixing around the house," adds Peggy with a laugh. "I really like to take care of my house and do the housework. I am my own contractor." Beside just the usual household chores, Peggy also cans fruits and vegetables and has also put in the concrete steps on her front porch. Peggy goes on to add, "I like to keep myself busy at home and at work." She is busy at her job, being a comb~ation receptionist and secretary for the two deans, which means she sees on the average about 50 male students a day. This is certainly a job any woman would love. In fact when asked what she enjoys most about her job, her immediate response was, "The guys!" as she roared into laughter. Continuing in a more serious vein, "I enjoy talking with the students and listening to their problems and their stories." It is clear from the number of students who are by her desk as one usually passes, the feeling on the part of the students is the same. "There are some kids that Student Government Representative for 3 years, Chairman of Publicity and Elections committee for 1 year, Student Government Treasurer for 1 year, Freshman Orientation Staff for 2 years, S.G. Representative for Student Union Board for 1 year, Student Government Florida Trip Coordinator for 1 year, S.G. Representative for Faculty Committee for 1 year, S.G. Representative on Steering Committee for Visitation Day for 1 year, S.G. Executive Council member for 1 year. PLATFORM: ~ I. Greater communication between Student Government and the Student Body A) Better Publicity 1) Centralized bulletin board on campus where all upcoming events can be publicized. 2) Bimonthly newsletter to be printed by Publicity and Elections Committee and the Corresponding Secretary of S.G. B) Apartment Council 1) Help students find apartments -2) Help students with any problems arising from apartments 3 ) Keep better communications between on/off campus students II. Social A) Create Travel <;,ommittee in order for students to take advantage of special student rates over breaks and holidays. B) Increase outdoor activities by working through Commuter Council and Inter-Dormitory Council. Such activities can be Old Fashion New England Clambakes and outdoor Variety Niles and the revival of block parties. III. Academic A) Provide better counseling (faculty advisors ) for students by working with the Dean of Academic Affairs. B) Better departmental communications between students and faculty outside of the classroom. 1) Informal gatherings of students and faculties within each department. 2) Students and Faculty from each department competing against other departments in competitive events. C) S.G. Academic Committee working with Placement office in providing seminars for students in each respective major using recent alumni of Wilkes College to discuss with student what they can expect after college. IV. Financial · A) Increase student Activities Fee 1) Promote at least one concert a semester 2) Increase all budgets, ailowing more money for more clubs and organizations to promote student activities. Peggy come to see the dean with a problem and end up getting advice from me and then leaving." In fact their are some students who come just to talk to Peggy. Another group of students that are often in the office to consult with Dean Ralston are the foreign students. "I listen to Uieir problems especially and try to understand their difficulties." She obviously has become more than just a LD. C. President Proposes George Elliot Memorial Give the Gift of Life BLOOD DONORDAY 10-4 in the Wilkes College Gym Api:1115 PLEASE GIVE YOUR SHARE Januzzi's Pizza and Hoagies 125 Academy Street Home Delivery OPEN 7 DAYS 11-1 IDC President Mike Stapleton proposed that IDC place a plaque in the IDC office in memory of Professor of Economics, George Elliot, who died recently. Stapleton noted that Professor Elliot had been instrumental in forming IDC. It was also decided that IDC would donate some money to the scholarship fund that was established in Professor Elliot's name. Visitation Day for prospective freshmen at Wilkes is coming up on April 13. The IDC reps were reminded that the lunch line would close at 12:00 instead of at 12:30 on that day. Stapleton stated that there would be an IDC booth set up on campus for Visitation Day, and that help was needed to man the booth. Under committee reports, the upcoming IDC pajama party in the Student Center was discussed briefly. It was reported th at th e request form for the party had been turned in, but the exact date of the party was still not settled.The party will take place on April 1112. In other business, Housing Director Paul Adams a~~unced that the ~orms would offlc1ally close for lllYi.Ur i1Jr -_--------·-,' 1 I I t I I ·- I I I I 113 South Main St. i I Downtown Wilkes-Barre I I I I l 'I r _,. ! ► Cd I •llaV ~ I - .[11lrtll]llf1flf1iS r.r1[1 SIJSiflrtlS , See Joe, Bob, and Danny MON.-THURS. 11 A.M.-9 P.M. TUES., WED., FRI. & SAT. 11 :00 A.M.-5:30 P.M. 288-3751 I Jones secretary to many of these students. While I was talking to her, in fact, one of the foreign students invited her to his wedding this summer. Peggy, who has been working at the deans office for thirteen years now, says her goal in her job is to "be a good secretary." Did she ever want to be a dean? "That would be fun! I think I would really enjoy that but I enjoy the contact I have with students now a great deal too." In the past thirteen years, however, the students have changed according to Peggy. "Today students have goals and are here to work toward accomplishing them." When she began at the school, however, the students had a different attitude. "T.he kids back then were basically unsettled. They wanted change and in many instances they got it." She noted as an example the open housing policy which students in the sixties fought for and received. Peggy Jones, then, has become much more to the students at Wilkes than just a receptionist in the deans office or a secretary, she has become a friend. We all hope that we will see her smiling face behind the desk on the second floor of Weckesser Hall for a long time to come. Bill Miller 'J ..-, HOURS: 0a;1y 10 o.m.-s::io p.m. Mon. &Thurs. 10o.m.-9p.m Easter vacation on Friday, April 4 at noon, and would re-open on Monday, April 7 at noon. Adams also stated that room selection for all dorm students would ,take place from April 21-24. The $50 dorm deposit must be in before a student may participate in the room selection process. It was also announced that R.A. selections have been made, and the letters informing applicants of their selection for the position will be mailed this Thursday to the students' home. Nominations for all offices on IDC took place at Sunday night's meeting. The election for the office of president will be run on Thurs- , day, April 10. Elections for all other offices will take place on Tuesday, April 15. (See related story ) Mary Kay Pogar · NOTICE Class of 1981 Executive Council applications are available in the library, Student Center, and Bookstore. Applicants are asked to submit applications after Easter Break. Drop them off at the S.G. office. ~.. 1r----EiiERsoFs;;;-1 I \ Featu~es. Thurs. Phil Pilorz \ i :::~:RA:I:rs5 tI Fri. PAT GOD WIN ~ (~~~~1~ II 1i ~ ~ Sat. Pete Schaumloffel j \ DEN1M-coRDu10,- -PLus- FLA~NEL SHIRTS BoutiqueFashio_ nsAt Army-Navy Prices \ • \ ~ a, Show begins at 9·30 i\ IL • . ..,.,...,.....,....__.....,....,...................................................................................,.......................~___... ~,.._..~.,_,.~.._.. ..... ~ .....,.,_;s 06 �Page 4, The Beacon, April 3, 1980 AsWeSeelt Student Government President Joe Galli Inter-Dormitory Council President Janine Tucker Commuter Council President Bill Miller The selection of student leaders will take plac_e next week. The presidencies of Student Government, InterDormitory Council, and Commuter Council are up for grabs. Each post offers a full-tuition scholarship, yet for the three offices only four candidates emerged. From SG, Joe Galli is the sole nominee for president. He is the most knowledgable and experienced member on SG to run for the office but it shouldn't just be handed to him. We would like to see him go through a tough campaign and win. It would make his election more meaningful ... as if he cwed the students something in return. At present Galli is not obligated to make one promise and could very easily skate through next year. With his respect for SG and ability to assume responsibility, Galli will most likely not take this route. We expect him to improve upon SG's activities where outgoing president Dave Blumfield left off. Janine Tucker and Jon Pliskin offer the only competition as they run for the top spot of IDC. This will be the first time in three years that IDC has nominated more than one candidate. IDC is a social planning organization that also deals with some policies concerning dorm life. The controversial issues are limited, but "touchy" subjects are often discussed. IDC is basically a forum for opinions and suggestions of dorm students. The president of IDC must be one who will command the respect of the executive council and the dorm representatives. He or she does not necessarily have to be opinionated but rather organized and effective. We feel Tucker best suits that qualification and will be an excellent leader. Even though she is a transfer student of one year, Tucker has adapted to the campus very nicely. The contest between Bill Miller and John Moffatt for the CC presidency had been one that many commuters were looking forward to. Both are excellent candidates and it was anticipated to be a very close race. Moffatt, however, has withdrawn. Since he is not allowed to hold the office of CC president and a class office simultaneously, he has · opted to stay with the Class of 1981 treasurer position. Like IDC, CC is , primarily a social planning organization with some authority concerning commuter student policies. Although we felt that Moffatt may have been a stronger leader over Miller, we are very confident that Miller will do excellent work next year. He is enthusiastic, organized, and sincere in his efforts to help create a better social atmosphere for the college as a whole. The combination of Galli, Tucker, and Miller looks like a good one and may be the best trio put together in the recent history of the three organizations. Vote Galli, Tucker, and Miller. Volunteers Still Needed For Visitation Day To the Editor: The next meeting for students involved in Visitation Day will be on Thursday, April loth at 11 : 00 in Stark. Visitation Day is less than 2 weeks away but there is still time left for you to volunteer to participate in this program. Over 500 people will be coming on campus on Sunday April 13th and students will be needed to direct our visitors to available parking facilities on campus. If you are interested, please attend the next student meeting or contact me in the Admissions Office. Debra B. Stratton Assistant Dean of Admissions Theof}ald Answers Hartdagen ,s ·Letter Reg~rding Controversial Diploma Issue To the Editor: To Dr. Hartdagen: In response to the article appearing in last week's BEACON concerning the "Major" problem, I am replying for a majority of the Class of 1980. According to the letter, the addition of double majors or double degrees (Bachelor of Science and Bachelor of Arts) threatens to turn the diploma into a second transcript. Double majors have appeared on the diploma before without the diploma turning into a second transcript, so this should not be any more of a threat this year. Very few, if any, students from the Class of 1980 will receive a Bachelor of Science and a Bachelor of Arts Degree therefore this should not be a reason to deny the Class of 1980 the opportunity of having their majors listed on their diplomas. The technical problem mentioned in the letter has been solved for the past eight years by placing the major on a separate line below the degree on the diploma. Our concern is the "Major" and not the "Minors" since minors do not exist for us and therefore are not our concern and should be dealt with next year. Just because the majority of the colleges and· universities do not print the major on the diploma doesn't mean that Wilkes must follow in their footsteps . Since when does Wilkes have to keep up with the Jones'? By removing the majors from the diploma we are now Pliskin Promises like all the other colleges, but I was always lead to believe that Wilkes was better than the rest. I hold pride in this institution and am honored to receive a diploma from Wilkes College. Because I have worked hard for four years, I am proud of my work and I feel I deserve the honor of receiving my diploma with my major concentration included on it. Even though in the future it may be a dust collector, right now it is important to me · that my major is stated on my diploma. Susan L. Theobald President of the Class of 1980 Campus Commentary Jogging Eases The Mind Boring, painful, time-consuming, strenuous, uncomfortable, laborious, foolish , pointless : These are all adjectives which I formerly used to describe jogging. I believed that all joggers were a masochistic, elite group of physical fitness snobs who thumbed their noses at the rest of the nonrunning world. Ask yourself, who in their right would leave the comfort of their air-conditioned room to go out into a hot, humid world to sweat, risk injury, and endure cruciating pain? However, over the years my attitudes towards running and joggers has drastically changed as I have discovered a new way of looking at and appreciating jogging. It seems self-evident that the quality of one's own life is determined by the state of one's health. It is true that joggers are a different breed of people, but they are people who place a high value (priceless) on life and health. When I stopped looking at jogging as a chore, and began to perceive both the physical and spiritual benefits I could derive from it, that became the turning point at which I began to enjoy jogging. When I run (but can't hide ), my body and my environment are in complete harmony. Both my self and environmental awareness are heightened to almost overwhelming levels. There is an energy exchange : nature to runner+ runenr to Nature; it is the rare world of direct experience. Pain is an integral part of this total experience, but the runner learns to recognize (Identify) and understand his pains. He knows which ones are warning lights and which ones are challenges. Whereas the runner is free, the man who drinks beer and watches television all day is enslaved by his fear of• physical discomfort. I get more satisfaction from bettering my own (individual) performances than from beating others. To put it simply, running just keeps me going and gets me out of my bad moods. Jogging makes me feel good to be alive and healthy. To me, there is not a better feeling in the world than to realize I am doing some things which benefits both my body and mind. · David A. Clanton Improved JDC USPS 1132-01141 Editor-In-Chief Jim Edwards If Elected Pres. To the Editor: To All Dormitory Students: As the dorm population expands, the Inter-Dormitory Council is beginning to expand its role in campus life. Food, Social, Maintenance, and Parking committees are being added to the constitution of IDC. The purpose of these committees is two fold: One, to inform the administration of student views, and two, ~ help plan and sponsor more student activities. The only way IDC will be able to achieve its goal of expansion is to have a president who can pull these committees together into one grQup and lead this group, called IDC, into a more active role in the student life here at Wilkes. I feel sure that I am capable of doing this. As Maintenance chairman of IDC and student member of the Steering Committee for Visitation Day scheduled for Sunday, April 13th, I have learned not only how to organize ideas and committees, but I've also learned the proper channels which ensure the reality of those ideas. Help IDC expand its role in campus life by electing me president on Thursday, April 10. Sincerely, Jon Pliskin Sports 1<:ditor Managing F.ditor BillTurcan Eddie White III Copy Editor NewsE4itor Patti Sparlow Peter Steve Op-Ed Editor Margaret Scholl Asst. Op-Ed Editor Ant. News Edi&or Louis Czachor J>botographer Bob Gaetano Advertising Mana.;er Vanessa Martz Business Manager Sue Freda Circulation Manager Michele Serafin REPORTERS: Cindy Ercolani. Lisa Gurka, Mary Kutz. Sue Loveltt, Gary Mack, Bill Miller, Rich NordJ)eim. Ana Nunez. Mary Kay Pogar. ·Darlene Schaffer, David Stahl. Advisor George Pawlush Parrish Hall lfi S. River St. Wilkes-Barre, Pa. 18716 PIIIIUslaed weekly during the school year from September te May except f• vacatioll periods and semester breaks. Entered as secoud class postage paid ID Wilkes-Barre. Send form no. 357' to The Beacon. Wilkes Cellege, WIikes-Barre. Pa. Ul7M. Sultscription rate to DOR-stlldents: $-1 per year. Advenisillg rate: sz.so per columa lach. · Phoae: (717) 112U'51, Ext. -173 · · All views expressed are those of the individual writer and not necessarily el &lie pnUcatiell el tlae colJete. �April 3, 1980, The Beacon, Page 5 Upset Senior Will Refuse To Graduate If Majors Do Not Appear On Diplomas To the Editor: Bargain Days in Wilkes-Barre! What is it this time? Picture this : For sale-a college degree. Price-cheap. Only $20,000. No major required. Sounds good, doesn't It? Look no further, my friends, because if you are a student here at this fine institute of higher learning, that's what you've already bought for yourself. Just think how much money they'd save in admissions, and how much time you'd save In filling out an application that eliminated the page of fields of interest or majors? It would have saved me time, and perhaps money. As a matter of fact, the present $15 fee required of the applicant could be cut in half, as our diplomas are. I'm not only · disappointed but upset by the fact that the theory that an institute exists is to provide careers for the faculty, and not for the purpose of educating the studeljs is coming true. One . goes through high school either to prepare oneself for a chance to better oneself by enrolling in an institute .that will provide one with the tools necessary to become a functional part of society, or to prepare one with only the necessities. I chose the road that would give me these tools. I guess I took the wrong exit. Maybe I should · have turned the corner a long time ago. The journey through high school was long, but once I had that diploma in my hands I knew I was ready to embark on another. Wrell, the road I am travelling on is quickly coming to an end, but at this point in time, someone put up a dead end sign because I'll have a degree, but will have lost direction. Maybe I ought to have tried Hare Krishna. I wonder if they issue majors. I came here four years ago when the fee to apply was $10. I was unsure of what the future would hold, but was informed that, as long as I declared a major by my junior year, I'd be fine. I did what was asked of me; as a matter of fact, I changed my major; but c!,fter four years of hard-work, all-nighters, final exams and $20,000, them item I really value is being denied.· Call me naive, but as a student, I assumed that If I had concern about the school I wanted to express they would listen. Listen? Maybe I waited until it was too late, but I'm expressing a concern that is not only mine, but that of many students. The purpose of this letter is not to show my disrespect for the administration and faculty, but, at the same time, I feel that is what they have shown us. Being a resident assistant, I am in some respects considered a part of the administration, but I am also a student. For every job there is a certain amount of sacrifice that is required. What I won't sacrifice are my rights. The other members of the administration already have their diplomas. I do not. The purpose of this letter is to point out to you that, as. students, we do have certain rights, but nowhere are they written down. We aren't demanding that much, only a voice, a chance to really be li~tened to, not just heard like a voice in the night. A decision was made with almost no student input, yet without students, where would this school be? Not on the map, that's for sure. Removal of the majors from diplomas would have gon unnoticed, or so they thougilt. Doesn't say too much for their. opinions of us. ·After all, .they're not their diplomas, they're ours. That piece of pa~r. or whatever part of graduation we value is worth at least $20,000. Look, what I am saying is that maybe you don't value your diploma as much as I do. lf your preference Is the ceremony, the cap or gown, fine. That's your right. I want that diploma and I Heavyweight Bob Matzelle Cites His B-Day Greetings want to be able to reserve the right to have what I want written on that piece of paper. It should be the students' choice! You have my money; do you want my diploma too? I have my education, that can't be denied me. A degree to me, is a st~p up. The major tells what step that direction took. We are not asking for it to be written in Latin or Greek. Despite what other colleges have written on their diplomas, I will refuse to leave this school without my major on mine. To The Editor; I would like to send this message out to all those people who attended my birthday party on Saturday, March 29th: 1-1 am begging the person who stole my dog's leash to please return it. 2-To the person who stole several hairbrushes and combs from my bathroom! May you become a Telly Savalas look-a-like on your 24th birthday. 3-To the person who stole my aftershave lotion, I hope you break Sue Suchanic CC Presidential Candidate Seeks Support To the Editor, On April 10th, commuting -students will have a chance-to elect the new president of Commuter Council. This is a very important choice and I am encouraging all commuters to vote and become involved in school activities, of which Commuter Council is a vital part. As a candidate for the office of president of Commuter Council, I would like to explain to you the plans I have made for the next year if I am elected. First of all I believe the biggest problem facing all commuters is that of parking. Since the number of on-campus spaces are severly limited, I will try next year to make sure that all available spaces on campus lots are being properly used and attempt to get more spaces allocated for the students. Another proposal which with the help of Inter-Dormitory Council is already ·in the planning stages, is a parking grievance committee. This committee will handle compla~ts from have seen how much can be productively accomplished if the two groups work together. Next year, I feel we can do even more in the areas of parking as well as the planning of parties. So when next Thursday arrives, I encourage you to vote. Expressing your opinion on campus affairs is best done through the ballot box. I am also asking for your support of my ideas and my candidacy. Together we can accomplish much. students about tickets received on campus lots which the student may feel are a mistake. In addition to these programs the continuation and expansion of the Park and Lock program and the selling of bus tokens by Commuter Council will be key ways we. can help the day student keep his costs of commuting down. Yet beyond just the p~king issue, I feel Commuter Council must provide activities which will encourage more students to be active on campus. By providing parties ori weekend breaks and activities such as coffee houses during activity periods we will be able hopefully to get more commuter students Involved in what is going on here at Wilkes. Another key area which I feel is important is cooperation between two major student governing bodies on the Wilkes .campus, Commuter Council and Inter-Dormitory Council. This year as chairman of the joint CC-IDC social committee I Bill Miller Tucker Lists Qualifications For JDC Pres. ~-~ ~hi;,~~;;~:~i~;i ~ ~ · Currently on display in the Sordoni A~ Gall~ry is the_exhibit "Th~ee American Women," sponsored by the Jumor League of Wilkes-Barre. The show will remain in the Gall~: ~n~l~~~2~h. A Choral and Orchestral Concert, directed by Dr. Terrance Anderson and Herbert Garber will be presented on April 13th at 3:30 p.m. at St. nstephen's Episcopal Church, South Franklin Street. · nuntil April 4th. Uguests ~he Chestnut Brass, a versatile and acclaimed ensemble will perform as of the Concert a~d Lecture Series, April 9th at 8 p.m. in the Center ~ for the Performing Arts. · -------. . A Senior Art Exhibit by Rosemary Mcmahon will be on display in the ~ Conyngham Art Gallery from April 12th-18th. The opening reception is set for Saturday 8-10 p.m. Gallery hours for the show are Sunday .1-5 p.m.; Monday-Friday 5-9 p.m. ______ _ n U Upcoming music student recitals include: Pamuela Samuelson, April th at 8:15 p.m. in Gies Recital Hall; and a joint recital with Jessica + ◄► ◄► ►+ Mk H,. tively involved as the InterDormitory Council representative. For the first semester, I was a rep for the Hotel Women. Presently, I am .serving as a rep for Weiss Hall. Currently, I am chairing the upcoming Pajama Party that is to be held at the Student Union Building, and am serving on the Executive Council for the Cherry Blossom Committee. I am also·a member of the CC-IDC Social Committee, which is involved with · planning social functions for the two organizations. I recently worked with the Executive Council and others in revising the IDC constitution. Three goals that I want to emphasize as IDC President are: (1> more dorm interaction, (2) plan a variety of social activities, and (3) to increase the dorm student's interest in IDC. By being actively involved with .me this year, I feel I have the necessary experience needed for the office of IDC president. On Thursday, April 10, you as residents of Wilkes will vote for the Inter-Dormitory Council President for 1980-81. I encourage each one of you to come out and participate in these elections. · n U U The works of Karen Orlosk~~l~~o~ ;s;lay in the Conyngham gallery wiatkowski and Edward Shulde on April 16th at 8:15 in Gies Rectial Hall. To the Editor: To All Dormitory Students : For the past year, I have been ac- Sincerely, Janine Tucker out in rashes for life. 4-To the person who stole my bottle of champagne, a gift, I hope you became violently ill and experienced agonizing dry heaves. 5--To the persori who doesn't have enough common sense to know better than to sit on the glass topped table, I'm sorry you dldn'~get glass splinters in your rectum. 6-To all U.e people who think walls and carpets were made to put cigarettes out on, I hope someone dumps a truck load of garbage in your house. 7-To the people that think guests are allowed to pilfer through a host's closets, cupboards and dressers. May you one day put your hand in a bear trap. 8-To the person who vomited in my bedroom, may you climb into your bed one night and find 10 pounds of elephant feces under your blankets. 9-To the people who do not have enough decency to offer a donation for an overly generous supply of beer, may you expire by having your life support unit shut down in order for medical personnel to place bets on when you will kick off. l~To the people who were just plain rude, inconsiderate and won down right inhospitable, may your mother treat you like this over Easter Break. In these times of dynamic social change, it is enough of a challenge . to make and keep a good friend. Last Saturday, March 29th, shattered the confidence that I've acquired in people for two score and 4 years of existence. I must now pickup the pieces and revise my entire philosophy of life. So now, if you see me walking around campus with a look of distress, it is because I am scared: I DON'T KNOW WHO IN THE HELL MY FRIENDS ARE ! So now I graduate in May believing that the students of Wilkes are just as savage and uncivilized as the inhabitants of the Bronx Zoo! With My Broken _ Heavyweight Heart, Bob Matzelle April 13 Brunch Will Close Early Due To Visit. Day To the Editor: To All dorm students: Sunday brunch on April 13th will be held from 10:00 a.m. til 12:00 a.m. The Admissions Office is holding its' -second Visitation Day Program on this day and we would appreciate your co-operation. Over 500 visitors will be having lunch on campus from 1:00 ·til 3: 00 and it is important that the cafeteria is prepared to serve them lunch. I know that this does cause a, slight inconvenience for you, but with your help this program will be another success. In advance, thanks f9r your help. Debra B. Stratton Assistant Dean of Admissions �Page I, The Beacon, April 3, 1980 Ra.penAslcs A Work·Of Art • • • It could be a part of the "I Spy" feature from the comics page Qf the local newspaper; it could be part of an Art major's exhibit; it could be a lot of things, but what it represents is another in what is now a series of articles on the problem of vandalism on campus. In that regard I echo President Blumfield's . remarks and Housing Director While we each enJOY the benefits of this campus Community, we also share the responsibility for meeting the costs of the community. Mr. Blumfield made the point that part of the rising tuition costs are earmarked for the repair or replacement .of vandalized articles ; Mr. Adams t alked about the damage deposit paid by resident. These are CHESTNUT BRASS COMPANY - A few weeks ago the Concert and Lecture Series sponsored the unique talent of the Rodgers Dance Company; next ... Or lrreaponsibility? Adams' remarks in recent issues of the Beacon. How significant is this set a tableware? Not much, I agree ; at least not in terms of monetary cost. Food service personnel tell me that the value of this fork and spoon is probably not more than 75 cents combined. What is far more important Is that acts of vandalism occur with such frequency on · campus that we can be lulled Into accepting them as something that is bound to happen. A group of students are sitting at a Cafeteria table after lunch engaged in conversation, one casually picks up his fork and spoon, and the result appears in the photograph. A glass door on the dormitory is smashed, a thermostat is ripped from the wall, a desk Is destroyed, a piece of College equipment is stolen - the list goes on and on, and the costs go up and up. While I am concerned about those costs - and I would guess that they are sizable when looked at over a year's time - I am also just as concerned about the attitude that leads to such acts of vandalism. In this respect, the problem is not only here at Wilkes, not just on college campuses. I suspect rather that many businesses face this problem in terms of employees, customers, and others not even related to the organization. It seems that property which cannot be Identified as beIng owned by a single individual becomes target for acts of destruction. Behind them all is the rationale that "it doesn't hurt anyone - the business will replace it. " Locally it might sound like "it doesn't' belong to anyone - it . belongs to the College." What foolish thinking! There is no such thing as " the College." The College exists only on paper in the form of its charter and the recordings of the events that take place here. The College really is people you and I who are here now and thousands who have been here over the past years. And when an act of vandalism occur!', it occurs to you and me: consequently, the costs are borne by you and me, and not by the College. obvious and •granted. But let us not overlook the thousands and thousands of our dollars are paid out each year with no constructive benefits being realized from the expenditure. The dollars spent do not result in additional equipment on campus, or more books ln the Library, or higher Faculty salaries to attract more qualified teachers ; they are wasted because all they do is replace, and repair, and restore what was. Just imagine what could be done with those resources · both dollars and man-hours - if they could be redirected. I am not especially happy that I had to contribute my share of the 75 cents required to replace the fork and spoon pictured above. The fact that each of us in the Community · (some 3,000 of us considering students, Faculty, Administrators, staff, maintenance, and food service) just spent $0.00025 with no realizable benefit should please no one, especially when thought of in terms of the total cost of all vandalism on campus. Given the choice, let my money go to support art rather than irresponsibility. Richard G. Raspen Wednesday is the next unique performance to be given by this versatile and acclaimed ensemble. Chestnut Brass Ensemble Will Perform l\pril·9th The Concert and Lecture Series is once again bringing a unique style of talent to the stage of the Center for the Performing Arts. The Chestnut Brass Company, a versatile and acclaimed ensemble, will perform on Wednesdy, April 9th at 8 p.m. The Chestnut Brass Company is a vibrant young ensemble that can play almost anything almost anywhere. The versatile quintet has a repertoire ranging from the traditional music for brass instruments to avant garde twentieth century works to jazz, rags, popular and even movie music. The Company had their beginnings as street musicians in Philadelphia. While still students, they played for lunchtime crowds on.the busy streets, often giving the informal audience full length performances of major baroque and contemporary works. All members in the group were educated at fine conservatories and music schools, including the University of Illinois, the East~an !¼:hool, Temple University, Philadephia Academy, Northwestern Universities and others. The ensemble has developed a remarkable popular appeal through their performances of vintage American Civil War compositions, Joplin rags, and jazz arrangements. Audience response is usually enthusiastic whether they are presenting an unusual style new suite by a contemporary classical composer or their arrangements of popular themes and blues. The diverse Chestnut .Brass features a large collection of instruments which accompany its multifaceted repertoire. Ancient and antique instruments belonging to the group include an alto sackbut, Renaissance cronettos, a double belled euphonium, and an over-the-shoulder horn. This impressive variety of instruments enables the ensemble to perform in the most authentic manner possible. They restore old brasses for their performances and they are the only active brass quintet in the world using multiple sets of instruments from different historivcal periods. The Philadelphia Inquirer said of . a recent performance, "the most demanding item was the Handel aria from his quintet for oboes, horns, and bassoon ; the group played it fluently and movingly." The performance is free of charge. -----EVER CONSIDER--. REAL ESTATE? OnluM tffi m21® POOLIIEALTYCO. _ The nation's largest real estate organization invites . you to attend out Real Estate MIDTOWN PIZZA New York Style Pizza We feature Sicilian style pizza squares, · serve salads, hot platten and cold or hot hoagies. We have specialties such as: Stromboli, CalJone, Sausage Roll and Parmigiana Turnovers Receive $1.00 Off on any large pie Exp. April -- 17th -- - VALUABLE COUPON CAREER DAYS DURING _THE MONTH OF APRIL I/you've been curious about real estate as a career .... get the answers. J.. What's it REALLY like to sell real estate? 2. How much can I EARN? 3. Will I be MY OWN BOSS? 4. Do I fill the profile of a SUCCESSFUL sales associate? . 5. What kind of TRAINING do I need? 6. What kind of LISTING and SALES aids are available? HEAR about CENTURY 21 real estate training and mass advertising. LEARN why CENTURY 21 is the fa stest gro wing real estate organization in the world. Find out why at CENTURY 21 being a r eal estate agent is MORE than being a salesperson. For a priva te interview, call Leo S. Kopec, Sal es M anager. CENTUR Y 21 POOL REALTY CO. KINGSTON DALLAS -----287-1196-----675-2159 �April 3, 1980, The Beacon, Page 7 Circle-' K--~rings Home Total Of Seven Awards Album Review Ronstadt's ~~adLove'' When I heard that Linda Ronstadt had a new album, I said "Big Deal." I thought it would. be the same old boring stuff that Ronstadt has become famous for. Ronstadt, I always felt, W8$ more country than rock. · Things have really changed for Jerry Brown's girlfriend. On her latest album are featured three songs penned by Elvis Costello and two by Mark Goldburg. Gone are the past sounds of country ballads and sickly sweet pop. Ronstadt's sound is definitely high-energy ...She proves that she can rock with the best of them. With the release of this new album, Ronstadt's ace guitarist Waddy Wechtel is noticeably missing. His country-flavored guitar has been replaced by Doug Kretchmer and Mark Golburg, two top-flight new wave musicians. Ronstadt's vocals shine through on the single " How Do I Make You" and the title track. Costello's songs, especially, Girl Talk are handled marvelously. Although Ronstadt lacks the intensity of Costello, her vocals more than compensate for the lack of "new wave anger." This album is by far Ronstadt's most ambitious work. It is to her credit that she has changed with the times. Sales indicate that the record buying public is satisfied with Ronstadt's new style. It looks like Jerry Brown has finally come up with a winner in his comer. ... h • { ·'",.~•-;·,:·., ••• 1r• IIO ······· C!. •,..i ·, , , ,;::; . ····· ~ ···./- -... j . '••···· The Wilkes College Circle K Club, currently celebrating its 17th anniversary on campus, received a total of seven club awards at the 18th Annual Pennsylvania District Convention in Carlisle. "The convention is to basically see how your club is in comparison with the others; there are workshops that we attended pertaining to different areas of club activites," Donna George, Circle K president said. that sponsors the most original party at the convention. The parties are held to get the members from different clubs together; we sponsored a 2 bathrobe party." She also explained that the Inter-club award is given to clubs that participate in Circle K events and meetings held at other colleges. Every three years the International Board for Circle K develops on overall theme for the club to adhere to. The current theme is bowling tournament for the Special Olympics and they help at the Special Olympics Summer Meet. Circle K members are quite active because they have in the past participated in Alumni Phonathons, ushering, at plays Visitation Day, selling candy to benefit Multiple Sclerosis and they worked for the Cancer Society on Daffodil Day. The club currently consists of ap. proximately 45 members and is always seeking more people. If George Sal>.•- -~- ....:~ Greeting everyone! ··········•···· Well it's that time again. REGISTRATION! Aren't you seniors glad you don't have to go through that torture anymore? , You can laugh at the underclassmen skipping classes to register and fighting with the girls in the office to open closed courses! Good luck to those that are trying to get bowling class for the nineteenth time. And to those who have five out of their six classes closed - better luck next Ume. As you wait in line, which moves awfully slow, dream of the time when you can walk by and laugh at the underclassmen ... It's not that-far away for some! The Great Spirit is happy to announce (as if you already didn't know) that spring vacation is here and will be gone before you know it! Four whole days to do nothing but search through the house for all that fattening Easter Candy. By the way did everyone get their very own bunny ears from the Easter Bunny! The great Spirit's time is running out for this time! It's off for home for . the weekend. Everybody enjoy themselves. I'll return again soon. Watch! P.S. CONGRATS TO M.S. AND P.S . .1980 Baseball Campaign Dedicated To Prof. Elliot To the Editor: Death is such a common and frequent occurrence but is so hard to adjust to especially when it hits friends and family . George Elliot was indeed part of the Wilkes Baseball Family. His support of our program through tile years created a bond of friendship which will never be forgotten. Mr. Elliot, like a few other teachers and staff members, dedicated himself totally to this college. He was especially loyal to the athletic programs. When the inOfficial Comics tegrity of the athletic programs were questioned he was quick to come to its defense (Letter to the Editor, Feb.14, 1980.l Because of the support he gave us during life, we refuse to forget him in death. As a gesture of our appreciation we would like to dedicate out 1980 baseball season to the memory of Mr. George Elliot, a true gentleman. The coaches and players of the 1980Wilkes Baseball Team C.Rf.AMY, YOU StWULll M. GLAO 'fHI\T 'f(,U~ fA-n-\Eil. ,A~ES St.l<t-1 A f~fESSIO~,\L ATrffLW[ A~UT 1-\\S ltEt..1\·rtoN~lf ,o ACTIVE IN SERVING OTHERS: The Circle K Club is one of the most active service organizations on campus. Recently, they were commended for '{OU The Wilkes Club walked away with more awards than any other club at the convention. Their awards include: Overall Achievement, third place ; Single Service, third place; Scrapbook, third place; Inter7Club, second place; Gleen and Salley Stevens Club Proficiency Award ; Special Olympics Booster Award; and the " Golden Turkey Award." Donna explained some details about the awards, "The " Golden Turkey" award is given to the club Vou ~110lllP e£ GMr'Efi.lL t\\.crr We ~c5 ~£SEA~ TO l.£.ilRN 'Jl..lSl" t){I\CfL-y' WH/t\" VOllil. G€f-.lER.ATtor( "fl(t( MAIU-S r;;;L~f v\_.A 0 their efforts at the annual state convention. The club is advised by George Pawlush, Public Relations Director. "Caring. . . Life's Magic" ; the three emphasize areas that are followed are the lonely child, the abused child and the child in crisis. In keeping with their theme, some of the upcoming activities include a Bowl-a-thon to benefit the Big Brothers Association ; hosting a dance marathon on campus the weekend of March 24-25th, this will benefit the Special Olympics and is being planned by Jeff Gavlick with area Coordinator Charles Wasserott. There will also be a v,1t-tt/ DO 't'OI.{ 1(1\lo\lJ WttER£ H£ IS ~H"f NOW? . anyone is interested they can obtain more information by stopping by the clubroom, basement of Chase Hall, seeing a member, or attending a weekly meeting, held every Tuesday at 11 in Kirby 102. Margaret Scholl NOTICE . Get into the Easter Spirit with Chesapeake Hall's Second Annual Chocolate-Peanut Butter Easter Egg Sale. They are ONLY $.35 each. Call ext. 400, Chesapeake Hall for more information. �Page 8, The Beacon, April 3, 1980 Student Aid, Draft And Abortion CoveredAt CongressionalDebate A debate involving the six candidates vying for the congressional seat in the 11th district was held this past Thursday night at the Dorothy Dickson Darte Center for the Performing Arts. Covered live by WBRE-TV, the candidates included Richard P. Adams of Kingston, Rep. Raphael Musto of Pittston, James Nelligan of Forty Fort, Atty. Frank Harrison of Wilkes-Barre, Atty. Paul E. Kanjorski of Nanticoke and Edward Mitchell of Kingston. Moderator for the debate was Monsignor Andrew McGowan of St. Pius X Seminary, while a four member questioning panel was comprised of Keith . Martin of WBRE-TV, Larry Saudor of WPGM Radio, Robert Faucett of the "Bloomsburg Dispat~," and William Lewis, a senior Political Science major at Wilkes College. During the debate which lasted from 7:30 to 9:00 , each candidate rendered an opening statement, answered approximately IO questions asked by the panel, and concluded with a brief closing statement concerning . their possible election to the congressionar seat. Bob Faucett opened the questioning by asking the candidates whom they would support for President of the United States. Nelligan stated that he would support Ronald Reag~, Mitcliell said that he endourses Ted Kennedy at the moment, while Adams and Kanjorski leaned toward the re-election of President Carter. Frank Harrison, making no firm commitment, said that he would support the democratic nomination whomever he may be. The only candidate making no comment on the matter was Raphael Musto, who replied that it was unfair to express an opinion at the present time. One issue which all six candidates agreed upon was the "prolife" vs "pro-choice" movement. Everyone of the congressional hopefuls confidently said that he was opposed to abortion and the funding of abortions with public money. In discussing the possible opening of the nuclear power plant in Berwick and nuclear power in general, Richard Adams was the only candidate to totally support nuclear power, while Edward Mitchell was the only one to all out oppose it. The other four candidates took a "middle of the road" view by stating either that we should use the present plants we have but stop future construction of them, or we should have federal inspectors constantly stationed at nuclear plants to insure our safety before we allow their opening. Waste disposal and the possible conversion of nuclear to coal or solar plants were two issues Notice Anyone wishing to volunteer their services in preparing for the March of Dimes Saperwalk scheduled for April ZO, 1980, sponsored by the Wilkes College Haman Services CommiUee may do so by contacting Steve Demko, 8%5-5&, ext. 485, or Lynn Patterson, 829-91142, ext. 400. Recraiten are needed to visit local higb schools, and walking mar1halls and a set-up crew are needed for the day of the walk. discussed by all six candidates in answering this question. When asked whether they support or oppose the draft, most of the candidates favored draft registration although some were opposed to a peace time draft. Richard Adams made one of the most shocking statements of the night when he said that he is opposed to the draft at the moment, but if it is necessary, he feels it should be for both men and women. James Nelligan stated that he supports draft registration and the draft, and pointed out that our country is weak today because we have not had a draft in seven years. · An interesting thing to note is that during the whole debate, only once did the wrong doings of former Congressman Daniel J. Flood enter into a discussion. This moment came about when Paul Kanjorski was asked what he hopes to accomplish in Washington as congressman. Kanjorski hinted at Flood's criminal involvement by replying that he hopes to bring a bit of honesty to Northeastern Pennsylvania. He continued that he wants to use his influence to solve the problems facing the district. An issue of great importance to almost every s.tudent on campus was brought into discussion by William Lewis when he asked the candidates their opinions concern- ing future funding for students. Out of all the candidates, James Nelligan was the only one who said that he would cut down on educational spending in favor of national defense and balancing the budget. . At the other extreme, Paul Kanjorski stated that education is a top priority of his and that he will not cut from this area to balance a budget. While Mitchell and Musto said that they would support the highest level of education possible without having the budget suffer, Harrison and Adams stressed that they favor Joans as opposed to grants because they feel the federal government "should not have to pay for every student's education. After fielding questions concerning the Iranian hostage situation and the probability of organized crime in the area, each candidate made a closing statement which ranged from James Nelligan's wish to be a "spoke in a wheel for change" to Paul Kanjorski stressing, "I would like to take to Congress a new image." Monsignor McGowan concluded the debate by saying that although he was not sure this was the best way to choose a candidate, he was sure that "we can make a judgement if we only vote." Because of increasing apathy, he considered this the most important thing of all. Peter Steve WCLH VS. WRKC IN A BF,:NEFIT BASKETBALL GAME. On April 10th. 1980 at 7 p.m. in the King's College Gym WCLH will play WRKC as a part of Marathon 88. Last year WCLH nearly pulled off an upset and will be looking to even their record against WRKC. Tickets are available from any member of WCLH at a donation of $.25. Proceeds go to the Pittston Lions Club benefiting the Eye Conservation. Shown making preparations for the April Ioth game are Ron Renio, WRKC, Rich Norheim, WCLH, Tony Rovinski, WRKC, Chris Kosakowski, WCLH. Spring Concert Slated By Music Department Dr. Terrance Anderson, chairman of the Music Dept. and Herbert Garber, will conduct faculty, students, alumni and guest artists Sports, Plays And PartieS••···································· Cherry Blossom Events Planned With the Cherry Blossom weekend only 3 weeks away, preparations for what promises to be an unforgettable weekend for many are already at an advanced stage. According to one of the cochairpersons of the Cherry Blossom Weekend Committee, senior nursing major Bobbie Lou Hamilton, this year's festival will include a number of sporting events, two plays, and, of course, parties. The weekend will start off with an opening ceremony at 4:00 p.m. on Friday April 25th on the Chase Hall lawn. This ceremony will be mainly for the teams which will compete in sport events over the weekend. After the ceremony the action will move to Raison field where there will be sack races, three-legged races and egg races. At the end of these there will be a Nerd party in the gym sponsored by Weiss Hall, Dennison Hall, Parties Unlimited and the Cherry Blossom Festival Commitee. The admission fee will be, believe it or not, 50 cents only and all those going to the party are urged to dress up like Nerds. The music will be provided by Thunderbird, one of the top 40 rock bands in the area. Saturday will start off with a softball game in Kirby Park. The games will go on until 5 p.m. when · there will be an hour's break for dinner. Six will see the continuation of the games which are scheduled to end at nine. Meanwhile Ralston Field will be ablaze with a rock session which will start at 12 mid-day and end at 5:30 p.m. Ms. Hamilton has appealed to both faculty CHERRY BLOSSOM COMMITTEE - A weekend of fun-filled activities is being planned for the weekend of April 25th. Shown are committee members from left, Rob Doty, Bobbie Lou Hamilton Janine Tucker and Lori Cavalla. members and students to help make the festival a success by volunteering to be umpires and actively participating in the events planned. At the end of the softball games there will be two plays in Church Hall (The old SUB ), one of these being 'The Imbecile' by Luigi Pirandello at 7 p.m. A 'Block Party' on the Chase Hall lawn at 9:00 p.m. The Party is sponsored by the C.C. and the I.D.C. and the music will be provided by "Mountain Back StrinllS". ' On Sunday there will be softball finals at Kirby Park between 12 and 2, swimming.at the Y.M.C.A. bet- at St. Stephen's Episcopal t:nurcn, April 13th at 3:30 p.m. in the Spring Choral and Orchestral Concert. There will be approximately 70 participants in the program and selected works to be performed in.elude: Be-thoven's "Coriolan Over-· ture," Hayden's "Lord Nelson .Mass," and Tchaikovsky's "Symphony No. 4 in F-minor." Featured performers for the concert are Helen Ralston, Eugene Kelleher and Gretchen and John d-Armand. Mrs. Raiston, Dean George Ralston's wife, has participated in many choral events and is also a member of the Master Works Chorale. Eugene Kelleher is an alumnus of the college and has also taken an active part in choral activities at the college. Gretchen and John d-Armonde are both faculty members of the University of Massachusetts. Mrs. d-Armand has performed with major symphony orchestras throughout the United States and sung in the most music festivals and won the National Metropolitan Opera Award. Mr. d-Armand has sung with the Robert Shaw Chorale for nine seasons and appeared with many major orchestras on the East Coast and in the Mid-West. Dr. Anderson feels that the timing of the event is excellent, "April 13th is Visitation Day and parents and prospective students will be able to hear the college choir at .its best." The decision to hold the concert at St. Stephen's is also a significant one in Anderson's mind, "By holding the concert off campus, at St. Stephen's, we are reaching out to the community. The presentation is not only for the college but is significant to the community. It is part of the music department's plan to obtain a closer contact wHh the greater Wilkes-Barre Area." The event is the biggest planned for the music department this semester. ween 2:30 and 4:30, and movies ·featuring Charlie Chaplin, the Three Stooges and Abbott and Costello. · The teams which will be competing will consist of 7 members from each sex, a total of 14 people. Auditions for the groups which will perform during the rock session will be held in the CPA on April 10th at 7:00 p.m. Applications for both the teams and the groups are available in the Library and buokstore. The deadline for team application is the 11th of April. The rock jam session deadline is on the 1st. k Margaret Scholl .... Nk -- - �April 3, 1980, The Beacon, Page 9 Alpha Campaign Report--------------------=.--------~-~---------- ----- ---- ----- Goal For 1980 Scholar:s ~IP ,D riVe Exceeded "Talent opens the doors of Wilkes College, not the ability to pay." Thus begins the main gist of the 1980 Annual Campaign, which is the third and final year of the Alpha Campaign. Called the Scholarship Year because an effort is put forth towards scholarship support, it runs concurrently with the Alpha Campaign. In fact, the last two and three year phases of the Alpha Campaign are mainly for maintaining scholarships. Dean of External Affairs, Thomas Kelly, announced that the goal set for the three year Alpha Campaign was $2.4 million, with the . goal for 1980 being $200,000. He stated that the total amount reported was $235,000, exceeding the goal by $35,000. To date, the total amount reported for the three year Alpha Campaign is $2.33 million, with $70,000 left to be raised between now and December. " I anticipate that we will be able to raise the money by mid-summe-, which means we will attain our goal six months ahead of schedule, " remarked Dean Kelly. According to Dean Kelly, there are four phases of the campaign. The first is the amount of dollars raised from the community, such as businesses, friends and alumni who were solicited by volunteers. The second phase is the Alumni Phon-A-Thon which was conducted in March from the Alumni House. Alumni and students did the calling, making vital contact with the alumni which made for good alumni relations. " It's more than fundraising, it's friendraising," commented Dean Kelly. A third area where the money comes from is the foundations and corporations; and the last one is from the Wilkes College Family -- faculty, administrations, staff, and trustees. The community phase, which was headed by James Aikman, Development Office, involved a work force of about 170 volunteer friends and alumni who solicited about 1,000 prospects. These 170 volunteers were divided into groups including a chairman, vice chairman, 7 division leaders, captains, and workers. Of the seven division leaders, three were parents of Wilkes students and three were alumni. Aikman feels that this speaks well for the support we get out of people who have an affiliation with Wilkes. "These are faithful servants, dedicated people who have faith in and want to help Wilkes, " he commented. Four students - Bill Lewis, Paul Kerrigan, Ellen Batey Behlike, and Stephen Croghan - were fea tured to let the workers " see the products of the college." Mr . Aikman stated there are six categories where monies come from . The six, and the approximate amount of money ~eceived from them are as follows : 1. Community (Work Force ) $50,000 2. "Silver Colonels" (selected trustees> 32,000 3. Alumni Phon-A-Thon 26,000 4. Trusts & Bequests 50,000 5. Memorial Scholarships 46,000 6. Foundation for Independent Colleges of Pennsylvania 30,000 When asked to comment on the campaign overall, Dean Kelly replied, "For many years, friends and alumni at Wilkes have given of themselves to assist Wilkes in its services to the students and Northeastern Pennsylvania. 1980 is no exception. I think it particulary noteworthy that these friends and alumni supported the college to the extent of exceeding the $200,000 goal by $35,000. 1980 is unusual because of current inflationary rates, the general economy, and energy concerns. Many major donors made three-year pledges to the Alpha Campaign in 1977, and are currently paying those pledges. Our friends and alumni again made a commitment to Wilkes in 1980 as evidenced by our campaign result." Aikman responded, "The 1980 Annual Campaign is unique in that it requires the highly dedicated effort on the part of the work force in soliciting prospects. · 1980 represents the third year of the three-year Alpha Campaign and as such the Development Office spent considerable amount of effort in matching each donor with the proper solicitor. This was particularly important in the 1980 campaign, because we had to maximize each donor's contribution. Overall, the work force came through with an outstanding effort and was totally dedicated to the job of helping Wilkes College." Lisa Gurka NOTICE Theta Delta Rho Sorority will have a hoagie sale on Thursday April 17th. The cost will be $1.25 and tickets can be secured from any member of the sorority. Pick-up for the hoagies will be in the student center from 11 :00 until 1:00 on the 17th. Ena,iro. Science Club Aims To Saa,e Energy For the 1980-81 fall semester, the Guidance and Placement office will have energy conservation screens installed on all windows by the Environmental Science Club as a club project. The screens are constructed of very thick fering strips with extraduty plastic stretched over them . The screens are an attempt to reduce heat loss from building. The club intends to monitor the heating bills for the building during the year and then compare them to bills in the past years. When asked why the club picked this particular project to do, Bill Petrick, project coordinator, stated that the club wanted "to do something to conserve energy. The project has something to do with the environment as well." Petrick said that the club's- advisor, Dr. Mike Case, gave them the idea at the beginning of the year and everyone agreed to do it. He continued that the actual construction of the screens is going great, since the project was started this past August. The project coordinator also stated that if the energy screens work out, it is possible that the school will have the same procedure done to other buildings. He further mentioned that no dorms were chosen for the project because of the height of most of the buildings. It seems that the Guidance and Placement office was the safest and the most practical for the project according to Petrick. Petrick concluded by saying that he is very optomistic that the project will be a success as well as beneficial to the college. Peter Steve NOTICE There will be a meeting for all people interested in working on an "Elect Ted Kennedy for President" campaign, this Thursday at 11 :30 in the basement of Franklin Hall. E.S. Club Photo Contest Announced " Impressions of Nature" has been selected as the theme for a photo coptest sponsored by the Earth and Environmental Sciences Club. The contest is open to all non-\ professional photographers. Three prize winners will be chosen from among snapshot entries. Three prizes and two honorable mentions will be awarded for black and white prints (minimum 5 x 7 inches, maximum 11 x 14 inches ). All photos must be accompanied by an entry blank and $1 entry fee per photo. Forms are available in SLC Room 50. Photos, entry blanks, and fees must be submitted in Room 416, by April 12. Winning contestants will be notified by mail after judging on April 22. Photos will be displayed on campus on Saturday, April 26. w comes Miller time. �Page 10, The Beacon, April 3, 1980 While Others Sit Through Rain~ Lacrosse Team Drowns Widener Although most sports action was postponed this past weekend due to rain, the Wilkes College lacross team played in miserable weather and brought home a 5-4 victory over Widener. It was the season opener for the stickmen of rookie Coaches Brian Blesi and Bill Harris. Senior Mark Sanders, West Islip, N.Y. was the "hero of the week" with two goals and one assist. The co-captain also played a tough defensive game from his mid-field position. Tommy Heller, the senior from Carle Place, N.Y. was responsible for "breaking the ice" as he found the range first with his goal ten minutes into the game. Also hitting the nets for the Blue and Gold were Rich Modica and Glenn Pohorely. Modica, the big man on the squad is a sophomore from PP.linview, N.Y. Pohorely, a sophomore from Whitehouse Station, N.Y. was assisted on his tally, by the oppos- MAC Golfers Open The Wilkes College golf team will enter the 1980 campaign as defending Middle Atlantic Conference champiQns. Last season Coach Rollie Schmidt's team was 8-3. But defending that championship will not be easy since three of the four top golfers from last year are gone (Mark Alansky, Francis Hayes, and Joe Skladanyl. The fourth, Mark Lepore is the only returning golfer from last year and will be the captain in 1980. Coach Schmidt calls Lepore a " good golfer who is very consistent." Lepore placed seventh in last year's MAC tourney. He and Schmidt are hopeful that Lepore will do better in this year's tourney. Other golfers returning from last year's squad are Karl Blight, Jim Fialko and Joe Rubbico. Top freshmen include Ray Ward, out of Nanticoke Area ; John Guyler of Meyers ; Chris Grimes ; and Alex Apaliski. new upperclassmen are Chris Reilly, Dave Samsel, and Frank Gardner. According to Schmidt "We have only one returning veteran and we are going to find out who are top golfers as the season progresses. Our first meet is Wednesday. This is the first time we are golfing this year and it is away, like our next four meets." Coach Schmidt concluded, "We hope to do our best in the duals and hope to find out who our top four golfers are when the MAC's roll around." All home meets are at the Irem Temple Country Club in Dallas. Seven players participate for each team with the five lowest counted towards the team score. Four players will take part in the MAC's. The first meet was slated for yesterday and the Colonels will meet Haverford on April 4 and King's on April 7. GOOD LUCK COLONELS! Rich Nordheim ing goalie. Nevertheless, it was the winning goal for Wilkes. Coach Blesi said, "There was at least six inches of mud on the field and three inches of water on top of that". The Colonels probably fit right into that atmosphere since their lacrosse "CAMP" was held under the same circumstances. Lacrosse players have to be considered a different breed of an athlete. Not only do they play on terrible fields, and terrible weather, but the game itself is brutal. If there are people who like seeing people get destroyed, hit with sticks, hit with balls travelling about 100 miles per hour, then you'll like lacrosse. Defensively, Wilkes was wellsupported by goal-keeper Dave Singer of Fairlawn, N:J . The sophomore goal-tender recorded 17 saves against the Widener team. The Pohorely's, Glenn and Gregg · both contributed adequate efforts in the defense also. John Nordstrom, a sophomore from Whitehouse Station is now a part of the " bruisers" on the basis of his performance Saturday. Joe Burnett, a senior from Binghamton, N.Y. and Billy Adams, of Bethpage, N.Y. played steady games according to Blesi. The Blue and Gold was expected to play Dickinson College yesterday and chalk up another victory. Last annum Wilkes handed the Carlisle squad a 17-6 setback and the Colonels should have dumped them again. But Friday beings on a tough contest when Wilkes travels to tangle with Bucknell University under the lights at 7:30 p.m. at Lewisburg. Last season Wilkes played well but dropped a 17-8 verdict. Blesi will send Adams, Modica, heller, Steve DeGiso and Eric Farber on the attack against the Bisons tomorrow. DeGiso, a transfer from Brockton, Mass. never played competitive lacrosse but will see a lot of action this spring. Burnett, Sanders and cocaptain Pete Canine are in charge of the mid-field duties with Nordstrom and Jeff Harper adding depth. Freshmen who are playing for the varsity are Tracy Cloth, John McCarthy, Alex Rae, Kevin Cavanaugh, Joe Bernhardt, Carl Schulteis, and Paul Supansky. Blesi l.._..~.,_,..._..~,_,,.~.,_,.~.._..~,.....,_,,....-........,....................._...._..,~~..-.c. . pointed out that Larry Buffalo, a freshman, played an exceptional game on Saturday and hopes to get a few more fresmen moving in the future. After Bucknell tomorrow, Wilkes will entertain Western Maryland April 9 at 3 p.m. at Ralston Field. Ii~~,._..,,_...._.......,~......,~,._........,~......,.....,.......,.....,~.......,~,_,.~~ Last year's tilt was a real "barnWilkes College's season-Opening at Artillery Park. On April 8, the burner". baseball doubleheader slated for Colonels · will travel to Roosevelt Bob Gaetano this past Saturday was rained out. Park in Swoyersville to meet King's The Colonels were slated to open in another MIC doubleheader. the year on Tuesday with a twin-bill Last season, Wilkes split four with Scranton University in games with Scranton with each Schautz Stadium in Dunmore. team sweeping a doubleheader. Those two games with the Royals When the Royals swept the Colonels · will count in WBRE's Metro Interlate in the year at Schautz, it markcollegiate Conference (MIC) staned the first time in history that a dings. Colonel diamond team went Believe it or not, Wilkes is not in wineless in a twin-bill. Wilkes and the same Middle Atlantic ConKing's split a doubleheader last ference division as King's and year at Roosevelt. The games were Scranton. Therefore, the games played there due to the muddy conagainst the Monarchs and Royals ditions at Artillery. DO NOT count in the MAC stanOn April 10, the Colonels will dings. travel for a MAC doubleheader with Due to press time, we were Elizabethtown College at 2:00. And unable to report the results of Tueson the 12th, Wilkes will host Susday's game and yesterday's home quehanna University for two games opener against Muhlenberg College at 1:00 at Artillery Park. Lacrosse Coaches and Captains Go Over Game Plan I Two Rainouts For Wilkes, jWill They Ever Play? bowling BUD'S Has Best Mark Otto Graham, one of football's greatest quarterbacks, has made a successful comeback: from colorectal cancer. And today, he's feeling good enough to keep working full time as Athletic Director of the Coast Guard Academy. Your donations have helped fund the research and advances in treatment necessary for a recovery like Otto Graham's. And the recovery of almost 2 million others who are living proof that your contributions count. C'ANCER C'AN BE BEAT. American Cancer Society ! The Avengers re-captured undisputed possession of first place in the Pacific Division of the Wilkes College Mixed League last Friday by sweeping the Whippets 3-0. However, still in striking position are the EE's (Paul Miller 208-495 & Mike Jamiolkowski 488) who took two of three from the Vets Club II · and crept into second - two games back of the Avengers. IN the Midwest Division, the Assorted Nuts (Dave Samsel 469 & Lisa Hughes 194-509) dropped two points to The Force, but still kept a onegame bulge over the Aristocrats, who also lost two. After a week off (for Good Friday ) the Nuts•Aristocrats, Mother Brothers/Bud's, and Avengers/EE's matches will be the ones to keep an eye on. Standings Bud's Compressor & Supply 22-5 Mother Brothers Poky's 752 Crew Veterans Club I 17-10 16-11 14-13 7-20 Midwest Division Assorted Nuts Aristocrats The Force The Pack Good News 15-12 14-13 12-15 10-17 8-19 Pacific Division Avengers EE's Whippets Veterans Club II BS'ers Nukes 17-10 15-12 14-13 11-16 11-16 10-17 Others: Leo Orlandini 520, Rod Wyffels 201-529, Bill Petrick 219-565, Vince Taninies 186-472, Ed Ohmott 481, John Moffatt 482, Stan Kman 488. I I �April 3, 1980, The Beacon, Page ll 11 Tenn-i s ~ - § ~ §§ § ~ RAINED-OUT § § The equipment was passed out, S § § §§ §8 S 8 S 8 8 the C<'Urts were dry, and the starting six players were picked for Saturday's match against Juniata, but the weathermas had other ideas. The Colonels had their full -artillery ready for Saturday's match. Ten years of experience, from the ~ R starting team along with a tremen~ ~ dous amount of talent and depth awaited Juniata College. The Recently, Wilkes College head football coach Rollie Schmidt held his annetmen have every member of last nual football coaches workshop at the Stark Learning Center. The all-day year's squad returning, adn with affair was well attended and the veteran mentor said, "it gave the coaches the guidance of head coach Tom a chance to share ideas and many said they learned from the experience:" Rokita, the team should improve on Shown above are some of the coaches who spoke a! the workshop : Ma~e R last year's 7-5 slate. Billas, Mike Klembara . Marty Hlay, Chuck Roccom, J.P. ~eek, Charhe ~ Coach Rokita says that in all his Pirello and Schmidt. . .. years with Wilkes (first as player Pirello, a native of Pittston and the coach at Northern Burhngton ID Col- ~ and now coach) this is the best umbus, N.J. spoke on the defensive secondary. Purnell is the coach ~t li group of men he has ever been 8g Shikellamy and Rocconi is head mentor at Central Bucks East. Hl_ay as associated with. Pilo!ing the team head coach at Hazleton High School. Meck is the head coach at Coughl!n. . will be senior co-captains Mike Schmidt was pleased to see many of his f~rmer players, now coac~ng_ ID Hromchak and Bill Murtagh. Mike Sg attendance. They included: Ted Yeager. Rach Roshong, Joe Frappolh, Jam R combines sharp angled serves with Rodda, Bob Ashton, Bob Catina, Terry Blaum, Charlie Fick, Angelo li deadly volleys making him the top Loverro and Ja Holliday. · singles and doubles player on the· team. Bill Murtagh never gives anything less than his best, he has great placement and a steady consistent serve. The lone junior on the team is Pittston's Stan Manoski, an allowed 45 hits, 11 earned runs, 24 Carl DeFelice is the " ace" of the explosive who knocks the cover off overall runs and 13 walks. He Wilkes College pitching corp. He the ball. When Stan is at his best he finished the campaign with 47 k's. It knows what it is to be an "ace." He is an extremely difficult player to was enough to name him to the Allhas watched Jim Stehle and Andy beat. Middle Atlantic Conference all-star Kresky carry the burden in the The Sophomore class is squad. clutch for Wilkes baseball and now "superheaded" by former Coughlin In his three seasons, Carl has its his turn. standout Dave Battle and Barry hurled in 21 games with a 9-3 slate, DeFelice, a senior from MifflinSpevak. The former three-time two saves and a era of 2.48. In 113 ville, was a freshman when Stehle Class AAA district champ uses a innings pitched, he has allowed 95 was a senior on the Colonel baseball blistering topspin forehand to hits, 54 runs, 31 earned runs, 37 squad. Stehle-carried the load as destroy his opponents. His style is walks, and recorded 103 strikeouts. Wilkes moved to a 2o-4 record and a considered by most to be unorvisit to the Mideast Regional Tourthodox but they say the same thing nament in Wooster, Ohio. about Bjorn Borg. Barry Spevak is Stehle, considered by many to be a steady player who uses the full the finest hurler in Wilkes history length and width of the court to his and the best to come out of Wyomadvantage ; he really makes you ing Valley, was a draftee of both the work for every point. Marcus Chicago White Sox and the San Eckert is only one of the many Diego Padres. While Stehle and freshman on the team, he broke the Kresky dominated things in his first starting ranks because of his. exyear, DeFelice contributed with a 2cellent balance and agility. Marcus 0 slate and 21 strikeouts in 24 innis a tall player with a consistantly ings pitched. He also allowed only hard serve and a remarkably good 23 hits and 12 earned runs in 1977. attitude. In 1978, De Felice's soph season, The Wilkes tennis team combines Stehle was gone via graduation and every element needed for a winning now the man was Kresky. Andy set season, experience, depth, talent Wilkes records for wins in a season and confidence. If all goes well they as the Colonels racked up their best will have an excellent season under record in history with a 25-5 slate. coach Tom Rokita. If you want to They made the Mideast Regional see some exciting tennis action, the tourney in Huntingdon, Pa. and matches will be held at the Ralston came one-run short of making a trip tennis courts adjacent to the footto the World Series. ball field. That season, DeFelice was again DROP SHOTS ... Dave Battle was All that remains is his senior undefeated with a 3-0 record and a seen withou t a racket yesterday ... season and DeFelice is looking for a 1.85 and Colonel fans could see Juniata match will be rescheduled another "ace" was moving up in · good one. Coach Dave Kaschak at a later date ... Important match says having DeFelice around is like the ranks. In 39 frames of work in with rival Scranton University on having another coach. He is regard1978, he allowed only 27 hits, eight April 8 at the Ralston Courts at 3: 00 ed as one of the most dedicated earned runs and nine walks. He also .. . Colonels take the road against athletes to ever set foot on Wilkes struckout 35. Susquehanna on April 10 at 1: 00 ... soil. He is also a top candidate for Then came last year. Kresky was Bob Buchsbaum post-season honors. Major-league gone and the burden fell on the 6-0, scouts should be filling Artillery 170 pounder. But not only was Park this spring to get a look at the Kresky missing, but also was an former Central Columbia standout, · All-American catcher, second who played for Don Engle in high baseman, shortstop, two outfielders school. and a designated hitter. If ever When Stehle was a senior, he led there was a rebuilding year for his team to the Regional Tourney Wilkes basebatl, it was 1979 as the and was named the MA C's MVP . Colonels "slumped" to 16-9. When Kresky was a senior, he led Carl was hurt by team-mates his team to the Regional Tourney shoddy fielding and recorded a 4-3 and was named the MAC'S MVP. slate a year ago with a 1.98 era, Now, DeFelice is a senior ! which ranked 19th in the nation in Eddie White Division III. In 50 innings, he had 8 S §8 §S8 § 8 8 8 s88 S 8 8 S S 8 8 8 § S § § 8 S DeFelice C arl DeFelice Women's Softball Report . Next Week Between The White Lines by Eddie White We lost a great sports fan over a week ago with the passing of Mr. Elliot. He was not only a top educator, but also a great fan of Wilkes athletics. One could see him at any baseball game, wrestling match, basketball game or any Wilkes sporting event. He will be missed! We have to admit it, but Philadelphia 76ers center Darryl Dawkins has come a long way since he first entered the NBA-a few seasons ago. It seems only yesterday that the "Chocolate Thunder" was getting into fights and committing turnovers like crazy. He has matured into a fine center and one of the tops in the : 1gue. Although he is imporving, he will never reach the plateau of a Chamberlain, Jabbar or Russell. Rain washed out most or last weekend's spring sports season openers with the baseball and tennis teams getting their games postponed. But not the !across team. Lacrosse is like football - IT IS PLA YEO, no matter what. Ir the river was flowing over the banks, the !across game would still go on; nothing stops those guys. We were criticized last week for a comment that loacrosse is like "mugging." What we meant is, there is a lot of contact in lacrosse. Much more contact than in any. other sport. It is a b~tal sport, a tough sport and a fun sport to watch. The baseball team played Scranton Tuesday in a MAC doubleheader at Schautz Stadium in Dunmore. Because of Saturday's rain, the twinbill with the Royals opened the 1980 campaign. Last time the two schools met, Scranton swept Wilkes in a doubleheader and it was the first time in history that any team had done that to the Colonels. There is great rivalry between the Scranton and Wilkes baseball teal))s, but it is a friendly one, which makes it the best kind. We've heard rumor talk of lawsuits in reference to the Wilkes-Scranton basketbrawl. This is crazy. Things have finally settled down and it is over. Let it die! If one party tries any legal jazz, it will bring back the whole ugly mess again and could really set Wilkes basketball back a few years. Fights do happen in all of sports and one can say it is a part of the game. But it is the risk you taken when you walk on that court or field . And how can ·anyone place blame on the Wilkes-Scranton experience. Both teams were to blame and so were both officials. No one was innocent in that brawl! Super Sight: Saw Meyers' great wrestling star Jay Patterson chatting with top Colonel grappler Bryan Billig in, of all places - the Wilkes Library. If Coach John Reese could get Patterson to stay in Wilkes-Barre, Colonel grappling fans are in for a treat. Patterson is considered as one of the finest wrestlers in Pennsylvania state history. · The PIAA, which governs high school sports in pennsylvania recently made an announcement that anyone can coach in the high schools. Any person, no matter what his education or occupation can coach high school teams in all sports. There has been much discussion about this issue, but we agree. Some baker or banker could well be a better-coach than some of the mentors in the local high school circuit. Wyoming Valley's "number one" sports fan award should go to Barney Banas of North End. Barney sees more sporting events in one year tha n most people do in a lifetime. Barney, by the way, says to look out for the Detroit Tigers in the American League this year. Great sports photo on the first page of the sports section of last week's SUNDAY INDEPENDENT. It showed Philadelphia Phillies slugger Greg Luzinski chatting with yankee hotdog Reggie Jackson. Both were discussing how wearing glasses will help a hitter. Reggie better do something, be has yet to hit .300 for a season. it was great photo though, showing the best player in the National League and the worst in the American League. Ran into a few local sports experts and asked their opinion of who will win the World Series· this year. Jlere are some answers : Matt Engle, Phillies; Ron Olshemski, Orioles; Joe Amendola, Yanks; Bob Waskiewicz, Yanks; Neil Corbett, Mets ; Mickey Banas, Mets ; Pete Baran, Dodgers; Mike Pawlush, Yanks; Tom Kosin, Mariners ; Mark Sovyrda, Padres; Joe Wilk, Pirates; and Ken Pascoe who says look out for nanticoke. Ron Righter had an interesting call a week ago. it was his old college coach and now head man with the L.A. Lakers, Jack McKinney, McKinney invited Righter to a banquet honoring the former St. Joe mentor, but Righter could not make it because he was playing in a basketball league. THE BEACON is looking for sports writers (male and female) for next year. Anyone interested is asked to contact the Beacon office and ask for Eddie White or Pete Steve. No experience is necessary and the staff will train you. Scranton University's women's basketball team finished No. 3 in the nation in Division III in the recent championships. They were honored when they returned home by Scranton officials. Only a few years ago, the men's team at "Duh U" won the national championship in Division III. The success of their teams shows what can happen when the people that count, care about athletics and don't treat it as second-rate. This is our last year on the BEACON sports staff and if we could have one wish, .i t would be for the Wilkes College men's basketball team to get new home uniforms next year. The so-called "white" ones worn this year are like a grey-blue. Thank heavens when the team is on TV, they wear the away blue uniforms. It's a shame if they don't get new uniforms. Can't believe the King's College school newspaper sports editor hammered Monarch baseball coach John Dorish in a recent column. Dorish is a class guy and a good coach. The King's scribe should take a course jn sports writing. Did you know that Pat Kennedy, who took over the Iona head coaching job when Jim Valvanno went to the North Carolina State, is a former student and asst. coach at King's. Both Iona and the Wolfpack are slated for a toiJrney next year at Madison Square Garden. Should be a dandy! ,.. �... .. Registra~ion Schedule SENIORS-Class of 1!)81 Pre-Registration---Monday, March 31 and April 1 Registration-Tµesday, Wednesday, April 1 and 2 S-Z-8: 30-12: 30-Tuesday A-E-12:30..4:30-Tuesday F-L-8:30-12:30-Wednesday · M-R-12:30-4:30-Wednesday SOPHOMORES..:..c1ass of 1!)83 Pre-Registration-Tuesday, Wednesday & Thursday, April 8, !l & 1o Registration-Thursday & Friday, April IO & 11 Monday & Tuesday, April 14 & 15 S-Z-8: 30-4: 30-Thursday A-E-8: 30-4: 30-Friday F-L-8:30-4:30-Monday M-R-8:30-4:30-Tuesday JUNIORS-Class of 1!)82 ( Pre-Registration-Wednesday, Thursday. April 2 and 3 Registration-Tuesday and Wednesday-April 8 and H S-Z-8: 30-12: 30-Tuesday A-E-12:30-4:30-Tuesday · F-L-8:30-12:30-Wednesday M-R-12:30-4:30-Wednesday : (1-P can register with S-Z because they registered last as Sophomores). FRE.S HMEN-Class of 1!)84 Follow the same schedule as Sophomores, Class of 1983. � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 April 3rd Date A point or period of time associated with an event in the lifecycle of the resource 1980 April 3 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/f835517cfda1eaac68c96df2a67139be.pdf 04504fa67d26aef6bfe8aa0ff4bb0703 PDF Text Text Wltla WIikes Since 1950 Prof. George Elliot Dies Over Weekend George F. Elliot, 61, Professor of Commerce and Finance, died over the weekend in his home at 215 South Franklin Street, WilkesBarre. Born in New York on August 11, 1918, Elliot served as a member of the Commerce and Finance Department since 1950. A native of Rutherford, N.Y. and a graduate from Montclair State College with a bachelor's degree in 1941, Elliot attained his master's degree from Clark University in Massachusetts in 1942. He was a World War II veteran, serving with the U.S. Army Air Force. Before joining the Wilkes College Institute research fellow in 1952; 1''aculty, he served as assistant pro- outstanding American educator in · fessor of economics at Mohawk Col- 1972, and to Who's Who in the East lege, Utica, N.Y. named professor in 1973. of economics at Wilkes in 1975, he The funeral will be held today at served as acting Dean of Men from 10 a.m. from the Collins-Calhun 1954 to 1955 and dormitory proctor Funeral Home in Rutherford, N.J. from 1950 to 1968. Also dµring his 30 Asked to comment on the death of year career, he organized the B.A. Professor Elliot, Dr. Howard Proeram and lnterantional Studies, Williams, Chairman of the Comand served on various faculty com- merce and Finance Department, mittees including the faculty- said, "George instilled respect for trustee and athletic committees. scholarship and intellectual acProfessor Elliot was a member of complishment in thousands of the American Economic Associa- students. He was one of a few tion, American Association of superb teachers on whom Wilkes University Professors, National · was built and we will never meet Geographic Society and the his peer." Williams added that a Foreign Policy Association. He was George Elliot scholarship fund is a member of Capa Delta Pi, and being ·established and anyone was an expert in international af- wishing to contribute to it may confairs. Elliot was named as a Case tact the development office. Middle States Assoc. ReaffirDls ·Reaccreditation Of Institution . .. .At its session on March 1st, the Commission on Higher Education of Middle States Association of Colleges and Schools reaffirmed the accreditation of the institution according to Robert S. Capin, President of Wilkes College. In a letter received by the president's office on March 13th notifying the school of its reaccreditation, the CHE commended the institution on its self-study and requested a Periodic Review Report due on March 15, 1985. Dr. Gerald Hartdagen, Dean of Academic Affairs, stated that the purpose of the report is to indicate any progress made by the college in reference to the recommendations noted by the MSA evaluation team. Dr. Hartdagen added that although the school is in no way obligated to adhere to the recommendations of the team, every suggestion that does not require a large expenditure of money will probably be accomplished. An end result of the work over the past two years, the accreditation process started with notification from the MSA concerning the evaluation of the school about a year before the evaluation team's visit took place. After compiling a self-study, hosting the evaluation team for a three day period, and approving Jhe visitation committee's final report, the school's self-study along with the committee's report were sent to the MSA in January Removal OfMajors-From Diplomas Arouses Protest In Senior Class The recent decision to remove the majors from diplomas has caused much protest from seniors. At last Thursday's senior class meeting president Sue Theobald informed the seniors of the decision not to print the majors on the diplomas for the class of 1980. She also informed students of a petition being circulated to protest the major removals and encouraged them to add their names to the list. Last Friday a meeting was held between Doris Barker, Registrar; Dean Gerald Hartdagen, Academic Dean ; and four students to discuss the reasons for the decision to remove the majors. Dean Hartdagen stated that he had submitted a letter of reasons leading to the major removal decision. (That letter is printed in full on page 4. l Mrs. Barker would only say that she feels the .major removal decision was the right one. She believes the transcript and not the diploma should be the place to list the majors and minors which students have earned in college. She added that she believed Dean Hartdagen's list would explain the reasons for the decision adequately. Sue Theobald said "The Senior Class is not happy with the decision and is planning further action." Although she did not say what this might be she did say they were not definite as to what actions they wished to take. Sue stated, "The seniors believe they have put enough time and money into Wilkes to deserve the right to have their majors included on the diplomas. To us the pride and satisfaclion we feel for Wilkes is reflected in our diplomas. We feel we have the right to have our majors printed on these diplomas.'' Sue further stated that Dean Hartdagen told the Friday-Meeting that the.decision to remove the majors was "administrative business.'' She feels such decisions are the students business as well as the administration's. She continued that the college should listen to what the students want, and understand that having. the majors on the diplomas is important to the seniors. She concluded, "The students are not happy''. Bill Turcan which ultimately resulted in the school's reaccreditation. President Capin said that the institution's self-study was widely applauded by the MSA and was even recommended to other schools as an example of a very good report. Capin went on that he was very satisfied with the entire accreditation process because, "it permitted .us to do a searching study of ourselves." He added that the process not only accomplished its accreditation mission, but . it also facilitated the addressing of many problems facing the ~ollege today. When asked what problem would Withdrawal Proposal Passed By Faculty · Despite much controversy and opposition, the four-week course withdrawal policy will be in effect in September 1980. The final step of the procedure was completed when the faculty passed the proposal by a vote of 52-20-3 at its March meeting. The new policy states that the present ten week withdrawal period will be decreased to four weeks. During the first week of classes, a student will be able to drop and-or add a course with only the advisor's permission. From the second through the fourth week, the student will need the permission of the · instructor, advisor and the dean. After the fourth week, a student may withdraw from a C!)Urse only after consultation with the instructor. Those students taking the sevenweek biology modules will be able to withdraw from the courses during the first four I weeks of each module. The positive effects of the 1>9licy are far-reaching, believes Dr. Debate Tonight In C P A - - - - - - - Congressional Candidates ·vie For Dan Flood's Spot Adebate involving the candidates for the special election of the 11th Congressional District on April 9 will be held Thursday, March 27, from 7: 30 to 9 p.m. at the Center for the Performing Arts. The debate is being sponsored by the Department of Political Science and will be televised live by WBRE· TV, Channel 28. According to John Chwalek, coordinator of the event, all seven candidates, vying for the seat left vacant by the resignation of Daniel J. Flood, have indicated that they will participate in the event. The candidates include Republicans James Nelligan and take top priority &s far as the college is concerned, Capin replied that no one problem is of greater importance than another. He continued that the entire situation of the institution will tie investigated and not just one particular aspect. President Capin pointed out that the MSA "felt the reaccreditation study was straightforward, honest, and frank," with no shortcomings prevalent at all. He considered this to be very important because "MSA accreditation tells people you have an institution of acceptable quality." Peter Steve Robert Hudock, and Democrats Richard Adams, Frank Harrison, Paul Kanjorski, Edward Mitchell, and Rep. Raphael Musto. Msgr. Andrew McGowan, St. Pius X Seminary, Dalton, will serve as debate moderator. Members of the panel include Keith Martin, anchorman, WBRE-TV ; Lawrence Souder, WPGM Radio, Danville; and William Lewis, a senior political science major. A limited amount of reserved seats will be available to each candidate and the media with other seats open to the public on a space available basis. The doors of the Wilkes CPA will open at 6:45 p.m. Owen Faut, Chairman of the Academic Standards Committee. First, communication is opened up ~ween instructor and student. The academic reputation of the school is enhanced, thus benefiting the students in many ways. The only way the policy can be rescinded is by a proposal through the Academic Standards Committee or the Board of Trustees, stated Dr. Faut. "The policy will be in effect next year," he said. Along with the new withdrawal policy, a new audit policy will be in effect in September 1980. This allows a student to sign up for an audit 'Only prior to or during the first week of the semester. Patti Sparlow Anthracite Con!. Scheduled Here April 23rd Wilkes College will host an energy conference - "Anthracite: Energy Alternatives for the 1980's • Wednesday, April 23, at the . CPA. The conference is being jointly sponsored by the Department of Engineering, Greater Wilkes-Barre Chamber of Commerce, and the Institute of Regional Affairs. According to Dr. Umid Nejib, chairman of the Engineering Department, the purpose of the regional conference is to acquaint local leaders in business, government, and industry as well as any large user of energy with current technology available for the utilization of Anthracite as an alternate source. Further information on the conference may be obtained by contacting Ms. Sandra Beynon, Institute of Regional Affairs, Wilkes College, Wilkes-Barre, Pa. 18766. �Page 2, The Beacon, March 27, 1980 College's Redevelopment Includes More Housing There may be a new dorm or new dorm space in the future of the college to help alleviate the increased need for housing, according to Dr. Andrew Shaw, Dean of Management. 'rhe cbllege will apply for federal funds through ,the United States Department of Housing and Urban Development by early June. The government should re.il>Ond~ t>Y September of 1980. If the allocation of funds is approved, construction of the new facility would begin immediately. __ . -·Although there is a need for more housing space, building a new dorm is costly, stated Dr. Shaw. Another possibility would be for the college to take out loans. Since interest rates are so high, however, this is :~~~=i:;f:~~;_;!.ve:~ "however, the only problem is obtainingmoneytobuildlt.'' Althoughthecollegewilllose120 dorm students through graduation . and 65 through transfer, Dr. Shaw projects there will be a demand for the 1060 dorm spaces in the fall of · 1980, from 660 returnees and 400 incoming freshmen. There are 775 beds available on campus. Also, there is a possibility that several dorms may be modified slightly, l!_c!_dl!!_g_2(!_~~spac~ .. . .. As a solution, the college is negotiating with the YMCA to take over the residency section. If this plan goes through, another 90 to 95 people would be accommodated. The college is looking into placing the remaining 200 students in the Hotel Sterling. As of March 1980, 70 females and 27 males are housed in the hotel. The Department of Education predicts there will be a 40 percent decline in college enrollment during the next several years. Pr. Shaw does not think this will affect the dorm situation at Wilkes. The sudden increase in dorm students at Wilkes is due to two main factors, he believes. First, there are fewer students in the local high schools; these are usually the comrouters. Second, those that are from the outlying areas such as Mountaintop or Dallas, consider dorms seriously because of the price of fuel needed to commute. Dr. Shaw would like to see a new energy efficient dorm built which would maximize effective maintenance and custodial services. "If by chance,· the money comes up earlier than the HUD funds, we would begin construction of a new dorm then," he concluded. Patti Sparlow F Five Year History-Business Curriculum Attempts To Fulfill Student,s Desires. Are you interested in studying history, but at the same time satisfying a desi_re for a career? The new five year history-business program offers students a chance to do just that. This program involves a B.A. in history at the end of the fourth year and an MBA (Masters in Business Administration) at the end of the fifth. According to Dr. Howard Williams and Dr. James Rodechko, this- program will attract students who were interested in history in high school and want to continue with it in college, while at the same time seeking to satisfy career desires. Students would register as history majors and also complete tise; and also because it combines traditional liberal arts with professional programming. "I see it as a way of combining the two, " stated Dr. Rodechko. . Although this type of program is not unique, Drs. Williams and Rodechko stated there is already evidence of student interest. Dr. Williams elaborated, "I've already had three inquiries - two even before there was any publicity about it." Going into effect next semester, this program will be very easy for students to enter. Both Williams and Rodechko echoed the fact that transfer students and sophomores should be able to .enter this program with relative ease. Dr. Williams feels that the deadline to ormer " Time ,, Editor.......................................... 1 1980 Graduating Assembly~~:!.:::.::~::· T.o H ear M I T p ro f essor · · e Louis · Layton Banks, Adjunct Professor of Management at Sloan School of Management, Massachusetts · Institute of Technology since 1976 has verbally accepted the college's invitation to speak at this year's graduation, stated President Robert S. Capin. Previous to his position at M.I.T., Banks began his career as a Nieman Fellow at Harvard University during 1969-1970. He was ·corresponding editor for "Time" magazine from 1945 to 1961, assistant managing editor for "Fortune" magazine from 1961 to 1965, managing editor of "Fortune" until 1970, editorial director for TIME, Inc. from 1970 to 1973 and a Carroll Ford Foundation visiting professor at Harvard University Business School until 1976. President Capin believes that Banks' speech will deal with the effeet of media on society. "He is a e ting, Art, Biology, Chemistry, History, Earth and Environmental Sciences, Mathematics, Computer Science, Business Education, Secondary Education, English, Theater Arts, Modern Foreign Languages, · Communications Studies, Sociology, and Anthropology. In addition, the Curriculum Committee will be considering a proposal for a minor in Political Science before the faculty meeting. A proposal for a minor in Psychology will be considered at a later date. thused about it and think it is a good idea. Students who are interested can_getinfOf!Dationfromeitherthe busmess or history departments. Lisa Gurka e well qualified speaker, " stated President Capin; "with outstanding credentials." Since the search for a speaker began last June, nine people have refused the college's invitations ineluding four Ivy League presidents, and a Supreme Court Justice. "It is not unusual for problems to arise when looking for a speaker, " . said President Capin. First, many peopie have long-range commitments. Another problem is that most prominent people just do not give commencement speeches. Seniors made several suggestions which were eventually eliminated for various reasons. President Capin stated that student opinion is welcome, however the graduating class must understand that the final decision rests with the administration. Sue Suchanic, a member of the senior class executive council Can-icalaDI CoDl~ittee Approves Minors ID Sixteen ~is~ip,ines According to Dr.Gerald Hartdagen, Academic Dean, the Curriculum Committee of the faculty has approved minors in 16 disciplines, to be recommended for approval by the full faculty at the April 3rd faculty meeting. Once passed by the faculty, the minors will be in effect beginriing with the next academic year. Dr. Hartdagen stated that as of the latest Curriculum Committee work session, most of the proposed minors were considered and have either been rejected or forwarded to the faculty for approval. The Curriculum Committee rejected proposals for minors in Business Administration and Economics. Hartdagen explained that in cases where proposals were rejected, the departments usually required too many credits or the proposal did not meet the requirement of having at most two courses at the 100 level with additional courses at upper levels. The minors which have been ap. proved and designated to go before the full faculty include: Accoun- the prerequisites for an MBA. To graduate with a B.A. in history, 121 credit hours are needed including 30 in history and 30 in the business prerequisites. This program will allow enough electives so the student has a chance to graduate with a minor in something else. An MBA at the graduate level includes 30 credit hours - 15 in core requirements and 15 in 105 levels. Five areas of business marketing, managerial science, labor, accounting, and finance - are covered. Both Dr. Williams and Dr. Rodechko feel that businesses would find this attractive because of the fact that it blends a broad background with business exper- Hartdagen did not wish to release the requirements for the individual minors because they have not been approved by the faculty. However, since the proposals will not be voted upon by the faculty until after registration for next semester begins, the above list of minors has been supplied with the understanding that if a student wishes to pursue a minor in one of these areas, he can get more information from the chairman of the department through which that minor is offered. Louis Czachor 10% DISCQUNJ _OFF ANY PURCHASE WITH THIS COUPON · l I t II I t believes that the administration listened to the seni9rs. "It is important that the students get more of a chance to have rational input in an attempt to unify the efforts to students and administration, " she stated. By Patti Sparlow Colleen Gries . Defeated By Rob Wallace Write-in candidate Rob Wallace defeated incumbent Colleen Gries for the office of Class of 1981 president in the run off election held last Thursday. Wallace tallied 105 votes to gries' 87. Both candidates had previously tied at 57 vQtes apiece in the regular election. In the run.:Off election, voter turn out had almost doubled with over 190 ballots cast. It was the largest turn out for the class of 1981. Wallace's write-in campaign was the most successful in recent years, and possibly the history of the colle~.:.-. 1 DECKOU R'S BEER Across from Bishop Hoban Ph. 822-7045 -Imported Beers-Cold BeerCall in Advance fof- Kegs\and Quattefs (Mvst have LCB Card) Book and Record Mart 115. Main St. WIikes-Barre BOOKS-RECORDS-TAPES 825-4767 Cliff and Monarch Notes __ r'lfl ~iflrflll r'llllJ~fl • I\) ~ i1Jr <' [](]fTI fl (]11 fllliS r.rirl SIJSiflfTIS See Joe, Bob, and Danny -MON.-THURS. 11 A.M.-9 P.M . TUES ., WED., FRI. & SAT. 1 l :00 A.M .-5:30 P-.M .. 288-3751 ~ 0 ~ z G') )> ::::: A z G') en 0 z �March 27, 1980, The Beacon, Page3 SG Representatives To Be Elected Today Listed below are the respected nominees for representatives to Student Government. Each class will vote for and elect six representatives today from 11-1 in the Student Center and from 4:30-6:30 p.m. in the cafeteria. Students must present an I.D. card to vote. The nominees who have previous elected experience are indicated with an asterisk. The Class of 1 9 8 2 - - - - - Theresa Gabana• Chris Lain BobLasbock PatMumin Ana Nunez• Tom Rooney• Lisa Warden Alan Wirkman• The Class of 1983------Corinna Bender* All students voting should note Peggy Butchkavitz the evaluations made by SG presi- Chris Fellin• dent Dave Blumfield concerning Diane Hall this year's representatives. (They Elaine Kerchusky* are printed to the right of this Barb McGee The nominees are as follows: LuAnne McHugh The Class of 1981------- Maureen Morrison _ Carol Benek* Joanne Rice* Marla Brodsky* TerryShemo Steve Demko* Rob Doty• Joe Galli* Tim Palmer• Dana Shaffer ••••••••••••••••••••••• NOTICE This is the last week to buy your Wilkes-Comfort T-Shirt. Only $5.00 while supplies last. Buy one today! NOTICE Anyone interested in working on the "Elect Ted Kennedy for President" campaign is asked to attend a special meeting at Gus Genetti's today, March 26, 1980. The meeting will start at 6:30 p.m. Additional information can be obtained from Dean Hoover's Office on the second floor of Weckesser Hall. NOTICE Anyone interested in being film committee chairman for Student Government for next year is asked to contact Janet Croft at Dana Hall or Dave Blumfield at Denison Hall or leave a message in the SG office, Chuck Robbins ... - -- ----- SPORTING GOODS COMPANY I We Accept Master Charge and Visa 39 West Market Street Wilkes-Barre, Pa. 19701 Phone: 822-1333 '' Free Parking al Hotel Sterling I PATRICK BURKE, Owner Evaluations Of Representatives Completed By SG Presiden-t Recently Student Government President David Blumfield completed evaluations of all the Student Government representatives. The results of the evaluations are presented below to make everyone aware of the work which has been done by each representative. Blumfield explained, "I felt that there was a definite need to have the reps evaluated for the voting , population of the campus.'' He added, "Nobody really knows if the representatives are doing their jobs, since mainly what the executive council does appears in the paper." He feels that it is important that the constituents have an idea of the quality of the performance of the peoplewhohavebeen elected to office. Blumfield noted that the evaluation "should give some sort of representation of the representatives' activeness in SG." He cau- SG Social Committee Presents Report On First Attempt Of 'Parties Unlimited' It was reported, at Monday night's Student Government meeting that the first party held by Parties Unlimited, the subcommittee of the social committee, took place this past Saturday in the Student Center. Speaking for the social committee, Diane Seech noted that the party was poorly attended. Several representatives responded by pointing out that a number of private parties were held the same night. Also, SG President Dave Blumfield suggested that since tickets cannot be sold at the door, some people could not attend such a party if they had not purchased tickets before 6:30 p.m. on the day of the party. In a related matter, SG Treasurer Joe Galli mentioned that this past Sunday he talked with some of the workers in the Student Center. Jfe noted that every Sunday they have to do extra work to rearrange the tables and chairs, and to scrub the tabletops because they are not cleaned after the parties during the weekend. It was suggested the groups sponsoring parties should make an extra effort to leave the Student Center in order. In other business, Blumfield brought up an idea to have SG put aside some money each year in order to help the college bring in interesting guest speakers for graduation. Also, he feels that if this can be done the administration should consider allowing the students to have some say in chos- ing the guest speaker. Blumfield's comments sparked SG into a discussion with many representatives voicing their opinions that the students should have some input concerning graduation. Senior representative Sue Suchanic pointed out that all of the classes should take an active part in graduation since it is a college function and not merely a senior one. SG Advisor Dean Art Hoover stated that he had mixed emotions about the subject. He noted, "Historically and traditionally commencement is an academic exercise." He pointed out that any one guest speaker will not appeal to everyone, and he stated, "to put up a lot of money to bring in an enterfor a graduation exercise ~ tainer would be a sham oil the academic exercise." Advisor Doris Barker commented that she thinks SG's money should not enter into the situation, and she would rather see it put into something else like a stereo for the r..,... . . . . . . . . ., . . . . .. ,. . . . . . . --. . ,. . , .-. . . ~.._. . . ,_. . .,.___._, . . . . . .,. . . . . .-. . ,. . . . - - _ - _ ~ ! EMERSON'S~ ! ~ ·Features: Thurs. Grado and McHale I i Fri. Trish Lupi I ~ Sat. Pete Schaumloffel I ~ ~~ ~ i ~ Show begins at 9:30 ! L . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. __. . . . . . . .. . . . . . . . . . . . .,;,. . a:, . ~ , tioned that the evaluations should quality, 2.0-acceptable quality, 1.5not be used as a detailed analysis of -minimum quality, LO-minimum what the reps have done, but it quality, and 0.0-below minimum should be used to judge how effec- quality. tive they have been in their work The criteria that were evaluated during the past year. were: attendance at meetings, atHe continued by saying that the tendance at office hours, participa- · evaluations should have been tion at meetings, activity in SG started a long time ago. He pointed events, and what Blumfield con-0ut that they were supposed to siders most important--the amount begin last year, but they did not. of effort put into going beyond the According to Blumfield, each · call of duty. representative was evaluated from Because "no particular representhe standpoint of his being presi- tative did not do some part of his dent. "I am the only person who can job", the grades range from 1.5 to objectively evaluate the reps' per- 4.0. Also, due to the fact that • formance over the year, because I freshman reps were faced with a am the one who sees them perform situation that was _new to them, their duties more often than anyone grades of either 2.5 or 3.0 were the else," commented Blumfield . only grades they received. He explained that the evaluation Blumfield commented that these was based on the college grading evaluations are to be taken by the system: 4.0--outstanding quality, representatives as objective con3.5-above high quality, 3.0-high structive criticism which is not inquality, 2.5-above · acceptable tended to offend anyone. Class of 1980 Janet Croft 3.0 Ann Cardillo 3.5 ~ Januzzi's Pizza and Hoagies '1 r:~....cr.,...,.~ 8 BROOK'S I BARBER SHOP I i 125 Academy Street ~ Home Delivery OPEN 7 DAYS 11-1 ~~-~ ~ -- ~ • STYLING FOR MEN & WOMEN .: - ~:i::.;~~~~l~!l~gNOIIIONING • H-'IIR STRAIGHTENING •SCALP~ FACIAL TIEATMENI • MANICURING • SHOE SHINE .£All FOIi Al't'QlNTMENT FRANll • PETE SART°"'° • PROP . ( l:~~SE:t~.) 824-2325 , MAIN FLOOR . 15 S. IIAN<IIN SL . WIIKE S-BAltE . I ~000~ Student Center. Under fund requests, cue 'n Curtain was given $125 to help subsidize a trip to New York City to take place this weekend. The motion passed by an unanimous vote. In other news, it was announced that all newly elected members and all present members of SG are expected to be present at next week's meeting. In a matter related to elections, it was reported that during the recent elections for class officers, the candidates were campaigning too near the ballot box. As a result, in the coming weeks SG will attempt to ammend the election laws so that candidates must stay a certain distance from the ballot box. Bill Keba · Dave Samsel Shep Willner Class of 1981 Steve Demko Rob Doty Joe Galli Tim Palmer Marla Brodsky .. Diane Seecb Class of 1982 Laura Danowski Theresa Gabana Ana Nunez Tom Rooney Mart Swartz AlWirkman Class of 1983 Eric Farber Chris Fellin Joanne Rice Corinna Bender Elaine Kercbusky 3.0 3.5 4.0 1.5 2.5 4.0 3.5 4.0 3.5 2.0 2.0 4.0 3.0 2.5 3.0 2.5 3.0 3.0 3.0 2.5 Elections For CC Rep·• To Take Place Today Commuters will have the opportunity to elect Council representatives from 11 o'clock to 1 o'clock in the student center and from 4:30 to 6:30 in the cafe today. Running for positions for the Class of '81 are: Susan Schwab JoeRubbico Bill Miller John Moffatt JoAnne Bennick Charles Boyer Bill Stusnick Nominees for the Class of '82 are: Maurita Gries Glen Weaver Bev Rothery Joe Knox Sudy Hartdagen · Running for the CC representatives for the Sophomore class for next year are: Mary-Ellen Judge Carola Hanyon David Sedor Amy Elias Next year's commuter council , meetings will be held each Monday at 4:45 p.m. on the first floor of Weckesser Hall. On April 26, CC will be sponsoring a Blue Grass Festival Block Party. The group, the "Mountain Back Strings" will perform and cold cuts · will be served. The party is planned around the Cherry Blossom Festival. Other activities are also planned in conjuction with this festival. In other business, Joe Knox, · President of the Coalition of Independent College and University Students (COPUS ) announced that the writing and petitioning campaigns went well. Word from Washington is that the President's Loan Proposal will not be passed. Joe noted however, "to insure the loan proposal will not be passed, all student leaders are asked to call the White House complaint line (202456-1414) and ask for the Comment Office. This is our last chance to let them know how we feel." Student leaders are reminded to support Bill H.R. 5192 when phoning. Also brought out at the meeting were the Congressional Debates that will be held tonight at 7:30 in the Center for the Performing Arts. Doors will be opened at 6: 45 and there will be limited seating. �,.,. Page 4, The Beacon, March 27, 1980 With Respect The sad news of Professor George Elliot's death was taken to heart by members of our staff. Several of us had him in classes while the rest knew him. As an educator, he was a man very set in his ways but would bend over backwards for the student. Those who had him for International Trade or Economic Georgraphy knew he loved to teach. He was a dedicated, fair, enthusiastic and respected professor. Beyond that he was also an avid sports fan of the Colonels, win or lose, and was loyal as anyone to the college. On a more personal note, many a Sunday afternoon when The Beacon was holding its weekly staff meeting we would often pass Professor Elliot entering or leaving Parrish Hall. He was correcting papers, preparing for a class or whatever. He always greeted us with a smile and went out of his way to make conversation. At a time like this it is both awkward and difficult to express exactly how one feels. We are just very glad that · we got to know him. · Theobald Seeks Support · Over Diploma Dilemma To the Editor: · ·Open Letter to the Students of Wilkes College: Recently a decision was made to remove the majors from this and following years' diplomas. Previously the diplomas read the degree on one line and the major on the next. An example of this would be: BACHELOR OF SCIENCE MAJOR IN PHYSICS From now on the line containing the major will be left off. The Senior Class is now circulating a petition in protest of this action. Any seniors wishing to sign the petition may do so at the elass meeting on Thursday at 11 : 00 in the CPA. I am also asking for the written support of all Wilkes College students in our attempt to have the major line appear on the diplomas once again. Thank you, Susan L. Theobald President, Class of 1980 Editor's Note: This letter was written to be printed hi last week's issue but was submitted after the deadline. ..&.~le --- · ~;:'~ ,f . ·~. . . . . . . . . .- .......... USPS 832--0ll8 . Editor-In-Chief Jim Edwards Sports Editor Managing F.ditor BillTurcan News Eclitor Peter Steve Eddie White III Copy Editor Patti Sparlow Asst. Op-Ed Editor Margaret Scholl Aut. News Edilor Louis Czachor Photographer Bob Gaetano Business Manager Sue Freda Op-Ed Editor Perry Lichtinger Advertising Mana.;er Vanessa Martz CirculaJion Manager Michele Serafin . REPORTERS: Cindy Ercolani. Lisa Gurka, Mary Kutz. SUe Loveitt. Gary Mack, Bill Miller, Rich NordJ}eim. Ana Nunez. Mary Kay Pogar, ·Darlene SChaffer, David Stahl. Advisor George Pawlush Parrish Hall II S. River St. Wilkes-Barre, Pa. 1117M PIIIIUIW weekly daring tbe school year frem Septemlter to May except f• vae.._ periods and semester breaks. Entered as 1ecOINI clau ,-&age ,.w la W. . .Barre. Sead f•m no. 3579 te TH Beacoa. WUkes C'ellege, WIIHHlam. Pa. 187M. S■IKcriptioa nte to D011~tlMle•t1: s.a per year. A•venllia& nte: sue per cel■11t■ laeh. Pllleae: <717> 11Z.a-ta1. •;xt. .a73 · All views expressed are tllose of the incllvidul writer aad ■ot aeceuarily .,.. ,...ueau.., tile celJele. Hartdagen Addresses Graduating Class With Explanation To ''Major'' Problem To the Editor: Members of the Senior Class have asked me to publicize the reasons which led to the decision to remove majors from diplomas. Listing the major on the diploma began at Wilkes in 1972. Initially this. posed no particular problem since a simple statement, such as "Major in Philosophy," was _adequate in all cases. In recent years, the addition of double majors and the possibility of one individual obtaining both a Bachelor of Science and a Bachelor of Arts degree have threatened to turn the diploma into a second transcript. The technical problem of how much to include and where to put it made for an intolerable situation. Adding to the nightmare was lhe realization that, beginning in 1981, students would be graduating with minors. Should one, two, or three minors also be listed on the diploma? The point had been reached where a solution to the problem could not be postponed. Very few colleges or universities include a major on the diploma since the purpose of the diploma is to indicate that an individual has earned a degree. The appropriate document for information about courses, grades, majors and minors is the transcript. The uses for the latter are many, but the former will be used rarely, if at all. The decision to remove a listing of majors from diplomas was not made capriciously. It was the result of careful deliberation and in response to a real problem which demanded an immediate solution. It was not made with the intent of depriving students of anything they had earned but rather enhancing the value of a degree and a diplomas from Wilkes College. Dr. Gerald E. Hartdagen De111.1 of Academic Affairs Fairness OfNew Withdrawal Policy Questioned By Student Rep. Nunez To the Editor: Starting fall semester, 1980, the procedure for withdrawing from a course after 4 weeks will entail getting permission from the course Instructor, the faculty advisor and the academic dean. The faculty voted the proposal in as policy 5220-3 in Its March 13 meeting. The new policy reduces the number of weeks from ten to four in order to make the students more responsible in their courses. Proponents of the policy assert that It will increase dialogue between students and faculty, especially since the old policy allowed students to merely notify their professors well into the semester about withdrawal decisions. The new policy emphasizes permission and discussions with the prof. Also asserted is that the new .withdrawal policy, upon implementation, should increase academic standards and decrease withdrawals. The withdrawal proposal is now policy. However, this policy which one would assume to be an improvement over the old policy, has an Inherent inconsistency that was overlooked or deemed insignificant when the vote was taken. One benefit the faculty will derive is the ability to decide criteria for accepting a withdrawal after 4 weeks. No guidelines were established for this decision, and adherence to denying withdrawals after 4 weeks was emphasized. The major inconsistency in the policy ls the inequality in module courses versus semester courses. Under the new policy a student in a biology module must decide upon withdrawal after he has attended 57 percent of his course. All other students in regular semester courses must decide after 28 percent of the course is completed. Stated simply, according to the new college policy, students in biology modules have what is comparable to eight weeks in a semester course, before making a withdrawal decision. The inequality and a question on summer courses were mentioned in a discussion prior to the faculty vote. The number of weeks allowed to drop in a summer course is proportional to that of a semester course, or 28 percent. This is not delineated in the policy, rather, since this was one under the old policy, the assumptions were made that this element of the policy would not change. It was never formally outlined in college policy. In response to the question of inequality, the faculty were informed that the Academic Committee could interprete the policy and Wallace Thanks Supporters And Promises Exciting Yr. To the Editor: To the Class ofl 981 As my first "official" com· municatlon to you, I would firstly like to thank you for your support, and assure you that I will do all within my power to make our final year at Wilkes successful and memorable. Secondly, to maintain a high level of activity and accomplishment, the officers and executive council need the support and assistance of the entire class. The number of votes cast a week ago represents a signHicant percentage of our class; far greater than any of our past elections. This in indicative of your concern for the outcome of our senior year. All to often we hear of complaints of apathy and lack of spirit here at Wilkes. We have shown that this is not completely true, but just depends on how motivated everyone is to do something. WE can be the class that turns this apathetic attitude around. It may not seem like much now, but later you'll be proud to have had an active senior year to remember. When asked to help with a project, please consider this idea, and join in. Even if you can't spend a whole lot of time, any kind of contribution you can make will help build our unity. Attend the Class meetings; con• tribute your ideas. Don't just be a member of our class, be a PART of our class. I'm looking forward to a really great year. Rob Wallace President, Class of 1981 eliminate the problem. This gross inconsistency can not be resolved by interpretation. The policy states that a student may drop a course prior to getting permission four weeks into the cours It makes no exceptions (modules or summer school) and does not utilize any percentages as in 28 percent of the course completed. Because the approved policy stat~ four weeks when Its intent was an amount of time equivalent to four out of fourteen weeks, the policy should be ammended. As it stands, an unfair situation exists. As a result of the policy, students must become more aggressive. According to Dr. .Owen Faut, Academic Committee chairperson, If students are not getting a fair sample of their course in four weeks, then they are getting cheated. If this is the case, and most students have encountered courses that rambled at the beginning and rapidly became difficult, then it is the students who must make the demands. It is far too easy for students and faculty alike to slowly acclimate themselves into college at the beginning of each semester. However, if the student is to make wise decisions, then demanding a fair representation of course content in four weeks is the only recourse. Ana Nunez Student Representative to the Academic Standards Committee Nursing Student Feels Thievery Unnecessary To The Editor: About one month ago I had a towel stolen out of my wash along with two pairs of socks. I chalked it up to experience and faced the fact that I would never see my towel again. On Thursday afternoon .I was again .doing my wash and took out someone else's clothes in order to put mine in that dryer. In the process of doing this I noticed a towel that looked exactly like the one that Continued on Page 6 �. . March Tl. 1980, The Beacon, Pages Choreographer Rod Rodger•~····; ..................,. ............................................. . Dance Company Shows Unique Style Unusual. Innovative. Interpretive. All these terms can be used to explain the performance given recently by the Rod Rodgers Dance Company. The Company is basically a touring company and has a vel')'. un~q~e STRETCH! ! ! One of the dancers of the Rod Rodgers Dance Company does warm-up exercises before the recent performance by the company. style. They are well known tor their rhythmic and percussion dance pieces. Critics have acclaimed the dance company's work as "some of the most exciting abstract move- . ment around" and "a unique celebration of Afro-American experience.'' Both of these statements are very true. "Tangents" began the program; this piece featured three dancers two females and one male. The dancers performed with long thin rods, which seemed like extensions of the body. The rods were whipped through the air and beat on the floor adding to the movement and rhythm. " Visions of a New Blackness" , "Sweet Blues," "Need No Help", "Box 71" and " Creature" were among the other works presented throughout the evening. "Sweet Blues" was a very fluid and flowing piece performed by two dancers - one female and one male. "Creature" was choreographed by a dancer ip the company, Shirley Rushing. The accompaning music was by Herbie Hancock. Noel Hall was the featured guest artist and was found center stage engulfed in green light with blackness surrounding him lending a quite mysterious effect. Hall was, as one could say, the "creature" mixing many different styles of dance throughout this piece. The company's very dramatic style was evident in "Box 71" This piece was choreographed by Rod Rodgers and featured him as one of the participants. "Box 71" is a tribute to George Jackson who was involved in the prisoner rebellion at Attica State Prison. Mock jail bars were used to give the effect of a man imprisoned and another "free" . The man inside seemed to be boxed in by prison bars while the man outside was imprisoned by society's attitudes. "Rhythm Ritual" was the closing PSYCHING ONESELF UP. This featured dancer from the company is also practicing before taking the stage for her dramatic presentations. number which featured all the dancers in the company. Rod Rodgers was onstage adding to the rhythm with several different percussion instruments. The main NOTICE Jewish students at Wilkes College who are interested in observing passover seder, Monday, March 31st and Tuesday April 1st are asked to contact Mr. Sy Hefter ·at the Jewish Community Center. NOTICE There will be a meeting of the Class of 1981 today in Stark Learning Center Room 166 at 11:15 p.m. Officers and executive council members are requested to be in attendence. ''Three American Women'' Show Currently In Sordoni Art Gallery A major exhibit entitled "Three Pennsylvania Women",, opened in the Sordoni Art Gallery March 22. The exhibit, brought to the Gallery under the sponsorship of the Junior League, will be on display until April 27. perfected their art in Paris and gained international recognition and critical acclaim. Mary Cassatt was a true jmpressionist and is,. today, widely acknowledged as one of the most important painters America h~s The Junior League of Wilkes-Barre is sponsoring the major exhibit, "Three American Women" in the Sordoni Art Gallery. The exhibition will remain on display until April Tith. The exhibit is significant to this area in that, all three artists, Mary Cassatt, Martha Walter and Cecilia Beaux were native Pennsylvanians, who lived and painted in Philadelphia during the late 19th and early 20th centuries. They produced in any century. Cecilia Beaux devoted herself to portraiture and followed a vibrant forthright style often equated with the works of Thomas Eakins and John Singer Sargent. Martha Walter, the youngest of the group, absorbed the lessons ~f impressionism along with such later developments as Matisse's Fauvism, in creating a · vivaciousand colorful style of more distinctly twentieth century character. Together these artists represent some of the most important and c.dmired artistic developments of that era. The exhibition of approximately thirty works will be the first to show, in a collective way, the works of these women in Northeastern Pennsylvania. Art Historian Dr. William Sterling, director of the Sordoni Gallery and chairman of the Fine Arts Department said of these women, "Although there are many successful women artists today, there were very few then. To pursue a career in art as a woman, then, required tremendous courage, determination and self-confidence. That these women made it in this endeavor, testifies' as much to their grit as to their considerable gifts.'' HQurs for the Sordoni Gallery are Sunday through Friday 1-5 p.m.; Thursday evening 6-9 p.m. and Saturday, 10 a.m. to 5 p.m. There is no admission charge and the public is cordially invited to visit the gallery. featured dancer was once again Noel Hall who seemed to be portraying an African witch doctor. He used various percussion instruments along with the other dancers as they "communicated" onstage. The entire program was excellently choreographed and presented. The athletic leaps and strenuous leg extensions portrayed the determination and dedication that the dancers have for their art. It seemed, to this writer at least, that some people found the dances very hard to understand and interpret; this showed by the slow filtration of the audience. Those that stayed to the very last piece seemed to enjoy and appreciate the program. Margaret Scholl , Campus Commentary The Draft (peo- Nerve gas drifting over the fields of Europe; anti-personnel bombs ple killers) used with abandon; 500,000 American soldiers dead in the first six weeks. This is the Pentagon's documented scenario for the war to be fought should the U.S. want to protect Europe from Soviet invasion. While the rest of us watched with horrified fascination as China and Russia flirt with 'limited' nuclear war over the invasion of Vietnam, the Pentagon is gleefully predicting that a war in Europe or Asia is proof we need a new military draft in these here United States. "A war in Europe will be vastly more destructive than the Pentagon has admitted to date/' warns Tom Conrad of the Friends of Peace.Committee, a Quaker group. "Military estimates of the number of American soldiers who would die on the European battlefield have increased sharply and as a result the military has quietly levied new demands on the Selective Service System." Gloria Jacobs (Seven Days) predicts " a nuclear war would turn soldiers and civilians alike into bombfodder, creating the need for constant replacements" - if they can get them. The Joint Chiefs of Staff expect to get them : In November (1978? ), General David C. Jones, chairman of the Joint Chiefs said he had recommended to Defense Secretary Harold Brown that the draft be reinstated so the U.S. could be ready to face a "crisis." "We do have problems with the all-volunteer forces - some fairly serious problems" , he told the media. Short of a new draft, Jones said he would push for classification for all young people from 18 to 26 years old, with mental and physical examinations for the registrants. There's no one, either in the Army or out of it, who thinks military .leaders could take today's "volunteer" army into any war:_ envisioned by the Pentagon. Racism, sexism, and recruitment fraud among officers have seen to it, that, as in Iran recently, "too many officers would hesitate to lead their men into battle, fearing that their soldiers might use them for target practice." In 1976, 16.9-percent of the armed forces recruits were Black; last fall, 43 percent were Black, and the percentage will probably continue to rise as long as unemployment among young Black males hovers around 60 percent. " Volunteers ... are coming far more heavily from the ranks of the poor, the unemployed arid the undereducated than did even the troops in Vietnam, " stated The New York Times in a recent editorial. "No problem is more worrisome than the shortage of middle.class, college-oriented recruits,' ' the paper concluded. Blatant as these statements are, the government (defense department) rarely indicates what they find so worrisome about a poor, Black Army. They often seem to imply that the Army should be more middle-class in the interests of "equal opportunity" (shades of reverse discrimination) . But the real reasons have more to do with the nature of the military (government) itself, which is incapable of purging the system of racism, and unwilling to provide the remedial training needed by many of the undereducated poor. Thus, while minority men and women join the military, desperate for a paycheck and in hol)e of an education, they stumble against the same barriers that blocked them in the outside world. If they rebel, they're thrown in the stockade or given a "bad paper" discharge, worsening a chance of their finding a job on the outside. Parade magazine recently stated that " During the four-year period ending Junt 30, 1977, our armed forces reported 608,000 cases of AWOL (absent without leave). According to General Accounting Office estimates, these have cost the federal government more than $1 billion. A GAO report, "AWOL in the Military," says the problem is likely to get worse. It explains that there is no overall method of treating the problem and that because of the discretionary nature of sentencing, there is no consistency either in punishment or type of discharge issued to the guilty." �Page 6, The Beacon, March 27, 1980 Wilkes Alumnus •••· •••••••••· •••••••••••· •••••••······ •· ••••••••· •••••••••••••••••••••· •••••••••••••••.•••••••••• Dr. Charnetski Described As -Work-A-Holic If you were to ask people to describe their personalities in one short sentence, you could safely bet that there would be a great deal of soul searching to find the proper thing to say. But in the case of Dr. Carl Charnetski, assistant professor of psychology, the answer came almest without effort. He said, "I'm a work-a-holic. I just can't sit still without having something to do." After you take a peek at his work history it becomes qulte easy to see why he couldn't have put it any better. Like many of the faculty, Dr. Charnetski is an alumnus of Wilkes College having graduated in 1970. Although he ended up graduating Magna Cum Laude in psychology he'll admit that his freshman year was not worth speaking about. Soon a•ter that not only did he turn his school work around but he also got married, which he admits helped him to settle down. After graduation, Dr. Charnetski spent two years in Philadelphia working as a consultant to the Systems Research Company. Also during that time, he worked for the Institute for Urban Systems Urban City Science Center where he concentrated his efforts in research and development. Then, the Temple Graduate School offered him a place in a graduate program that led straight into their Ph.D program. At first when he accepted the spot in the program he felt intimidated by the credentials of .the other candidates who wer~ selected. He said, "I really wondered how could I ever compete. There were people with degrees from Harvard, Yale, and UCLA." He continues, "But then I found out that they didn't have any more knowledge and understanding of Uie subject that I did. There were only two people who finished the program in four years: the guy from UCLA and me." Dr. Ch!rnetski related this story, "The two of us became very good friends. Both of us bad families to support so we decided to fil!d wa~s Riley, bead of the psychology department at Wilkes. Dr. Riley was at the convention to advertise an opening on the Wilkes staff. He asked Dr. Charnetski to apply and he did. By accepting the position at Dr. Carl Charnetski to make extra cash to help pay for Wilkes, Dr. Charnetski had to give up many of the research projects he school. We ended opening up.an anstarted at Temple, because Wilkes tique shop on the weekends, and it does not have the facilities for large turned out to be profitable. We had scale research. The emphasis here a great time because it was an exis on teaching, but that . doesn't cellent chance for us to get away bother Dr. Charnetski at all. from our studies yet keep busy. It was a welcome diversion.'' He comments, "I'm enjoying ·While still in the graduate .program, Temple offered Dr. Charnetmosphere is I'm very condusive for atin- . everything doing. The ski a teaching position as a visiting tellectual development. I really like professor. His performance was the students and teaching, and I good enough that they made his director of their Learning Research Center. Then as it does, fate took a turn in direction. At an Eastern Continued from Page4 was stolen from me. I checked the Psychology Research Convention tag and it was my towel. I folded the being held in New York where he rest and decided to wait for the perwas to speak, Dr. Charnetski acson to pick up their wash in order to cidently_bumped into Dr. Robert find out why· my towel was with their wash. In the meantime another friend of mine came to the laundry room and noticed that towels she had stolen were also in the pile. We waited until ten that · night with no luck as to who took them. Finally we decided to go door to door. We walked into two girls rooms and asked if it was their stuff. They said that it was and I imWhen we mention progressive rock, groups like Rush, Styx and mediately claimed that it wasn't. Nazareth jmmediately come to mind. But when we look into the meanThere is no doubt that those are our ing of the words "progressive rock," we find that it is not music that towels, but these girls rent through stagnates. A true progressive rock band tries different styles and new the hotel, not through Wilkes, so we innovations. Pink Floyd is a true progressive rock band. The music cercannot get our towels back or the tainly can be called innovative. It is a pleasure to listen to a band that rest of our things. experiments and uses "different" techniques. This may seem like a petty arguAs you have probably heard, the album is filled with sound effects and ment, but it is not. I transfered her elaborate orchestration. The main attributes of the album, however, to get away from theft, mugging are the music and lyrics. In this age of three-word songs, Pink Floyd, to and murder only to find out that say the least, is refreshing. Roger Water, who penned most of the songs, when my things get· stolen and I is very inept and criticized just about every aspect of society, including think I know who took them, family, education and love. Water pulls no punches and spares no feelnothing can be done. Is this the kind · ings. This album makes a recent disk like Fleetwood Mac sound like the of student Wilkes accepts? If it is, • Archives. The depth and perception is incredible. then I believe that the excellent The album and single "Another Brick in the Wall" are already no. one tradition of Wilkes is slipping away. on their respective charts. The single is a comment an education and As a nursing major it is hard for me teachers, as is most of the first side of the first album. It's haunting to believe that this is allowed. Will lyrics and imaesting chorus makes it the most original single of the these girls steal (if they are the year. ones) from their patients? I cerWhen I first was persuaded to listen to this album, I had my misgivtainly would not and I think that ings; I usually don't like this type of music. But the album is those of us who do not, should not be devastating. punished by those who do and get Cuts like "Run Like Hell" and "Young Lust" are fast paced rockers. away with it. I WILL NOT forgive Ballads include "Mother," "Goodbye Cruel World" and "In the Flesh." for "they know what they have Even if you don't buy this album, find someone who has it and listen to done." I will forgive because they it. You would not want to miss a classic. know not that they are ignorant. George Saba Debbie Taylor Album Review Pink Floyd's ''The Wall'' Thievery-'-· - - don't mind putting off some of my research for it.'' Some of the research he is domg includes; applied medical education in the health science field, work with psycho-active drugs such as anti-depressants and El dopa, and various student research projects done during the school and during the summer months. Dr. Chametski describes himself as a "people person", and his involvement in school affairs backs · that up. Besides being the faculty advisor to the class of 1980 he also serves as advisor to the Human Services Committee. He is supervisor for both the students teachers in psychology as well as the students involved in the Cooperative Education program. He works part-time as a member of the Health Sciences department, and served as exofficio on numerous selection committees for post-Wilkes medical programs. His work in the community is almost as extensive,. including a membership on the Board of DirecNOTICE Get into the Easte r Spirit wi th Chesapeake Hall's Second Annual Chocolate-Peanut Butter Easter Egg Sale. They are ONLY f 35 each. Call ext. 490 , Chesapeake Hall for more information. j~. M tors for the Luzerne and Wyoming County Mental Health and Retardation Centers, as well as the chairman of the Program Com ·ttee which is responsible for approving all new programming for the above mentioned organization. Dr. Charnetski finishes by commenting, "As far as I'm concerned, I'm being paid for having a fun time. I enjoy the o,ther faculty members I work with, I enjoy working with the students, and I enjoy the warm feeling that surrounds Wilkes CollegP-. Why would I want to leave?" . Perry Lichtinger NOTICE Project Upward Bound is accepting appliactions for resident tutorcounselors and academic tutors for the 1980 Summer Program. Tutor-Counselors · should be upperclass persons who have worked with disadvantaged youth and-or have had campus residence assistant experience. Academic tutors should have a 3.0 average in the subjects they wish to tutor. The summer program begin June 22 and ends August 1st. For more information and application forms, contact Anne Graham Director, Ross Hall, Ext. 382. Deadline for applications is April 9, 1980. • S Wi--h, a.◄t:· ,sa11Ill11•aep~ayesn·- ,·n-;i ;c=:::::,o1i-1e==----==)l-111-c::==>-n-c:=::::i-o1i-1e==--,c-==)l-11e=~ I Student Government will be featuring the film "Piranha" Friday night i the Center for the Performing Arts at 7:00p.m. and 9:30p.m. Warren Bush's senior exhibit will be on display in the Conyngham Art Gallery until March 28th. Gallery hours.for the show are 1-8 p.m. daily. Karen Orloski will be giving her senior exhibit beginning March 29th an continuing until April 4th in the Conyngham Gallery. "Three American Women," the major exhibit for the year, is currently on display in tlie Sordoni Art Gallery. The exhibit, brought to the Gallery under the sponsorship of the Junior League, will be on display until April 27th. Gallery Hours for the show are as follows : Sunday through Friday, 1-5~ p.m.; Thursday evenings 6-9 p.m. and Saturday 10 a.m. to 5 p.m. There is no admission.charge and everyone is cordially invited to visit the exhibit. . The Junior-Senior Dinner Dance will be held Friday, April 18th at~h Woodlands. The cocktail hour will be held in the "25th Hour" from 7:3 pm. until 8:30 p.m. The band for the evening will be "Cloudburst. " Furthe etails are being finalized. M ,..,,.r Mk K► Wk ◄k ►k _ W _z 0 Q. ;) 0 u ~ ~ = ~ ;) ~ _. ~ MIDTOWN PIZZA York Pizza New Style We feature Sicilian style pizza squares, serve salads, hot platters and cold or hot hoagies. We have specialties such as: ~ > t""~ > ex:, t""- Stromboli, Calzone, Sausage Roll and Psirmigiana Turnovers . tij Receive $1.00 Off 0 on any large pie with this VALUABLE COUPON '"C 0 . EX!11RES APRIL 3, 1980 r.l ~ z �Wasted Cafe. Food Causes· Rise In Food Sera,ice Costs "Don't spill your milk ... Remember the Johnstown Flood", "Ladies -and Gentlemen, will you please refrain from ......wasting food" , "Butter is often wasted. Take what you'll eat."-These are some of the many signs concerning food wasteage that have suddenly appeared in the cafeteria. From looking at the trays being taken to the conveyor system during meals, it becomes obvious that there is a certain measure of food wasteage in the cafeteria. For specific facts on the quantities wa:sted everyday, the cafeteria management staff were approached with a few questions. According to Calman Baggs, one of the cafeteria managers, there is a lot of food wasted in the cafeteria. "The cost of food is high, and so are other college costs. We are attempting to keep the cost (of attending college) from rising by minimizing food wasteage," he said. The food items most wasted are deserts, salads and beverages. "People take more than what they can eat and then find they cannot finish the food," said Mr. Baggs. When asked for specific figures in terms of dollars, Mr. Baggs replied that it was difficult to do so but gave butter as an example. He stated that butter currently costs $28.29 a case. One and a half cases are used a day and about half of this amount is thrown away. Simple arithmetic reveals that this amounts, for butter alone, to about $21.21 a day, $1,909.57 a semester or $3819.15 a year. "The amount of peanut butter which is wasted is also unbelievable. Some people fill a whole salad bowl with it and then use a very small amount," added Mr.Baggs. Some students have complained that cafeteria food is badly prepared. Afew have even said that it is unfit for human consumption. When these were put before Mr. Baggs he replied that catering for about 800 people involves catering for a wide variety fo tastes. "What I like to eat might not be considered tasty by another person, so we serve two or three different entrees per meal," said Mr. Baggs. "We also have to bear in mind that different people like their food prepared in different ways," said Mr. Baggs. "This," he continued, "means that the cafeteria h·as to strike a middle course and cannot cater for individual tastes." The cafeteria staff work long hours to serve the students, according to Mr. Baggs, "They also try and do their best but cooking for 800 people is not like home cooking," he con- tinued. Mr. Baggs also added that there is always one manager available at meal times to listen to student complaints. "Some students give the ladies who serve a hard time, but these ladies only do what the cooks or manager tell them to," he continued. When asked if there have been any major complaints so far he said there have been none. "Most students seem satisfied,1' he said. "The signs which have been put up have not had much effectiveness so far", said Mr. Baggs. Obviously the question of wasted food, because even this food is paid for, is costing everybody a lot of money. Perhaps it is worth noting that there is a suggestion box placed near the tray-veyor and this box is for suggestions concerning the preparation and serving of food in the cafeteria. ,.:.C:::Wfu0:::;::;;,~:''::,:<':ci:«=:½~{;:::,{,:::·=·:.\i::::,,,. ·"''"~ MUSCLES-Wayne Castle, second from left, wen his second Mr. I' Wilkes contest. It was held this past Sunday in the CPA. The contest was sponsored by the college Barbell Club. Castle is standing among other I contestants who were not identified at press --time. . ·· . --- . . -• - - ID C Pres. To Attend Summer Conference At the IDC meeting Sunday night, IDC President Mike Stapleton proposed that IDC send its president to the summer conference of the National Association of College and Tony D. Sibiya University Residence Halls, to which IDC belongs. Stapleton Newly Developed P r o g r a m - - - - - - - - - - - - - - - remarked that, each year, a new president is elected to IDC; thus, the president is relatively unfamiliar with the duties of the position when he first takes office. By attending the conference, however, the newly-elected president will be able to find our what other colleges are doing, and thus bring back new · The Wilkes College Alumni "Social Obligations," "Mor- inost of the professionals coming in ideas for IDC to work on. This will Association is continuing with the tgages," and "Buying Stocks." are attorneys, accountants, enable the new president to_start college's philosophy of the educaMs. Hallez explained · the par- bankers and ninety percent are planning the year's activities tion of the whole man with their ticulars of certain topics, "Under alumni. There will be approximate- earlier. newly developed seminar program One IDC rep suggested that the social obligations some areas that ly 15-20 professionals participating Skills On Survival. The seminar will be covered are : social in the seminar which will consist of vice president also bf' sent to the will be held April 12th from 10-2p.m. courtesies, such as, introductions, each person giving a short lecture conference. It was decided that the on campus and is for junior and correspondence, situations when a with most staying for a panel president would definitely go, but « 7 > ~ ~ ~ . q ,,,i?·K~··'f seniors at Wilkes. The intent of the Jetter is better than a phone call and • discussion afterwards and others · that the vice president would go onp REGNANT? § program _is to ~id .upper-classmen vice-versa, entertaining, dressing entertaining questions as soon as ly if the extra expense is within the properly present yourself to a limits of the budget. • § m managmg their lives and careers their lecture has finished. business and so on." "Many of the participants are t:~pleton ilnnounced that N EE D HELP ·? effectively after graduation from the college. "Money Management" will entail coming from out of town and giving nominations for all IDC offices will Confidential Counseling Tanya Hallez, assistant director discussions about budgeting, thrift, up valuable time to come to the col- be held at the next IDC meeting, . of Alumni Relations feels, and savings; "Buying Stocks" will lege and offer their help and ex- which is on March 30. He stated that Pregnancy Testmg "Something has to be done for the include the topic of investment. periences to the students," the anyone who has been an IDC rep for one year may run for any office. students to prepare them for the Ms. Hallez stressed also that assistant director concluded. Allentown outside world. The Alumni want to The IDC president will be elected on April 10, a Thursday. All IDC of-. Women's Center do something for the students to ficers will assume their positions on §§ fl ' ..L' j _1,1 . '.I:' 1 ( 215 ) 264 5657 · help th~ tra~ition from student to · . April 20. § - _ - productive citizen." Housing Director Paul Adams ~ . ~ This is the first year for the Skills UT II reminded the IDC reps that 1980 is a «7>~ , . q , ~ ~ , , q ,, On Survival seminar and Ms. census year. He sfated that all ·. --------·-1 Hallez hopes that it will be -_ · t dorm students will participate in , beneficial in that the seminar will I inform the students of what is Who are we? ... The Wilkes sions in today's world situation. Our the census at school rather than at · __ I available to steer them in the right Chapter of InterVarsity Christian faculty advisor is Dr. Frank Bailey home. The R.A. in each dorm will _ direction. Fellowship. What are we? ... a of the Physics Department. give dorm students a questionnaire The seminar program will indiverse group of college students This week we will start having for the census. ARMY & NAVY elude such topics as "Living in the both dorm and commuters, major- fellowship meetings every ThursAdams also reminded IDC Big City," "Insurance," "Real ing in areas from Commerce & day from 9:30-10:30 p.m. Here we members that housing contracts 113 South Main St. and Renting, " Finance, Biology, Environmental have a chance to share faith ex- will be sent out at the end of this Downtown W ilkes-Borre t Estate-buying "Loans," "Legal Services," "ConScience, to History & periences, personal concerns, or week to the students' home. A $50 HOURS: Doily 10 a.m.-S:30 p.m. t sumer Protection," "Money Philosophy.Music, Mon. & Thurs. 10 o.m.-9 p.m We include both discuss Christian viewpoints. We deposit is required as soon as possiManagement," "Income Tax," Roman Catholic and Protestant usually sing a song or two and ble so that dorm students may be I "Family-Marital Counseling," faiths. Why do we meet? ...Our pur- sometimes we have guest speakers allowed to take part in the room I pose is to help Christians grow from local churches or neighboring selection process. tcoward maturity as disciples of colleges. Every Wedenesday from Mary Kay Pogar ~ hrist, to provide fellowship which 3:()()-4:00 p.m. in SL Room 209, we ffl4 • _ f r promotes Christian relationships hold Bible study centered on the livNUMBER 9 i based on Biblical concepts of unity, ing example of Jesus Christ. Every NOTICE 1)l J love, joy, and encouragement, to Friday at 5:45 p.m. we will be · The Class of . 1981 will hold a DENIM-CORDUROY i SHOP \ lead others to personal faith in eating together as a group in the meeting today at 11: 30 noon in , t 9 N h s Jesus·Christ as Savior and Lord and cafe. Presently we are coStark Learning Center room 166. i -PLUSi J W. ort ampton t. to develop a global concern for missponsoring a film series called Executive council members and of, ARMY PANTS Wilkes-Barre, Pa. 18701 t "How Should we Then Live" which ficers are requested te be present. PAINTER PANTS ! ~ Boutique•Jewelry•Clothes J has 3 remianing films you won't i FARMER JEANS t i NOTICE want to miss. Posters on all our ac' SWEATSHIRTS J Layaway Available t All SG representatives are re- tivities can inform you on the films FLANNEL SHIRTS i \ We Accept Mo st er Ch~rg~ & Viso l quired to return their constitution and where our Thursday meetings Boutique Fashions At ! i J and bylaws book to Bill Keba in the will be held. Everyone at Wilkes is __ ,__,.!~~!:~_J L__.._.._.._..__..._..__.__..._..._..__..j SG office. welcome. .I, ! Al umni Association To Present ''Skills On Survival'' Seminar t l C'J..r,·st,·an r;,el'owshi1n Slates R egular "~eekly1u4eet,·ngs I I Uh. l,ee- , I I I II \ I.._..._...-.._..._.._.._..._..__...-.._..,_.. I\ I I i �Page 8, The Beacon, March 27, 1980 "Beaten To H e l l " - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Pickering Bathrooms Slated To Be Replaced The bathroom facilities in Picker- damages something in the dorm. ing Hall will be replaced this sum- Also, if areas of the dorm used by mer in order to improve the ap- all its residents receive any pearance of the rooms and to make damage, all the residents are the facilities more suitable for charged ~ually for that damage. ·Adams stated, "Mr. Shepperd will everyday use. When Comptroller Joseph get his money back," when he Chisarick explained the budget for leaves, if there is no common the coming year at a recent Student damage to the dorm. Government m~ting, he noted that the facilities were not being replaced because of their age, but because, "they have been beaten to hell." Housing Director Paul Adams agreed with this statement but he added that the building is a men's dorm and the bathrooms, like the other parts of the dorm, get a lot of use and abuse. Adams also pointed out that the building is poorly designed in that the walls do not lend themselves to s..pporting metal stalls. A letter appeared in last week's issue of the Beacon which called attention to the reportedly poor condition of the bathrooms in Warner House, one of the dorms in Pickering Hall. When asked if the complaint was legitimate, Adams responded by saying th~t during the week the bathrooms are· cleaned everyday by the college housekeepers, but on weekends it is the responsibility of the dorm residents to keep the rooms clean. He continued that the weekend before the letter was printed, the Warner House bathroom was not in very good shape since the residents and their visitors did not keep it in good condition. Adams also noted that the Warner House area receives the most traffic because it · is located over the bookstore and a lot of people travel through the dorm on their way to and from the cafeteria. Adams went on to say that when a student has a complaint, the procedure usually followed is that the student informs his resident assistant who then informs the Housing Office. In this case the Warner House RA reportedly received no complaint from the dissatisfied student. "The day before the article appeared," commented Adams, "I had all the guys in the dorm paint that bathroom because they had abused it." In his letter, Paul Shepperd also questioned what was being done with his $50 dorm damage deposit. Adams explained that the deposit is not collected for the purpose of making improvements, but the money is held in case a student 1 NOTICE Applications for booths for the Cherry Blossom weekend canival are now available in the Library, bookstore and the Student Government office. These booths can be games, food, handicrafts or whatever else you can imagine. Please return to the SG office by April 12. NOTICE Anyone interested in working on the "Elect Ted Kennedy for President" campaign is asked to attend a special meeting at Gus Genetti's today. March 26, 19841. The meeting will start at 6:30 p.m. Additional information can be obtained from Dean Hoover's Office on the second floor of Weckesser Hall. After reviewing the conditions in bathrooms on the first floor of Pickerin[ ·iall, it could be seen that . of the rooms the stalls were falling or had fallen down and the bathtubs were dirty. Adams stated that the bathtubs are in the condition they are in because "they (the students) dump _arbag~_in them," and he adtlie ded thaf in such cases the . Adams noted that the problem will housekeepers cannot be expected to be corrected and, in addition, a secclean them because it is not their tion of carpeting in the hallway will job. have to be replaced. Also, in the Warner House Adams concluded that whenever bathroom there is a problem with complaints are received the college the tiles and drain in the showers tries to act on them as soon as possicausing water to leak into the ble. hallway outside the bathroom. .K)HN CARWfER'S UTHE FOG" ADEBRA HILL PRODUCTION From the aeator Starring ADRIENNE BARBfAU, JAMIE LEE CURTIS, JOHN HOUSEMAN of ·Hatlc,weenmmes aoo IJANET LEIGH as Kathy Williams! . the .1nultimate expenence 1e1-1W'I01:• aoo starring HAL HOLBROOK as Father Malore Prooucoo by lIBRA HILL Written by JOHN CARPENTER and DEBRA HILL Dirocted by JOHN CARWfER -11 Executive Producer CHARLES B. BLOCH an ENTERTAINMENT DISCOVERIES, INC. PRESENTATION .&AVCO EMBASSY PICTURES Release C •trj ... vco U t 9ASS~ PICl UftlS ~ Read the BANTAM Book R 11HTI11cT■D UIDU 17 llfOOIIU ACCD.,AHIIC PAl(U ftlt ADULT CUAlltAI OPENS MARCH 28 �March Tl, 1980, The Beacon, Page 9 Lacrosse Team Opens Saturday At Widener Billy Adams, freshman Eric "Slip slidding away" is the best Farber and Modica. Adams, a 6' 185 phrase to describe the 1980 Wilkes pounder from Bethpage, N. Y. was College lacrosse camp which open• the leading Middle Atlantic Coned three weeks ago, in preparation ference scorer in 1978 and could be of the upcoming season. a strong point in the offensive atThe stickmen practice and play tack. their games on the field behind the The Pohorley's, Gregg and Glenn football bleachers. They have been held down the first defense posiworking-out on the field which is tions. The brother combination are frozen on one side, due to the shade both sophomores from Whitehouse from the bleachers, and like quickStation, N.J. and were first team sand on the other. Despite these All-Stater's while in high school. poor conditions, rookie coaches, Gregg is 6'1" and 180 while Glenn is Brian Blesi and Bill Harris have 6"1" and 205 pounds. been working with their diversified Jeff Harper, a junior from Endteam of veterans and newcomers. well, N.Y. is a 6' 170 pounder and Blesi and Harris are two former broke the starting ranks for the Colonel lacrosse stand-outs and apfirst time in the scrimmage. His impear to be very optimistic on the provement should allow him to see other side of the white lines. Most alot of varsity action in the mid· players think of their new mentors field this year. as an added dimension, saying, In the second mid-field were Pete "It's like playing on a clue team". Canine, a sophomore from Crofton, is a 5'11" 200 pounder and also "We can play tough and work hard Md.; John Nordstrom, a sophomore utilizes his quickness. Three and still enjoy it". Blesi works with from Whitehouse Station .and freshmen who show a lot of potenthe attackmen and offensive game, freshman Kevin Cavanaugh. tial and played third mid-field are half against Sienna, while yearling while Harris is the goaltending exCanine is a not by any means one of Tracy Cloth, Alex Rae and John pert. While at Wilkes, Harris . Paul Szcepanski filled in during the the biggest guy's on the team at second half. Tom Heller, the big McCarthy. averaged 13.9 saves per game. 5'6" 155, but he capitalizes on his 6'3" 235 pound senior from Carle Carl Schulteis also played in the Wilkes lettermen who will bolster quickness on the field and will be an second spot at the defensive posiPlace, N. Y. was in the starting the squad include Mark Sanders, asset to this year's squad. "Nord" lineup at attack and was joined by tion. Schulteis, a junior at 6', 180 Joe Burnett, Jeff Harper, Tom Heller, Glenn and Gregg Pohorley, -lk wr ►► ➔John Larkin, Rich Modica, John Nordstrom, Dave Singer, Billy Adams, Pete Canine, Carl Schulteis. Lost through graduation or other are . Blesi, Bernie ••===►t1U-IC==>1-1to-c=:==►-:1e==:,t►st·-===--:-tc:=::::)l-ltkC::==--tc-==~-11-c::==>1◄1~-===►-:11-1<==~-••-c=::::x Donachie, Bob Taylor, Warren and our goal is a winning record," 1980 team. There is nothing like ex" We have never really had the Wray, Bryan Savage, Brian explains Rokita. experience we have this season. perience." Recher, Todd Noll, Bob Matzelle, He says that Wilkes has a chance That is why I look for a good year Another senior expected to aid Mike Miller, Dave Hadley and Jim at its division in the Middle Atlantic if we play up to our potential." the team is Kevin O'Brien. Holding Hague. Conference, but Elizabethtown will Those are the words of Wilkes Colup the junior class representation The Blue and Gold recently be the team to beat. "E-town will be lege men's tennis coach Tom will be Pittston's Stan Manoski. scrimmaged Sienna College and the team to beat this year in our Top-notch sophomores include Rokita. ended on the short end of a 12-4 verdivision, and we have never beaten The Colonel netmen are looking Dave Battle and Barry Spevak. dict. But the Colonels lost that them. But if there is a season when · to improve last year's 7-5 slate, but Roldta mentioned that freshman match due to a disappointing first we have a good chance to, well it's Rokita adds that the 1980 schedule Marcus Eckert has been very im• half which gave the visitors an 8--0 1980!' pressive in pre-season workouts. will be tougher than year's past. advantage. Second half action saw The Blue and Gold will open the "We have dropped a lot of easy " That's not our whole team," says the two teams battle to a 4-4 1980 season this Saturday at home Rokita, "we have a lot more than teams from the schedule and will be deadlock. Blesi and Harris will on the Ralston Courts hosting faced with a tough card this year.'• can help the program." have this week to rectify the Juniata College at 1:00. On April 2, "Over the last four or five years, Leading the way for the Blue and mistakes made in the Sienna conthey will be home with Ursinus ColGold will be the senior co-captains we have begun to get talented test, as the season officially opens lege at 3:00 and on April 8, the ColMike Hromchak and Bill Murtagh. players. And this year, we have a on Saturday at 2 PM . at Widener onels will host rival Scranton " My co-captains have seen a lot in great mixture of talent and exCollege. University in a MAC and MIC game their years at Wilkes, " says Rokit'a, perience. I look for a good season Leading the Wilkes scorers was at3:00. "and this will help them guide the Rich Modica, a sophomore from Plainview, N.Y. The 6'4" 215 pound Attackman hit the net three times and will be counted on this season. Also finding the range was senior Joe Burnett, a native of Binghamton (Gore LGN Hall) . At 6', 175 pounds, Burnett is one of the Blue and Gold " bruisers" . Another New Yorker, Mark Sanders, a 5'10" 180 pounder from West Islip is on the " bruising squad" and will add depth in the midfield. Last spring Sanders won numerous face-offs for the Wilkesmen. Dave Singer, a 6', 165 pound goalkeeper from Fairlawn, N.J. held down goal duties for the first - "Experienced" -- -- -· -- ◄-Tennis Team Ready .. MOTORCYCLE FOR SALE 1973 HONDA STREET TRAIL 350CC Asking $400 Good Condition Call 829~4096 Co-captain ·••.,.,-,,..m,, · -- -- ' BIii Murtagla. Mike ffronaclaalc pounds is from King of Prussia and saw limited action last season but is expected to play more this year. Another freshman likely to play alot of time is defenseman Larry Buffalo. In the Sienna game, two former coaches, Jon Hobrock and Bill McArthur were the fellows running around in the black and white stripped shirts. Did you know those guy's called 10 penalties against us. Imagine that! Well-maybe our guy's were trying to take ad· vantage of the referrees. Looking ahead, Wilkes returns home on Wednesday to _..eatertain Dickinson CollegEnn a 3 PM. encounter. Last year the Blue and Gold was victorious · 11-6 over the Carlisle team. l~KEs ,l 1 \ Brian BJesl BOWLING RESULTS Wholesale changes took place last Friday night in the Wilkes College Mixed League. Only Bud's were left unscathed as they lowered their magic number for winning the Atlantic Division to four by sweeping the Vets Club I. However in the Midwest Division the Assorted Nuts, paced by Lisa Hughes' 1911-538 , and Marha Lasco's 469, shot into first by sweeping Good News. Out west, the Whippets forged into a tie with the Avengers by taking two fo three from the Vets Club II. Two other Pacific Division contenders squared off with the EE's taking two from the BS'ers (Kathi Roman 130-332) leaving those teams one and three games back respectively. Standings ATLANTIC DIVISION Bud's Compressor & Supply 19-5 Mother Brothers 14-10 752Crew 14-10 Poky's 13-11 Veterans Club I 7-17 MIDWEST DIVISION Assorted Nuts 14-10 Aristocrats 13·11 1()-14 The Force The Pack 8-16 Good News 8-16 PACIFIC DIVISION Avengers 14-10 Whippets 14-10 EE's 13-11 BS'ers 11-13 Veterans Club I UH 4 Nukes 7-17 Others: Stan Ray 213-495, Chris Fields 180-486, Bill Petrick 500, John Yudichak 517. �Page 10, The Beacon, March 27, 1980 Women's Softball Set To Open, Roberts Looks For Good Year " It's going to be a rebuilding year," said rookie coach Nancy Roberts in discussing the upcoming Wilkes College women's softball season. " We lost a lot but we'll have some good young people to replace them." Gone from last season's 9-7 squad are four of the. top six hitters. Junior Diane Kendig from WilkesBarre led the team a year ago in hitting with a .568 average but will not return. Also gone are Mary Lynn Drebelbis, .410 who transferred; Jackie Wiendl .385; and graduated Debbie Yedlock who hit at a .309 clip. Returning top hitters include sophomore Mary Jean Farrell .358 and senior captain Mary Jo Frail .304. Both are graduates of WilkesBarre Meyers High School. Also returning this year aft~ a year's layoff due to an injury is senior Sue Freda, outofCallcoon, N.Y. Roberts takes on the coaching reigns this season after completing an historic performance as the head women's basketball coach leading the women cagers to their greatest season in history. Gay Meyers, another outstanding coach, handled the head softball coaching chores last season, and will serve as an assistant mentor this year. Last season, Coach Meyers led the girls to the NPWIAA crown and the runnerup spot in the Middle Atlantic Conference and the Metro Intercollegiate Conference. "We will have some depth this · season," ,eommented Roberts. "But we will need experience." Another problem has been the weather. The coaches have been having a difficult time finding the right people for the right positions. As it stands this week, those vying for starting positions in the infield are : Frail, Mary Jean Farell, Cindy Rossi, Lynn Yedlock, Stacey Keeley and Joyce Walsh. AVAILA BLE SCHEDULES • Coach Dave Kaschak has announcII II b o-ed ed that women's-c vo ey a ftb II h d I Intramural and so a sc e u es will be available today in Weckesser Annex and the gym. • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • : • • • • as Wilkes' top reliever. The team has two scrimmages scheduled for this week with The outfield is also up in the air as Freda is the only experienced player. Player Sparanguler, by Eddie White Ill '••••HH• SOFT B A L L ACTION ,........ •H•HH•~•••••••••c•••••••H • • : • • weather permitting as Tuesday they face Bucknell and Thursday the Scranton campus of Penn State, arrives at Kirby Park for a 3:00 game. The season will officially start on March 31 with Upsala College in East Orange, N.J. The ladies will return home on April 3 with Baptist Bible at 3:00 and host rival King's College in a MIC and MAC twin-bill at2:30on April 9. Gary Mack Yedlock, Carol Hagan, Rose Shanahan, Judy Kopperman and hockey star Pam Snyder are candidates for the outfield. The catching position has no less than four quality players Including Yedlock, Shanahan, Karen Johnson, and Helen Brannon. The pitching staff is young, but talented with Cheryl Frystach, Linda Dayer and Ellen Van Riper expected to be starters. Frail is the Colonelettes' answer to Bruce Sutter of the Cubs BEACONSPORTS QUIZ 1.) Who has won the most Boston Marathons (7)? Hint: It's not Ken Pascoe. 2.) Who is the only player besides Wilt Chamberlain to have scored over 20,000 points, average 20 points a game and have over 14,000 rebounds? Hint: It's not Luke Jackson. • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • : • • - 1980 Wilke• College Women'• • : Between The White Lines • • • : • . ., • . Intramural Basketball Team : e• eeee eeeeeeeeeeeeeeeeeeeeeeeeee 3.) Who holds the major league record for most balks in a season? Hint: It's not Dennis Lamp. 4.) Who has the maJ·or-league record for most consecutive pinchbit homers (3)?. H1'nt·. It's not v1·c Davalio. 5.) Who is the only player to lead the National League in triples in three successive seasons? Hint: It's not Greg Luzinski. 6.) Who tied the major league record by allowing four grandslams in a season in 1979? Hint: IT IS Tug McGraw. 7.> Who set an NL record in 1979 for the highest lifetime fielding percentage ( .968) by a third baseman? Hint: It's not Phil Marino. 8.) Which pitcher was involved in the most combined shutout games (5) in 1979? Hint: It wasn't Wally Cox or Jack Brabant. 9.) Who is the leading lifetime baseball hitter at Wilkes College? IO.) Who was the baseball coach at Wilkes before Gene Domzalski? Hint: He is still on the athletic staff. Answers I.) Clarence DeMar 2.) Walt "Bells" Bellamy 3.) Steve Carlton 4.) Del Unser 5.) Garry Templeton 6.)Tugger 7.) Ken Reit,i ::;:~~;:::!!: IO.) Rollie Schmidt Bits and pieces: ... look for the Wilkes tennis team to have a super year under veteran coach Tom Rokita. One of the top Colonel netmen is former Coughlin standout Dave Battle, who is never without a racket ... do you want to see some super action this spring? Well then take in some lacrosse at Ralston Field. Lacrosse is growing in America and is becoming very popular. It's a tough sport and without a doubt, a sport of ME N. It combines all the roughness of football. rugby and mugging. You have to be tough to play that sport. Get over an(! support your Wilkes lacrosse team .. . the Wilkes golf team of veteran coach Rollie Schmidt will be hard pressed to repeat its Middle Atlantic Conference title of a year ago. The Blue and Gold won the title with a four-man team which included only one senior ( Joe Skladany). But due to academic problems, the Colonels have lost two of its top freshmen of last year. Rollie Schmidt will have to come through with another super coaching year if Wilkes is going to experience some of the success it had in 1!17!1. Mark Lepore has been named captain of the 1980 Colonels - he's the only survivor of last year's MAC title team . Skladany'·by the way, should be in the pro ranks soon . .. saw former Wilkes basketballer Nick Holgash playing in the 24th Annual Polzer Open Tournament in Nazareth last week. Nicky hasn't lost a step and is still the tough player Colonel cage fans remember . .. women's softball team is prepping for a good season behind energetic coach Nancy Roberts ... gals are out to get Scranton and King's . .. did you know that Scranton has captured the first five sports in the Metro Intercollegiate Conference (MIC ) action . . . Scranton's girls were responsible for "Duh U" winning the overall title a year ago . .. WBRE is · hoping for a good speaker this year . . . last year was Donna DeVaronna ... this corner likes Al McGuire, but would settle for Billy Packer .. . Packer's brother by the way, a basketball coach in Allentown. plays on an open-league team with Ron Righter . .. the more we see Larry Bird. the more we think he could become the best player in the NBA history he can do it all .. . Joe Barry Carroll of Purdue lacks the intensity to make it in the NBA ... NBC gets an "F" for trying to make women's basketball title game out to be like World Series . .. officials are asking for trouble making schools like Penn State and Notre Dame, give equal money to girls sports. When they draw 80,000 per game, then do it ... Ali coming back is a joke, but he's proving again that there is a sucker born every minute . .. and where have you gone Duane Bobick? .. . most Division I, (and sometimes Division III) basketball players take a hike when the season ends and skip finishing for their degree, but not Marquette's sensational "Sudden Sam" Worthen. Our scout in Milwaukee, Gene the Machine Blaum reports that Sam is still in school and will graduate. Let's give credit to that man . ... congrats go out to Wilkes freshmen baseballers Sam Berto and Rich Geffert. They both received awards at the last week's annual Hughestown Sports Dinner. Berto earned the sportsmanship award. while Geffert was awarded the "MVP" ... Hoban's Mickey Banas earned the basketball "MVP" and sportsmanship honors ... best line came from Mickey's mother and number one Hoban fan - Flo, who said." The MVP award is Chet Hine's (Hoban's coach) , but the other one is mine. " Mickey is a super athlete w.ith a super attitude ... Did you know that Mount St. Mary's, our favorite Division II basketball team lost by TWO POINTS in the NCAA Regional to Virginia Union. Va. Union went on to win the national title. And the MOUNT will have all its starters back next year ... King's cager Joe Hand • as made the Monarch baseball team as a third baseman ... too many people underestimate local high school basketball and overestimate the "Philly" or "Big Apple" type. Hoban's-narrow loss to super Roman Catholic should have silenced critics ... I still wish some of our coaches would recruit one-tentlt.as much as Ron Righter, so we would not have to suffer through any "11ore losing seasons ... Ed Mollahan received his All-ECAC award last week, congrats Big Ed ... now the world knows Jim Kearney's nickname is "Rainbow" ... former Wilkes cagers Steve Ference and John Zapko, along with Ron Righter are playing for Valley Sportsmen, coached by Doc Moses. in open leagues throughout the state ... Darrell Griffith of Louisville is the best dunker we ever saw, second is Toby Kimball ... George Pawlush says look out for the Boston Red Sox this year. but our pick in the AL East, although we hate to admit it, is the Yanks. They just have too much talent to lose, although you know those impeccable battling birds of beautiful Baltimore will be there to the end ... look for Billy Martin's A's to win in the West, and the Phils to win the NL East while Houston takes the West ... The Astros should beat the' Yanks in the Series ... Stabler could put the Oilers in the Super Bowl next year. Those former Alabama QB's are tough ... Pete Bryan says lookout for the Dodgers ... King's cager Dan Frascella might play pro ball in Europe next year, he's good enough to ... Ed Donohue of King's made a trip to this year's final four tournament, bet big Ed had a good time ... look for Philly's Greg Luzinski to have a super year for the Phillies, pass the word, the Bull is back ... and the Sixers will choke like all Philadelphia teams, also look for Flyers to fade in playoffs ... Iowa's Lute Olson deserved coach of the year, not Ray Meyer ... former Wilkes assistant baseball coach Jerry the Bear Ravitz is how head mentor at Nanticoke Area High School ... Wilkes harrier Ken Pascoe still can't explain the demise of Trojan basketball this year. �March 27, 1980, The Beacon, Page 11 ColonelsRankedllthlnNation, Open Saturday At Kutztown State GOLF CAPTAIN NEEDED - Mark Lepore (left ) has been named as captain for the 1980 Wilkes College golf tea m, it was announced by coach Rollie Schmidt, on the right. The Colonels will be defending · their overall Middle Atlantic Conference title this season.Lepore finished in the MAC individual racein the seventh spot. Joe Skladany, who has graduated, placed third. Wilkes ended it 1979 campaign with a 8-3 slate and will open this season on April 2 with an away triangular with Ursinus and Lycoming. On April 4, the team will travel to Haverford and then meet King's on April 7 at the Monarchs course. Rich Nordheim will have an indepth season preview in next week' s Beacon. The Wilkes College baseball team will open its 1980 campaign this Saturday when the Blue and Gold travels to Kutztown State College for a twin-bill. On Tuesday, April 1, Wilkes will travel to Schautz !5tadium in Dunmore to meet Scranton University before meeting Muhlenberg College the next day in the home opener at 3:00 at Artillery Park in Edwardsville. On April 8, the Wilkesmen will travel to meet King's College. The Colonels of Dave Kaschak will be out to improve on last season's 16-9 slate. Last season broke Wilkes three-straight 20-plus win seasons and three straight appearances in the NCAA Regional Tournament. If Wilkes could win its won MAC April 19 April 23 April 26 April 30 March 3 Upsala College OPEN DATE Swarthmore Lebanon Valley Franklin & Marshall H A H A IIOi+'E SCHMIDT, Coach . ;•.: TENNIS TOM ROKITA, Coach NANCY ROBERTS, Coach March 3.1 Upsala College A April 3 Baptist Bible H April 9 King's (DH) H April 14 Misericordia A April 17 Bloomsburg State (DH) H April 22 Susquehanna (DH) A April 24 Marywood College A April 26 Scranton (DH) A April 28 L. C. C. C. H April 12 Keystone (DH) A April 19 Keystone (DH) A March 29 April 2 April 8 April 10 April 14 April 16 April 19 April 21. April 26 April 30 Juniata College Ursinus College Scranton University Susquehanna King 's College Lycoming College Elizabethtown Scranton University Albright College Muhlenberg April 2 ; ·l}rsinus/Lycoming A Apri• 4 ·t1avertord A April 7 ·' ·King's College A April 10 Scranton/Upsala A April1f . , FDU/King's A April-16 .. King's College. , H April 17 Moravian/Muhlenberg H AprUl, Susquehanna H April 23 East Stroudsburg H April 25 Albright/ Juniata A May..1.. Lebanon Valley/Scra~ton H April 28 MAC Tourney Delaware H H H A H A A A A A LACROSSE CHUCK MATTEI, BILL HARRIS, BRIAN BLESSI, Coaches March 29 April 2 April 4 April 9 April 12 April 16 Widener College Dickinson College Bucknell University Western Maryland F. D. U. Haverford N. Y. STYLE·PIZZA and SUBS'at ANTONIO'S A H· A H H A BASEBALL DAVE KASCHAK, Coach March 29 Kutztown State (DH) April 1 GOLF WOMEN 'S SOFTBALL section and possibly the MAC overall title, the Colonels would have a good chance at hosting the NCAA Mideast Regionals. In the pre-season Division III rankings by COLLEGIATE BASEBALL, the Colonels are randed no. 11 in the country. Last year's national champion Glassboro State of New Jersey is top-ranked. Kaschak has announced that junior hurler Jim "Rainbow" Kearney and sophomore slinger Steve Swanson will start Saturday's twin-bill. He will come back with ace Carl DeFelice against Scranton in a key Middle Atlantic Conference matchup. Last time Wilkes and Scranton met at Schautz Stadium, it was last year, and it was the first time in Wilkes baseball history, A 1:00 Scranton University (DH) A 2:00 April 2 Muhlenberg College H 3:00 April 8 King's (DH) A 1:00 April 10 Elizabethtown (DH ) A 2:00 April 12 Susquehanna (DH ) H 1:00 April 15 East Stroudsburg (DH ) H 1:00 April 17 Albright (DH) A 1:00 April 19 Delaware Valley (DH) A 1:00 April 21 · Bloomsburg State (DH) Scranton University (OH) H 2:00 April 26 Juniata (DH) April 29 Moravian College A 3:15 May 1 Upsala College H 3:00 ' Dionne Warwick says: ''Get your blood into circulation!' SUBS You've tried all the rest, Now fry the BEST!!! STROMBOLI located Right Across the Bridge, in the Narrows "NUMERO UNO" "Oven Fresh " SICILIAN· Phone 288-7663 or 288-7664 for advance orders LONDON SCHOOL OF ECONOMICS ST UDY TH E S O CIA L S CIE NC E S I N LONDON The London School of Economics and Political Science offers junior year study, postgraduate diplomas, one-year Master's degrees and research opportunities . in the heart of London in a wide range of social sciences. Subjects include Accounting and Finance, Actuarial Science, Anthropology, Business Studies, Econometrics, Economics, Economic History, Geography, Government, Industrial Relations, International History, International Relations, Law. Management Science, Operational Research, ·Philosophy, Politics, Social Administration, Social Work, Gill Red Cross now for a blood donor appointment. Sociology. Social Psychology and Statistical and Mathematical Sciences. Fees £2000 (approx. $4500 ) a year. Limited financial assistance available. Application blanks from : Pro-Director, L.S.E., Houghton Street, London WC2A 2AE, England. · Please state whether junior year or postgraduate. 1- r.11!'1 A Public Service of This Newspaper ~ & The Advertising Council H 2:00 April 23 H 1:00 that the Blue and Gold were swept in a doubleheader. All-MAC catcher Jim Morrissey will be the opening game's receiver and veteran Chick Andrewscavage will get the nod at first-base while senior Rich Borofski will serve as the designated hitter. Either senior Rick Marshall or sophomore Chris DaRe will be at second base while Paul Yurko and Joe Malatesta share the shortstop duties. All-MAC and senior tricaptain Phi Marino will hold things down at the hot-corner. Another tri-captain George Kavulich will start in centerfield while senior Bob Brezenski will fit in right. Either sophomore Bob Luby or freshman Harry Ardoline will start in left field. Expected to see action in relief on the mound for Wilkes on Saturday will be Ken Hodick, Ralph McGuiness and Tony Vlahovic. Also expected to help out in the out'field are: Jerry Antosh, Gary Macko and Bob Bukoski. DeFelice, who will be the " main man" on the Wilkes pitching corp this year, owns a career record of 93 with a 2.48 era. He was undefeated in his first two years at Wilkes (5.0) . Kearney is 3-2 in his first two seasons with four saves and a 2.55 era. Andrewscavage is the leading veteran hitter along with Marino. Phil is batting .358 in his career and has a good shot at finishing in the elite .350 Wilkes club when he's through. In two years, Chick has 57 hits, 42 runs, 18 doubles, nine homers, and 48 rbi's in 53 games. The Colonels have a tough schedule in 1980 with some top MAC games on tap. Expected to be tough this year are Elizabethtown, Albright, Juniata, Scranton and King's opened its season yesterday at Kutztown State and the Monarchs are expecting a good season under veteran mentor John Dorish. Last year DeFelice ended the campaign as the 19th ranked pitcher in ERA in the nation with a 1.98 era. The previous season, Wilkes was ranked in 15 different categories. FOUL BALLS... assisting Kaschak this year will be Mike Broda ... former Wilkes baseballer Tony Schwab is head coach at Meyers...Terry Schoen, considered by many as the greatest second baseman in Wilkes history, is now working in Scranton and hopes to try out with a pro team ... King's standout Norm Magyar will try out with the Pirates in a few weeks ...Coughlin .baseball coach Bob Corba was once a swimming and assistant football coach here ... record for highest average in a season is .483 by Tom Higgins in 1971...Scboen is career leader with a .416' average ...Terry is the only Wilkesman in history to bat over .400 for a career... Kaschak was an all-league performer in baseball when he played at Wilkes under Gene Domzalski ...freshmen are invited to come over to Artillery to see a baseball game .. .the games are always exciting and we usually come out on top ... Wilkes has a great tradition in baseball and is known as one of the powers in the East. Eddie White �a 0 ' U ' N -~i ><..: >c:N -><. 'fl. . CUH Registra~ion Schedule SENIORS-Class of rn81 Pre-Registration-Monday, March 31 aqd April 1 Registra tion-Tuesday, Wednesday , April 1 and 2 S-Z-8 : 30-12 : 30-Tuesday A-E-12: 30-4 : 30-Tuesday F -L-8:30-12:30-Wednesday M-R-12: 30-4: 30-Wednesday SOPHOMORES- Class of rn83 Pre-Registr ation-Tuesday, Wednesday & Thursday, April 8, 9 & 10 Registration-Thursday & Friday, April 10 & 11 Monday & Tuesday, April 14 & 15 S-Z-8: 30-4: 30-Thursday A-E-8: 30-4 : 30- F riday F-L-8:30-4:30- Monday M-R-8: 30-4: 30- Tuesday JUNIORS-Class of 1982 Pre-Registration- Wednesday, Thursday. April 2 and 3 Registration-Tuesday and Wednesday-April 8 and!) S-Z-8: 30-12 : 30-Tuesday A-E-12 :30-4:30-Tuesday F-L-8:30-1 2:30-Wednesday M-R- 12 : 30-4: 30-Wednesday (1-P can register with S-Z because they registered last as Sophomores ). FRESHMEN - Class of 1984 Follow the same schedule as Sophomores, Class of 1983. � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 March 27th Date A point or period of time associated with an event in the lifecycle of the resource 1980 March 27 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/ad9d27586cbbd92786a6cfa24099ae1d.pdf a18621dd6e4685007b85f42b0a41a296 PDF Text Text Tuition, Room and Board Graphics 197 $1000 $2000 -Tuition $3000 $4000 $5000 '$6000 fftttttt tt{ Room & Board $700 Increase In Tuition, Room & Board ' Marks Largest Hike In Recent Years Tuition for next _year will increase by $500 with room and board going up $200 according to an announcement made by Mr. Joseph Chisarick, Comptroller, at last week's Student Government meeting. Chisarick, made the announcement for President Robert S. Capin who was out of town seeking additional funds for the college. He stated that the 15.4 percent increase in tuition will mean a cost of $3750 for full time students. Also, room and board will be $1900 - an 11.8 percent increase. According to President Capin, part-time and graduate tuition will also be affected by the increases. Part-time students will pay $82 per credit hour and graduate students will note an increase from $95 to $110 per credit hour. Chisarick noted that the college's budget of $14.5 million for the 198081 year has been approved by the president's council and the Board of . Trustees. It is the largest budget ever prepared at this college and it has an increase of $2.4 million over last year's. Chisarick pointed out that the faculty asked for a 16 percent salary increase, but they will be receiving a 12 percent increase instead. In addition, several capital projects were eliminated and no funds have been designated for construction of any new buildings. If the projects were not eliminated, an increase of an additional $500 in tuition and fees would have been necessitated. Wilkes will continue to be the highest priced college in Northeastern Pennsylvania with this overall increase of 14.4 percent in tuition and room and board. Chisarick commented that most of the other private, four-year, coeducational colleges in Northeastern Pennsylvania also will be making 12 to 15 percent tuition increases. On a st,te and national basis, Wilkes ranks near the middle on a scale of least expensive to most expensive colleges. Chisarick explained that federal , state, and Wilkes Financial aid will probably increase substantially in accordance with the tuition raises. He stated that $1.3 million in financial aid was received by Wilkes students during the past year. Earlier this week, The Beacon reached President Capin for his comments. Capin said that the decision to raise the tuition came "only after very serious consideration and review to the entire budget of the Institution.'' Capin added that a personal letter is being sent to the . parents of all the students indicating the increases and explaining the reasons for the raises. In his letter, Capin stated that the increases can be attributed to "the financial pressures faced by all institutions of higher learning as a result of continued inflation and rising costs of operation." Capin pointed out that even with the increases Wilkes will still be charging less than many institu- tions of our size and quality in Northeastern Pennsylvania. Capin stated that he urges all students to explore all the sources of financial aid in order to help offset the increased tuition. Louis Czachor Class Officer Elections•.• ········~~.~ ... Gries And·Wallace ·Tie, Glunk Wins, Hardy Beat · Colleen Gries tied write-in candidate Rob Wallace, Dan Glunk was re-elected and Carl Kadtke defeated incumbent Dennis Hardy in class presidential elections held last Thursday, March 13. ·1 For the Class of 1981, president Colleen Gries ran unopposed on the ballot but received competition from 1 write-in candidate Rob Wallace. They both earned 57 votes apiece of the 126 ballots cast. Wallace's _campaign was a surprise to many people and he ran on a write-in ticket with Arnie Joseph for vice-president and Carol Benek for secretary. Both Joseph and Benek were solidly defeated. Although very little, H any, campaign material was posted, many attribute word-of-mouth as being the driving force behind Wallace's , campaign. · There will be a special run-off election today In the Student Center at 11 :00-1 :00 and In the cafeteria from 4:30-6:30. Only Colleen Gries' name will appear on the ballot because Rob Wallace is still considered a write-In canidate. • In other offices for the Class of 1981, Joe Rubbico was elected vicepresident with 68 votes over Joseph's 50 write-in votes. John Moffatt easily defeated Norm Witko by a count of 72 to 38 for the office of class treasurer. The biggest. vote receiver of the class was Margaret Scholl who earned 83 votes for the office of class secretary. She defeated Benek who earned 21 write-in votes. Class of 1982 Next year's Junior class will again be headed by Dan Glunk. He defeated Roya Fahmy and this year's vice-president, Pat Murnin. It was a close race and the count was as follows : Glunk 35, Fahmy 30, and Murnin 28. Running unopposed, Laura Danowsky and Theresa Gabana were elected class vice-president and secretary respectively. Danowsky captured 81 votes makIng her the most popular candidate of her class while Gabana earned 79. For the office of treasurer, Steve Voyce was re-elected with 49 votes over Sue Palmer's 26. Class of 1983 Carl Kadtke defeated incumbent Dennis Hardy in another close race for the office of president. Kadtke squeaked by Hardy with a margin of six votes. The count was 57-51. Eric Farber was easily elected, vice-president with a total of 5:J · votes. He ran unopposed on the ballot but Dina Campbell earned 34 votes as a write-In candiate.candidate. Receiving 89 votes, the most for the entire election, Jean Colonna was re-elected class treasurer . Amy Elias was elected crass secretary over Eric Goldman by a margin of 5 votes. The tally was 4944. Junior-Senior Dinner Dance Controversy Centered Around Price, Bar And Food Plans for this years Junior-Senior . Dinner Dance to be held at the Woodlands on April 18th have been finalized according to Bill Keba, Dinner Dance co-chairman. After much deliberation between the two classes as to the exact format the dinner would follow , Keba and co-chairman Margaret Scholl agreed upon one of the many proposals under consideration. ed an open bar. At the meeting, various points of view as to the benefits and detriments of each plan were presented by members of both . classes. The Juniors main argument was that with a cash bar, the over-all expense of the night would increase greatly, while the Seniors primarily questioned the quality of drinks at an open bar and stressed a strong desire for the prime rib dinner. Barry Williams, Senior Class Vice-President, stated that from personal experience, · the drinks served at an open bar are "watered down" and usually the amount of bartenders on duty is decreased. A plan three was proposed by sold at the door the night of the par- _ Mike Sibilia, Class of '80, calling for ty. a combination of open bar and Blumfield . also stressed that prime rib dinner. The plan was security must be increased for ultimately voted down mainly future parties. Blumfield feels that because of an Increase in ticket the rules for sponsoring parties be prices to $28.00. Also with this plan, adhered to strongly to insure the freedom to hold parties on campus · there would be an inadequate amount of beer on hand which also in the future. At the cost of $25.00 a couple, the afair will feature a prime,.rib dinner with a cash bar, including eight halves of beer, along with wine and soda which will be available at rio charge. This basically is the dinner plan which the Senior class had supported during a March 13th special meeting with the Junior class, who endorsed a second plan that includ- Improved Party Practices DesiredBy Blumfield Due to a recent party held in the Student Center, stricter reinforcements must be practiced by sponsoring organizations, .according to Dave Blumfield, Student Government President. The most important issue is sellIng tickets. No tickets are to be sold without proper Wilkes College identification. There are to be no tickets Continued on Page 3- -· �T ____________________________________ ..:__--:--------~ Page 2, The Beacon, March 20, 1980 .I ncreasing Vandalism Children 'sProduction Termed A Success! Di.turf,. SG Pre.Iden t 1 Student Government President Dave Blumfield condemned several acts of vandalism that were committed on campus recently. He noted that someone broke the glass in a door of the cafeteria. Also, the glass on the bulletin boards outside the cafeteria was broken, and the glass on the SG bulletin board was broken. Blumfield stated that it does not prove much if you can break glass because it can be done very easily. He noted that students complain every time tuition is increased, but the acts of vandalism still continue. He concluded, "It has just got to stop." Under the topic of elections, Blumfield announced that in the runoff election today between Colleen Gries and Rob Wallace for presideht of the Class of 1981, only Miss Gries' name will a,pear on the ballot. A petition to put Wallace's name on the ballot was voted upon at the executive council's meeting and defeated by a vote of 9 to 1. Blumfield also announced that from now on he will appoint people to count the ballots at the end of an The Wilkes College Theater, under the direction of Adele Tavella recently produced a children's play election in order to. prevent the entitled "Mrs. Old and the results from being announced Unicorn" at Church Hall. before they are officially posted. As I walked into the play I Under fund requests, Cue and thought the Muppets were in Curtain asked for $125- to help pay • Wilkes-Barre, but then a few for a trip to New York City on familiarfaces appeared. Paul KerMarch 29. The request will be voted rigan, who played in "Waiting for upon next week. Godot" was the Unicorn, I think. It Last week two fund requests were was hard to tell with the grey har, voted upon and passed. The first white costume and horn on his was for $47 to be used by the Ear.th forehead. He sang "Everyone Has and Environmental Sciences Club a Dream," catching not only the to pay for trophys to be awarded at children's attention, but also the their contest for high school adults. The production did have students regarding environmental · adult overtones and a lot of visual awareness. The other fund request . humor, as noted by Yam - Donna was made by the Air Power Club Pioppi. for $150 to help reduce ticket prices A new face. in the theater who for their annual formal dinner played her part well was Lori Pritdance. chard, who caught the eyes with her In other business, Circle K Presidimples, green costume and dent Jeff Gavlick announced that singing voice. Her dance partner, Wilkes circle -K received nine who looked like "Big Bird" was awards at the recent Circle· K conRicky Caro, who played Snoopy in vention. last year's Charlie Brown. Other The film committee pointed out Wilkes students taking part were that the next film will be shown Joe Laub, Chris Golanski, Mike tomorrow at 7:00 and 9:00 in the Flamini, costumes. The sets were CPA. The film will be "Julia" and a provided by Kurt Schrawder, Bill "Donald Duck" cartoon will also be Stusnick, Bill Turcan and Betsy shown. Louis Czachor :A Scene From '~rs. Old And The Unicorn" Keller. The play was written by Brandon Ward and sponsored by the Cue 'n Curtain. A few members of the Little Theatre also participated, including the character who played Mrs. Old. It was a part of a directing class requirement for Tavella, who has already established herself on the other side of the podium, out of the director's chair. The cheater plans to have at least one children's show a year. Despite the dwindling crowd on opening night, Church Hall was packed on Sunday afternoon. By the way, did those kids find out where the raisins came from? Bob Gaetano Mr. Wilkes Competition Set Debaters Capture Third Place; .V ictory Marks 300th Triumph gathered on the campus of East Stroudsnbrug State College for intercollegiate competition. Not only did Wilkes win the team award but also captured seven additional awards in various areas of public speaking. . Jon Pliskin captured three awards in informative speaking, extemporaneous delivery, and in sales competition. Davida Roberts netted two - an impressive first place finish in After Dinner Speaking and a trophy in rhetorical criticism. Darlene Schaffer won an trophy also in rhetorical criticism. Norm Witko moved into a second · place finish in the area of salesmanship. Contributing to the team award in addition to the four above were: Colleen Gries, Betty DeCosmo, Fred_ peets, Darrell Lewis, and Gregg Price. The eight awards raises Wilkes victories won this year to 23 and overall to 307. The debate union members are presently preparing for competition in the annual Pi Kappa Delta National Honorary Society's Province Tournament. The debate and speech team is coached and directed by Dr. Bradford Kinney, of the Communications division. NOTICE There will be a Student Center Party Friday night from 9:30 to 1:30 sponsored by the Letterwomen. Admission is $1.50. Two tickets will be sold per Wilkes ID. Tickets will not be sold at the door, but will there will be tickets availabe at the cafeteria in the early evening. The Wilkes College Barbell Club will sponsor its second annual "Mr. Wilkes Physique Contest" on Sunday, March 23 at 7:30 p.m. in the Dorothy Dickson Darte Center for the Performing Arts. There will be -approximately 15 participants in the contest who will be judged by a panel of five judges. Trophys will be awarded to the top four finishers. Radio announcer Jim McCabe will be the emcee for the contest. Admission will be $1.00 per person and tickets may be purchased at the door. The club is hoping for a good turnout at the event, and all proceeds will be donated to the Muscular Dystrophy Campaign. Januzzi's Pizza and Hoagies 125 Academy Street Home Delivery OPEN 7 DAYS 11-1 i1Jr [J(]rfi ll (]fl fl fliS r.fl(I ~IJSiflfllS See Joe, Bob, and Danny MON.-THURS. 11 A .M.-9 P.M. TUES., WED., FRI. & SAT. 11 :00 A.M.-5 :30 P.M. 288-3751 �March ZO, 1988, ~ Beacon, Page 3 Budget Announced To CC B·y Claisarick Alternative Lifestlye Requested Through Co-Ed Housing Report Joseph Chisarick, Comptroller Nominations will be held in Stark announced the college budget for Learning Center, Room 101 at 11 1980-81 and explained the tuition in- o'clock. Anyone interested is urged crease at the Monday night meeting to attend. It was also noted that The availability of an alternative of Commuter Council. A long there will be a run-off election for lifestyle is the request of the Wilkes · discussion followed Chisarick's the ·Senior Class President also on College Student Life Co-Ed Housing presentation. Tuition is expected to Thursday. Report. The report was developed increase $500 for a commuting The meeting was brought to a in order to pesent the case of co-ed students and $700 for all students clase with two reminders. Joe housing, provide background and to that dorm. Knox, President of the Coalition of address questions. In addition to the college budget . Independent College and UniversiCollege life is a microcosm of and tuition increase, it was brought ty Students (CO~US) announced society, and along with students' to the attention of the council that that there will be a writing and petiacademic growth there is social the four week withdrawal policy tioning campaign all this week growth. A college residence hall has been passed by the faculty and against the Carter Administration's provides an excellent opportunity that, unless other action is taken, it new loan proposal. Anyone into learn by interacting with others. will go into effect. terested in getting involved is asked Wilkes College has "small living On the more pleasant side of to contact the COPUS Office in units" that allow for this personal things, the St. Patrick's Party was Weckesser Hall or to come to the growth. The drawback in the prevery successful. According to Joe COPUS meting this Thursday at 11 sent housing status is that "only one Rubbico, party chairperson, "It o'clock in the basement of Franklin living option (single sex.housing) is went very well, 417 people came Hall. John Moffat also reminded available to students, thus limiting and the management of the Sterling everyone that the Beer Variety the potential growth of many innoted that we were one of the best Party sponsored by The Student dividuals." Because of the diversity behaved groups they have ever Center Board is now on March. 28. · of students' needs, "no one housing had. " Shep Willner noted' that all The party had been originally set on arrangement can be satisfactory to that were involved should be com- this date, rescheduled, and changed • all." mended for a job well done. back again. Contrary to fears of increased The success of all of the CC-me Darlene Schaffer promiscuity, studies indicate that sponsored parties and activities this year has prompted another major activity. On April 26, CC will sponsor a Block Party. The Block Party will consist of blue grass music. The group Back Mountain Stream is expected to perform. Chairpersons for this event are: committee may be needed. At the me meeting on Sunday Mary Kutz, Eric Johnson and DenAlthough no definite guidelines for nis Heim. Additional information night, Vice President Mike Sibilia the committee were discussed, it can be obtained from the Com- proposed that a special parking muter Council Office on the second committee be formed to handle ap- -was suggested that Eugene Manganello should be present to peals concerning parking tickets floor of Weckesser Hall. hear the appeals, and that the apissued on campus. Sibilia stated All students are reminded that peals could be presented either in this Thursday, March 20 is is that he often receives complaints person or by letter. nominations for Student Govern- from students about tickets, which me President Mike Stapleton anindicates that such a grievance ment and Commuter Council. nounced that, at next week's meeting, nominations for all me offices would be held. Elections for president will be on April 8, and elections to the other offices will be held on April 15. Stapleton also reported that the Executive Council discussed the casual, more mature relationships exist. Co-ed housing socially acclimates students to encounters in real life. Increasing awareness in attitudes also occurs in co-ed dorms with men and women more equally discussing traditionally masculine and feminine concerns. Other advantages to co-ed housing include, improvement of communication skills and a greater understanding of the opposite sex, which increases community feeling. Studies have found "that co-ed housing has reduced vandalism and damage significantly." Co-ed housing has increased participation in cultural and educational programming, and decreased security problems. A 1972 study by Nancy Cohen Locker from Gettysburg College questioned six administrative of. fices and noted that 50 eprcent of the admission officers felt that co- Formation Of Parking Comnaittee Proposed By IDC Vice President You'll be am~ at all the opportunities and advantages the Army offers men and women with BSN degrees: r-;;;;.n.;;M:i:ii~fo-;i \ a group of professional \ • Excellent starting salaries and benefits, including a liberal vacation policy. • Real opportunity for advancement and professional growth -every Army Nurse is a commissioned officer. • No basic training for nurses; just a basic orientation course to familiarize you with the Army Medical Department. • The chance to travel; time to do the things you enjoy. • Opportunity to qualify for specialized roles, teaching or additional education. Call c91lect to See if you qualify. 301-677-4891 The Army Nurse Corps. Address _ _ _ _ _ _ _ _ __ _ _ _ __ Apt. _ _ City, State, ZIP _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __ Phone _ _ _ _ _ _ _ _ _ __ _ __ _ _ Age _ _ L ____ - ____ _ _ ____ ____________________ CASS/ NERRC i i i \ ~ i ~ ~ Mary Kay Pogar }_.~!te.!.:.~~~~.J EVERYONE IS MEETING AT ... JiM1)ANDYS Ana Nunez Dinner Dance Controversy Continued from Page I caused the plan's rejection. Keba noted that in addition to the orginial dinner plan, an agreement with the 25th Hour is possible which will enable those attending the dinner dance to enjoy the disconightclub before and after the affair. If adopted, couples will be requested to pay an extra dollar at the door to cover expenses. When asked to comment on the finalized plans, Scholl said, "I'm-in favor of plan one because I think it would work to the best advantage of all students in attendence. I feel optimistic that the dinner dance will be a success." Peter Steve Mark ~laza, Edwardsville- 211-2235 ,----- ----- - - - -----------------------------7 For more information, write: The Army Nurse Corps. Northeast Region, U.S. Army Recruiting Fort George G. Meade, MD 20755 Name _ _ _ _ __ _ _ _ _ _ _ __ _ _ __ __ \ artists who have set up a i studio in W-8. Must be 18 i and available to work for \ a month. Set up an interi view today by send ing i name, phone and i photograph to: ~ P.O. Box 2043 me constitution last week. Some changes were made in the existing constitution, but the most important change was the addition of · specific guidelines for IDC's committees: Food, Maintenance, Parking and Social. The revised con. stitution will be presented to the entire Council at the next meeting. A report on the St Patrick's Day Party held March 14 in the Hotel Sterling was given. Stapleton stated that the party was a success. He commented that, although they ran out of beer and wine, no one seemed to complain. Stapleton reminded IDC reps of the Pajama Party planned for later in the semester, and announced that it would be held either April 11 or 12 in the Student Center. Social Committee Chairman Bill Miller reported that a blue grass block party is planned for the weekend of the Cherry Blossom Festival. The Back Mountain String Band will play at the party, and admission will probably be free. ed housing positively affected admissions; alumni support was unaffected by the initiation of co-ed housing. The report also stated that all deans of students would reinstate co-ed living arrangements "if the decision were to be made again." The majority of chaplain's office respondents "felt that there had been no increase in counseling." However, 82 percent of the counselors agreed that "co-ed housing had provided a beneficial effect in the overall climate of their campuses." The health services personnel pointed out that there had been "no increase in psychological or emotional problems." Nor had there been an increase in drug or alcohol abuse, pregnancies or venereal disease. The sub-committee's report stated that they did not "feel that co-ed housing should replace all single-sex halls on the Wilkes campus," however, they recognize "the individual needs of the students, · and the lack of available alternative lifestyes." Thus, they advocate the institution of co-ed housing as "a step toward meeting those needs." IDC President Mike Stapleton remarked that the institution of coed housing would be "beneficial to the campus and an asset to student life at Wilkes." The Co-Ed Housing Report was accepted at Student Affairs Council, and Housing Director Paul Adams noted that the most important element was that the council "approved the concept of co-ed housing." 1 : : : : : I I I 1 j : ,11-i ~JYOJ?l" ~ . KNd'tS Mc:Hr~ \~ AND HIS BACK ROOM PIANO Accompanied By EDDIE " KING '" LEAR ON THE DRUMS APPEARING SIT. NIGHT FROI 9:30 P.I. UITIL ??? YOU'LL FIND IT ALL AT JIM DANDY'S JOIN US FOR SOME OLD FASHION FUN I -·c huck Robbins ... SPORTING GOODS COMPANY We Accept ~ster Charge and Visa 39 West Market Street · Wilkes-Barre, Pa. 19701 Phone: 822-1333 Free Parlcing at Hotel Sterling : : PATRICK BURKE, Owner - -= - -- - - �Page 4, The Beacon, March 20, 1980 Seniors Address Hartdagen Poor Turnout The Class of 1980 received word that starting this year majors will not appear on diplomas. Though students · who graduate with honors will have that distinction on their diploma, which is a first, the diploma will simply state whether a bachelor of arts or bachelor of science was awarded. This decision was made by Mrs. Doris Barker, Registrar, and approved by Dr. Gerald Hartdagen, Dean of Academics. Because students are now double and triple majoring more often these days, the Registrar's Office feels the diploma does not look attractive listing all the majors. It is possible that a · student may have pr-inted on his diploma: Major in English-Communications, Psychology and Community Service. In addition, students are now allowed to receive a B.A. in Sociology and a B.S. in Biology simultaneou~ly. The diploma will only state Bachelor of Arts and read: Major in Sociology and Biology (B.S. program ). . We see their po1nt and appreciate their concern. The response from the Senior class, however, indicates they prefer otherwise. It is a distinction that is important only to the person who receives it and that is all that should matter. The Class of 1980 has our support. If a diploma is worth roughly $16,000, 4 years of hard work and the key that opens the door to the future, then it should read what they want it to read. Gries Seeks Support For Run-oflElection To The Editor: showing of "The Rocky. Horror PicAn Open Letter to ture Show" took place and enough the Class of 1981: has already been said about that. Today is the day for the run-off The beginning of February saw the election for the position of president Junior Class walking away with ·for the upcoming senior class. first place in the " Class Feud" The fate of our senior year lies in sponsored by the Senior class. your hands ; the members of the Presently the class is very active class of 1981 have the power to with the Junior-Senior Dinner select the most qualified person for Dance. president. In the next two months tentative In review of this past year, I activities have been discussed to would like to give a brief analysis of keep the class active through the what the Junior Class has achieved end of the year. Some of which are a and can achieve next year. PresentStudent Center Party and a Cherry ly the executive council consists of Blossom Softball Team. seven dormitory students, six of We will be entering the most imwhich are elected Student Governportant year of our college life and ment representatives, and five it is important to lceep our active commuters. tempo going. I am asking all The Junior Class's acmembers of the Class of 1981 · to complisments began in April, 1971 please vote and consider the -c~nsoon after last year's elections. The didate that you want in office. class sponsored a ·· canoe· in the Colleen Gries River Regatta and executive counPresident of cil member, Steve Demko, parthe Class of 1981 ticipated in the Walk-a-thon for the class. Classes may have ended in May but the class's activities didn't with the initiation of the first newsletter, with the second to follow in August. When classes began in September, the class saw the T-shirt design contest and the beginning of the T-shirt sale. October seemed to be one of our . busiest months with the caramel apple sale, the Homecoming float, To the Editor: and J unior Weekend which conI am setting aside my personal sisted of "Let's Make A Deal," and feelings and supporting ColleE:n a successful Student Center Party. Gries for president of the class of Throughout the remaining months 1981. She will be an asset to the of last semester, plans were finalizsenior class. ed for the Junior Class Surprise, John Moffatt and the T-shirt sale continued. Treasurer, In January, the first on-campus Class of 1981 Treas. Moffatt Throws Support For Pres. Gries To the Editor: Dear Dr. Hartdagen: We, the undersigned, members of the Class of 1980, Wilkes College, Wilkes-Barre, Pennsylvania, hereby submit this petition in protest of the recent decision to remove the majors from this and following years' diplomas. Because we have devoted the last four years at this institution, we have pride and self-satisfaction in our own particular field of study and this distinction should be made on our diplomas. Barry S. Williams Leonard S. Anderson Susan L. Theobald Natalia Aizengart Donna M. Grontkowski Joseph Degenhart DavidKerek Gary Pisanchyn Perry Lichtinger Joel S. Buckey Susan R. Freda Kathy Sweerey Louis D. Partridge Lori Mreszkowski JohnJ. Romani Diane Karasek Karen P . Casey Lisa Hall Italia Wells Kathy Mlodzienski James Davis Michael J. Rohall Jeffrey Shovlin J . Justin Saporito Lisa Wazenski Joseph W. Klimchak MattKultys Ronald J . Gronski Michael T. McAuvic Peggy Barletta Michael A. Sibilia Donna Snyder James P . Edwards Leonard W. Jasuta William Alan Shaw David W. Samsel James Devaney Martha A. Lasco Gary Richard Kathy Roman Michael C. Gibbore Joan Mancini KevinP. O'Brien Norman Rickles Janet May Stanley Witek Sharon Knight Lisa Hughes Joseph A. Gray William A. Keba Julie Kent Kenneth Lesniak Frank Y amrus Paul F. Miller Barb Shaffer Joseph T. Rauschmayer Bobbi Lou Hamilton Charles E . Hagen, Jr. Peggy Nittle EdOhmott Maureen F.alvey Craig Jackson JamesR. Space David Williams Terry Talarico Dennis Lahr Marlene Vauter • Christian L. Shippey .0 Emmet Burke Rodney R. Wyffels Margaret Callahan Eddie White David Stesney Richard Mital Doreen M. Swiatek RobertJ. Gaetano Justin F. Scheiss James T. Murtha Joe Galaszeuski Editor-ln-Chlef Jim Edwards Kathy Burk Lisa Mastranuono Philip J. Spigarella Joe Cipriani Romaine Long NicholasM. Golowich Fred A. Pierantoni Linda Knorr Betsy McDonald Theresa Ciarmatori Charles Scrobola Thomas D. Salley Joe Rigotti Diane Cimakosky Michael S. Otruba J anet Hocking Pat Connors Diane Dudish Kathryn Tyahla Patricia L. Klotz Joseph J . Blizman R. Malcolm Bowes Steven Goldflam· To the Editor: As a student and a citizen, I was disgusted and disturbed by the pitifully poor turnout for the forum on Nuclear Power that was sponsored by our group, the Susquehanna Environmental Advocates, held last Tuesday, March 11, at the Stark Learning Center. The students in Academia today will be tomorrows' social planners - we have all heard this time and time again. I am also reminded consistently that " the people just don't care" and that Apathy is the rule of the day. Well, at this very moment, all of us are shaping our future, and the future of our children, by shrugging our shoulders and leaving the decisionmaking up to politicians soley concerned with re-election, and executives solely concerned with their profit margins. And our world goes to hell. The Berwick nuclear plant, 20 miles upwind from our community, poses an immediate and LONGTERM threat to the Wyoming Valley, in the way of steadily increasing radiation and steadily increasing electricity bills. And it doesn't have to be this way. It would be worth our while ( and our children's) to get involved, and not shrug our shoulders and give in to "the System" so damned easily. Christopher Miller Susquehanna Environmental Associates · USPS 1132-0118 GregMaskil Tina Manzo Irks Student .......-tbe-::>beaeon.-lllll(llliil... A. David Berman Susan Kozup Nancy Panarella Donna Eicke Vincent Savoca TonyMorash Barbara Pirrilla Kenneth Rogers Janet Lorusso Michael J. Jamillkowski Janet Falchek Jµdy.Lenza SandyJioyd Pat Sweeny Holly Derr · At Nuke Forum Sports 1-:ditor Eddie White Ill Managing F.ditor BillTurcan News Eclitor Peter Steve Copy Editor Patti Sparlow Op-Ed Editor Perry Lichtinger Asst, Op-Ed Editor Margaret Scholl Asst. News Editor Louis Czachor fhotographer Bob Gaetano Advertising Man.:.;er Vanessa Martz Business Manager Sue Freda Circulalion Manager Michele Serafin REPORTERS : Cindy Ercolani, Lisa Gurka, Mary Kutz. Sue Loveitt, Gary Mack, Bill Miller, Rich NordJ!eim. Ana Nunez, Mary Kay Pogar. .Darlene Schaffer, David Stahl. Advisor Geor ge Pawlush Parrish llall 16 S. River St. Wilkes-Bar re, Pa. lllil4i Publi&laed weekly during the school year from September to May except fw vaeatioa periods and semester breaks. EnterH as second class postage paid ill WUlles-Parre. Send fornt no. 35i!t to The Beacoa, Wilkes College, WIikes-Barre, Pa. 18711. Subscription rate to noa-stlldents: $.I per year. Adverdliag rate: sz.so per columa Inch. · Pholle : C717> 112.1-4151, Ext. 473 · All views expressed are those of the individual writer and not necessarily el tile ,-UCatJM of the college. _ �.r MM . •Maggie SayS• .. What's Happening »+ -- -- -- ◄k - - Sondra Tamman, interriatfonally known concert pianist, will appear as a guest of the Concert and Lecture Series at the Dorothy Dickson Darte Center for the Performing Arts on Saturday, March 22 at 8 p.m. The Junior League of WUkes-Barre ;s SJM)Dsoring the major exhibit enUUed, "Three American Women". The show will run from M~rch 22nd until April 27th. Sordoni Gallery hours are Sunday through Friday 1-5 p.m., Thursday evening 6-9 p.m. and Saturday, 10 a.m.-5 p.m. ~ -----"----- warren Bush will be giving his senior art exhibit _in the Conynghar_n Gallery from March 22nd until March 28th. The openmg for the show 1s March 22nd from 8-10 p.m. and gallery hours will be 1-8 p.m. daily. · Student Government will sponsor the film "Julia", Friday night, March 21, in the Center for the Performing Arts at 7 p.m. and 9: 30 p.m. Susan Luckey, soprano, will give a voice recital March 23 at3:30 p.m. in Gies Recital Hall. Patricia Paraventi will accompany on piano. · " Jenny the Mail-Order Bride" and olde-time American me lod rama w1·ll be presented by the Concert and Lecture Series in a production performed by the widely-traveled touring company, The Alpha Omega Players of Rockport, Texas at the Center for the Performing Arts, March 25th at 8 • '::p:.m::x.i1c:::=:::x-k1C=:::,iwi►k=· =::)l◄stkc:==--an-ic==◄◄· •►IC=:::)l◄~►===::,◄nkcc:J::.1 SchollAnd-· Rubb,·co·. • E ndiOrse Pres Gries "' k e To the Editor: As concerned members of the Junior Class we feel that we should voice our opinion relating to the run-off election to be held today between Colleen Gries and write-in candidate Rob Wallace. Under the leadership of Colleen Gries, the class of 1981 has experienced one of our most active years. There is no need to further explain what our activities consisted of because none were failures and everyone concerned kno.ws about what the Junior Class has accomplished. Granted, Colleen Gries is "no saint" but she is by far one of the hardest working presidents this campus has ever seen. The class has set an active pace on campus and we would not like to see our senior year suffer. It is very important to~p continuity and also enthusiasm in trying new activities. It is our hope that every Junior on campus will get out to vote today and vote for the qualified candidate, Colleen Gries, who will keep the class active and help make a successful year. Sincerely, Margaret Scholl Class of 1981 Secretary Joe.Rubbico Class of 1981 Vice-President Rest Room Facilities Upset Warner House Resident To the Editor: I wish I was a health inspector, because if I were, I would condemn or shut down Warner Hall Rest Room. Every time I walk in to take a shower or use the bathroom my nose has to be plugged. It smells worse than some public rest rooms. The smell is accompanied by bugs, mold and mildew, not to mention the bathtub in there. Why isn't there any hooks and soap dishes in the showers? Why isn't there any stoppers in the sink? The toilet stalls are about ready to fall down, and there's enough graffiti on the walls that would take all day to read. Some of the discrepancies are caused by immature students, but why aren't they corrected. Each student in a dorm hs to pay a 50 dollar dorm damage deposit. Not one bit of improvement has been · made over the spring break. Paul Adams is in charge of housing, so · why didn't he have these discrepancies corrected. I for one am not goIng to stay in a dorm if the person in charge of it is not doing his job. And another thing, I want my money back since it's not being used. Paul T. Shepperd Warner Hall March 20, 1980, Tht Beacon, Page 5 Reader Commends Wrestler, Bart Cook To the Editor: I believe in the unknown. Much lies hidden in Uie universe; seething, • growling, throbbing, pulsating, and developing. The unknown escapes time and all its constraints. The unknown is much · like the potential of a human being: never discovered until attempted. Perhaps, this is why I have so much faith in superstitions and omens. For example, let's examine the number seven. Seven days in one week (no big deal) . Seven digits in a telephone number (profound) . Seven letters in my last name (so what) . . Seventeenth best dual wrestling career in Wilkes College his story. One seventY:.seven pound weightclass. Thirty five seven-one lifetime dual mark. Seven-tenths of one pound. Seven transcends and follows a man. That man is Bart Cook. He rounds out his senior scholastic and athletic career at Wilkes as A co-captain of the wrest!ing team. team guided by twentyseven year mentor John Reese (30983-9) to a record-breaking, rump, roasting, win-streaking, buntoasting, exciting season, wrestling record of 19-2. I congratulate each team member for a superb performance and look forward to another challenging, rewarding season. However, the greatest legacies are left by the graduating seniors. In exploring any situation we must ask, "what have you done?" Not, "what have you done (for me) lately?" I have often wondered about the masochists wht> starve, run, and sweat themselves to victory. I have not yet felt the weight loss, injuries, or pain. I judge them because I am a part of the school; not a part of them. The graduating seniors have paid some financial, physical and intellectual dues. Some are fortunate enough to exist in the things they leave behind. The ·advice she offered to a struggling freshman; the confidence he instilled by showing it can be done; the knowledge they share with those who know (of) them. I thank y'all seniors for helping me through some rough times. Bart Cook has touched many lives and learned much. He has complete one phase (aspect) of his lives. And H he approaches each phase with-such tenacious vivacity ... well, you know, like I said, I believe in Bart Cook ... and maybe ... leaders ... comrade., preside-... Traly Yoars, David A. Clanton Student Assistance Needeil For VisitationDay,Apr.13 To the Editor: · The Wilkes College Admissions Staff is hosting a Visitation Day Program on April 13, 1980 for all high school students who have been accepted to Wilkes College. This program will combine the efforts of the students, faculty and administrators in order to represent the academic and social environment at Wilkes College. As stujlents, your cooperation is needed lo act as campus guides and informants for our visitors. This experience will be beneficial to you who will be seeking involvement in the annual Orientation Program in the summer:·There are many tasks that require your support in order for this program to be as successful as it was last year. A meeting for all interested students will be held on Tuesday, March 25, 1980 at 11:00 a.m. in Stark Hall, 101. I hope to see you there! Sincerely Debra B. Stratton Assistant Dean of Admissions ---------- Campus Commentary-. A Full Service Bank Scientists dispute whether selection breeding can boost human intelligence - and they also disagree about what sort of moral issues may be raised by a sperm bank for Nobel Prize winners. The sperm bank, called the Repository for Germinal Choice, is being set up by an Escondido, Cal., business tycoon - in his backyard - to produce exceptionally bright children. Already, five Nobel laureates reportedly have contributed, many more have been solicited, and t~ree women described as having "exceptionally high IQ's" hav~ been impregnated. They are given a choice of sperms. Nobel Prize winner Ben Mottleson asserts "it's all a bunch of nonsense." "The idea of intelligence isn't that simple".he says. "This is a primitive approach. There is..-eonsiderable arrogance involved in thinking we should populate the world with images of ourselves." The Nobel laureate declined to comment oil the concept of forgoing all other considerations _to pass intelligence onto future generations; that is, he wouldn't say if he and other Nobel Prize winners have congentially smelly feet or the heartbreak of psoriasis. These are the sticky moral questions we will encounter in genetic engineering. There are said to be a number of sperm banks already operating, and judging from the number of inquiries pouring in, this one is going to be quite successful. It appears that there is big money to be made in the sperm banking business. Its success will undoubtedly foster competition. At first the sperm banking industry will be staid and dignified. But as more of the banks crop up - "Why Have Just An Average Child?" - they will be forced to try and woo customers from competing institutions. · The 1st National Sperm Bank of Wilkes-Barre will offer a complete line of all your favorite Nobel laureate sperms, including : medicine, physics, economics, literature, peace and lemon-lime. Continental Sperm Bank will decide to offer premiums: black satin sheets, Donna Summer's "Love to Love You Baby" albums and subscriptions to Playboy. The Southern Sperm Trust will counter with "Pro-Longed Hours," a walkup window for daily deposits, a window fot, nocturnal emissions and "No Penalty for Early Withdrawal." Someone will open 1st Federal Sperm Savings & Loan, but it is doubtful sperm borrowing will catch on with a large segment of the population. But why just banks and Nobel winners? Indeed the philosophy behind the new California bank calls for donations from "famous and exceptional people" as well. Sperm department stores and specialty shops will be open in suburban malls, featuring sperm of the National Football League, the Chicago Symphony Orchestra, the Academy of Motion Pictures Arts and Sciences and Phi Beta Kappa. Diver-sity is the spice of life. For the exotic we include sperm from Tibetan Monks, eskimos, aborigines, pygmies, and mongoloids. Women, imagine the status of telling your friends and family that you are actually having Paul Anka's baby. Personally, I've always wanted to "father" my own family singing group, the Clantones. If you can afford exceptional children, there will be exclusive shops carrying an expensive line of Bjorn Borg, Bart Cook, Julius _Erving, Luciano Pavarotti, Kendall McNeil, Paul Newman, Mick"Jagger, William F. Buckley and an "Exciting New Shipment: Eric Heiden and the of- . ficial sperm of the U.S. Olympic Hockey Team!" Olympians will be the best science can create. : But everyone cannot. So suburban K-Marts will carry the likes of Don Rickles, Cubs utility infielder Paul Popovich, Allen Ludden, the K-Tel singers, Elvis impersonators, and people smart enough to pass their driver's test the first time. Then generic sperm and two-for-the-priceof-one package deals. Franchise sperm outlets will sprout up like weeds along surburban thoroughfares: Alfred Nobel's Sperm City, Sperm World, Sperm Barn (over 20 million served), House of Sperm (have it your way), Birds 'n Bees. Baskin-Robbins sytle franchises will be among thelJl, featuring the mutation of the month - for March? Kareem Abdul ICissinger. At the Sperm Hut the basic tliin crust impregnation will be $5 plus $1 for each additional ingredient: cheerful, thrifty, obedient, fun-to-be-with. G.M. (Germinal Mayhem) offers a special limited edition of their freak of the week. Like original prints the volume could be limited. If we include the sperm of racists William Shockely and Arthur Jensen, pardon me H I suggest the sperm of other infamous figures such as Richard Nixon, Adolf Hitler, and Ian Smith also be implanted. The whole concept is sexist in nature - talented women need not contribute. Were this just another short-lived southern California aberration, it might be a placebo pill easy to swallow. But the first manmade geniuses, products of the Nobel sperm bank, will be rolling off the assembly line in a few months. · Scientists have refrained from making withdrawals from sperm banks and ovum banks, adding three cans of water, and stirring up huge batches of babies. 'When they do, what will they make? Super intellects and.athletes? Slaves? What will we think of kids when we can buy them to match our walls? What will they think of us and what will ·they think of themselves? How will we ever make a decision of such magnitude and importance, a decision to create such a "brave new world?" In · America, businessmen in places like Escondido, Cal., will ·ask themselves if there's a buck in it. I quoted much of the information for this article from reporter Bill Geist' column in the 3-7-80 Suburban Trib. David Clanton �Music Educators Association of Internationally known concert New Jersey, and has judged pianist, Sondra Tamman, will apvarious competitions throughout pear as a guest of the Concert and the state. Lecture Series March 22, at 8 p.m. In the Middle East Ms. Tamman in the Dorothy Dickson Darte has performed in Israel and at the Center for the Performing Arts. Goethe Institute in Casablanca. She Ms. Tamman was born into a has been heard in Europe as soloist musical family and at the age of ten with the American Festival Orshe won the New York Orchestral chestra in Italy. She has also toured Society Competition. Since that West Germany, the Netherlands, time she has won first prize in the and Great Britain. Juiliard Conserto, . Competition, The concert is open to campus The Paderewski Foundation Comand community at no charge. petition, The International Piano Competition of the New York Congress of Piano Teachers, the New Jersey State Museum Competition POSITION and the Masterwork Foundation. AVAILABLE In 1975; Sondra Tamman receivSOD Intern, Office of Admissions, ed a Master of Music Degree from 1980+81 academic year. Applicant the Julliard School, where she American Relations and the must have strong public relations, studied under Martin Canin and the Garden State Arts Center, all in supervisory, communications, and late Madame Rosina Lhevinne. She New York. quantitative skills. Approximately · earned a Bachelor of Music Degree The pianist has also appeared in · fifteen hours per week, or full-time from the Manhattan School of many museums and colleges, for Cooperative Education canMusic. among them the Amherst Music didate. Eligibility for College WorkMs. Tamman has performed as Festival and has played with Study desirable, although not soloist at the Julliard Theater at chamber ensembles including the necessary. Inquiries should be Lincoln Center, the Metropolitan Audobon Quartet. She has condirected to Ms. Barbara King, OfCenter, the Center for Interducted Master Classes for the .fice of Admissions, Chase Hall. f.·.··················································:·.·:·:·.·····:·:·.........................................:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:·:-:·:·:·:·:·:·:·:·:·:·:·:·······················································································,:.·.:•: dr a Tamm an · Alpha Omega Pl~yers Will.Appear March 25th "Jenny the Mail-Order Bride" an olde-time American melodrama will be presented by the Concert and Lecture Series in a production performed by the widely-traveled touring company, the Alpha Omega Players of Rockport, Texas at The Center for the Performing Arts, March 25th at 8 p.m. This form of melodrama is a strictly indigenous, uniquely American form of theater. It is found in the dramatic literature of no other country. In its beginnings in the mid-nineteenth century, this type of melodrama, such as "Ten Nights in a Bar-Room," was taken quite seriously by audiences who · hissed the villain, cheered the hero and sympathized audibly with the · heroine as they entered into the spirit of the age-old struggle bet- ween good and evil. Today's audience tends to see the fun and foolishness in a style of theater which seems somewhat incongruous in its black and white interpretation of human nature and . human behavior. So while the ''.moral" is always there, audiences respond with good-humored ridicule at the outlandish goings-on. With audience participation setting the tone for the entertainment there is probably no form of amusement more satisfying to the general audience. "Jenny" is a modern version of the old melodrama, a type represented .by "The Drunkard," first written for a small cast, but produced by P .T. Barnum in 1842 with a cast of 1500. Greetings Everyone! The Great Spirit has returned from my much enjoyed spring vacation. It was a thoroughly relaxing week (except for the term papers, reading, studying, etc.) as was, I'm sure the same for most all of you. I have but one complaint, echoed by everyone else too - TOO SHORT! ! ! It's quite evident who went to Florida by those tans. For those of you who went and are not tanned - what happened??? Too many indoor activities going on, huh! ! ! I'm sure those activities didn't consist of Monopoly! ! ! Everyone should be back in the swing of things now! ! ! How many people have been caught doing that last minute typing for your term papers??? Some are still trying to convince profs on this wild topics including "The History of Bubblegum: A Sticky Situation." A bit wild ' even for most profs here. Green was the color of the evening last Friday night when the annual St. Patrick's party was held at the "Hotel Sterling." Almost everyone was there! ! ! The Great Spirit sure was and would like to know what two females were doing in a dark elevator with a hot (??? l campus guy??? Come on girls, tell us what really happened! ! ! I saw a lot of classy green outfits that night, and some not so classy. One of the highlights of the evening was the Colonels rendition of " When Irish Eyes Are Smiling" which was . . . ahem ... well ... the spirit passes comment. Nice try but definite_ly not an award winning pr~sentation. . �7 . March 20, 1980, The Beacon, Page 7 Student LoaD Revisions Cause Some Prot8St; COPUS To Orga~izeA W~ite-lnCaDip~ifln Revision of loan programs which would have a serious effect on college students is being proposed by the Carter Administration. This · proposal calls for the establishment of a federal bureaucracy, higher interest rates on student loans and a decrease in the amount of time allowed as a grace period before repayment of the loan. According to J oe Knox, student representative of the Wilkes College chapter of the Coalition of Independent College and University Students (COPUS ), the Carter Administration has indicated that it will veto any legislation concerning loan programs and higher education, unless such legislation includes the Administration's program. This loan proposal will affect undergraduate amT graduate students who rely on the current low .interest rate loans to help finance their college education. Current loan programs include the National Direct Student Loan (N.D.S.L. ) which has an interest rate of 3 persent. This program was designed to especially assist students with great financial need. Another current program is the Guaranteed Student Loan, with a 7 percent interest rate. Repayment of these loans does not have to start until nine months after graduation or after leaving school. The Carter Administration proposal, however, creates some changes. The N.D .S.L. program will merge with the Guaranteed Student Loan program to form one national program for student loans. The interest rate for this loan would be the current Treasury rate minus 1 percent (currently about 13 per- cent) or 7 percent, whichever is less. Thus, the N.D.S.L. will be phased out. To manage this new program, a federal bureaucracy in Washington would be created. Also .\!_Ilder the new proposal, student-parent loans would have an interest rate of the current Treasury rate plus 1 percent - a rate of 15 percent. The proposal also calls for the immediate accrual of interest and repayment of the loan. Thus, the nine month grace period currently allowed, will be eliminated. This new proposal drastically increases the cost of loan repayment for many students. According to a legislative alert distributed by COPUS, the "loan proposal would not only reduce accessibility ; but it would also be directly responsible for . placi!}_1t a greater financial ~~~ , ~~ Bloomsburg State · College . . SUivlMER SESSIONS -·. u980 · 200 Undergraduate Courses - 125 Graduate Courses (Business -- Arts & Sciences -:_:-Prof~s·sional Studies) ··· Da; and Evemiw u ~ · - Why _Not ~nrol~ for_ $39~00 per under- grf'jd!Jttte credit hour and $51.09 p~r graduat~ hour for In-State and Oui-ofSt·ate students. .. .. .. Work toward your undergraduate or graduate degree .. .. .. Continuing Education .... .. Off-campus courses S P E Cl A L PROGRAM Sc ...... Study tours abroad and in the U.S.A. .......Summ 6 r Theatre ......Special Teacher Workshops ...... Art Workshop S-E VE N Session Session Session Session S E S S I ON S : I May 27--July 3 11 June 16--July 25 111 July ?--August 15 IV May 27--June 13 obligation on students. " . To prevent this proposal from being passed, COPUS has organized a massive letter writing campaign to President Carter to express the students' concern about this legisla. tion. Approximately five thousand letter have been sent in from New . York, and it is hoped that Students Florida Trip Considered Nice Break From School What? Julius Caesar in Florida? Well, not exactly. Those who came, saw, sun-tanned and generally had fun were none other than the Wilkes College group which went there over the Spring break. The trip was organized, coordinated and publicized by Joe Galli, a Wilkes junior student, with the aid of Wainwright Travel Company which helps in organizing such trips for colleges. According to Mr. Galli, 76 students, 35 percent of whom were dorm residents, went to Florida at the cost fo about $300.00 per student. This money went towards the round trip air fare, car rentals and hotel fees. One of the students who went was senior Doreen Swaitek. According to her, the beginings of the trip were marred by a 45 minute flight delay in Philadelphia and a flight through bad weather caused by 2 tornadoes which struck Florida on Saturday, Feb. 1st. When the flight landed in Florida the students were greeted by cold and windy weather . which lingered for two days. Their vacation spirit was undampened though, and many made up for the weather by . visiting Disneyland, Miami and last but not least the numerous bars there. Among the highlights of the trip were a two · hour cruise, lunch and music on a paddleboat, visiting a major baseball team training camp, 'ladies' night at Pip's bar, sailing, meeting other students most of whom were from Michigan and, of course, visiting the bars . The last three days were (illed Session V June 16--July 3 Session VI July 7--July 25 Session VII July 28--August 15 For r,;rtlzer in(onnation, detach and marl to: Office of Extended Programs . Bloomsburg State College Bloomsburg, Pa. 17815 ----~-----------------r-------------. • suMMER sEss10Ns ·-11 ~~~ : 1 1 . -~ .. I ' I J Naine - - - - - -- -- -- -- Undergraduate_ r II Address _ _ _ _ '_ _ _ _ __ _ __ G raduate - ._ · ll II _ _ _ __ _ _ _ __ _ __ ___ Both_ II I . I I Telephone · ·• · · I I. . - - - - - - - - - - - - - - - - . - - ... - - - .... .... - -·. - - · ~--1 ~ ~ ~ ~ ~ -~!Ii:!' from Pennsylvania can show a similar response. All students at Wilkes are urged to write a letter. The address to which letters may be directed, and further information concerning the proposal may be obtained at the COPUS office on the second floor of Weckesser Hall. Mary Kay Pogar © 1977 20th Century-Fox Tomorrow In CPA 7:00 And 9:30 pm "Donald Duck" Cartoon Included . with sunshine and many students went to the beach which had suddenly come alive. The sudden fair weather was greeted too enthusiastically by some resulting in a few cases of sun poisoning. When .the time to leave came, it brought sadness to many. While a few felt the trip was "not worth it", the majority felt it was good. "It was a good break from school and a good change from the Wilkes-Barre weather", said Miss Swaitek. When asked about student participation she said "I'd like to see more dorm students going next time. It was super and I'm glad I went. It was worth it." The idea o_f the trip began according to Joe Galli, in September last year. "I started working on it soon after that. It was really hard work and it took up a lot of my time. " Obviously his time was well spent and rewarded with a smooth trip. Asked about the possibility of another trip next year Galli said "I think we should have another trip along the same lines next year." He rlitl n~• however state where exactly he expected next year's outing to be. Anthony D. Sibiya NOTICE Another chairperson is needed for the Cherry Blossom Festival. Anyone interested is asked to contact Dave Blumfield at the Student Government office_. Notice Applications are now available for positions on The Beacon and The Amnicola, the campus yearbook, for selection of next year's staffs. The positions of Editor, Asst. Editor, Business Manager, and Photography/ Art Editor are open on the yearbook staff; Applications may be picked up at Dean Hoover's office and are available through Friday, March 25, 1980 . All editorial positions are open for next year's Beacon staff. Applications may be picked up at The Beacon office in Parrish Hall or the Public Relations office. They must be returned no later than Wednes, day, March 26, 1980. NOTICE Anyone interested in being film committee chairman for Student Government for next year is asked to contact Janet Croft at Dana Hall . or Dave Blumfield at Denison Hall or leave a message in the SG office, �Page 8, The Beacon, March 20, 1980 Health Science Careers------- ------------------------------------------~-------------- JlrofeSSioital Schools Accept More Wilkes Graduates · --- - - Acco~g to Dr. Ralph B. Rozelle,,Dean of Health Sciences, over 150 of Wilkes students have been placed in professional schools specializing in health related fields i the last three years. Rozelle noted that the 150 figure represents only those students that the Health Sciences Office know about. There . are also other students who are admitted to professional schools. Also, the 150 figure suggests that approximately ten percent of the students in each class enter graduate schools for training in the health sciences. The following breakdown for 1977, 1978, and 1979 represents a partial listing of admissions to professional schools. In 1977, 23 students entered Hahnemann Medical College through the Wilkes-Hahnemann Program and nine more were admitted to medical schools through regular admissions. Also, five students entered schools of osteopathic medicine, six students matriculated to schools of podiatric medicine, two students were placed in optometry schools and three students entered dental schools. In addition, five students were admitted to pharmacy college. In 1978, 18 students proceeded to Hahnemann Medical Coll~e through the Hahnemann Program and through regular admission, five more students entered medical colleges. Pharmacy schools admitted five students and two more were placed in colleges of osteopathic medicine, six students went on to schools of podiatric medicine, dental schools admitted three students and optometry schools admitted two. In 1979, 25 students entered medical school, 20 of them through the Wilkes-Hahnemann Program. Six students were placed in schools of osteopathic medicine, and four students were admitted to optometry schools. Schools of podiatric medicine took in five students, four students matriculated to dental schools and five more were placed in pharmacy schools. Rozelle explained that of the students admitted to these schools during the past three years, only two have dropped out, and they had been students in the Hahnemann Program. Rozelle commented that before 1974, when the first WilkesHahnemann class entered Hahnemann Medical College, there had been a maximum of between 10 and 15 students admitted to professional schools annually. In the years since 1974 several programs in other health fields have been initiated: a program in podiatric medicine was started in 1976 in cooperation with The Pennsylvania College of Podiatric Medicine. A program in optometry with Pennsylvania College of Optometry began in 1977. And, in 1979, a program in cooperation with Temple University's School of Pharmacy was begun. These programs, along with proposed programs in dental medicine and other areas, will assure Wilkes of over "50 captured seats ( in professional schools) aside form regular admission each year," stated Rozelle. "As many students from Wilkes go into podiatric medicine," he continued, "as from any other school in the country." He pointed out that many of the larger colleges do not have as many different programs in the health sciences as Wilkes does. These colleges just try to "push" students into medical schools. Rozelle related that th.e college has "absolutely superior preprofessional advising," and it tries to give students a wide variety of choices. Students are often sent to observe practitioners in the area and as a result can be sold on a profession in a certain health area. Rozelle mentioned fhe admissions tests for the professional schools and suggested that "our students do quite well" on the tests. Students hoping to get into schools of medicine, osteopathic medicine, or podiatric medicine take the Medical College Admissions Test (MCAT). Last fall 17 students took the MCAT and 50 more will take it this spring. Rozelle quickly pointed out that no conclusions can be drawn from those figures because some people take the test twice. Also, several prospective dental students take the Dental College Admissions Test (DAT) each year and prospective optometry students take the Optometry College Admissions Test (OCAT>. Students taking any of these tests can receive help from the college or through the Kaplan courses, and many students take advantage of these services. Rozelle give credit to several of the campus psychologists, Mr. Kanner, Dr. Bellucci, Dr. Blumenthal, and Dr. Charnetski, for helping students to improve their test taking ability. Wilkes-Hahnemann Program Hahnemann (regular admission > Temple University School of Medicine New ,Jersey Medical School Eastern Virginia Medical School Georgetown University Medical School Washington University in St. Louis Thomas Jefferson Medical Center Hershey Medical Center Foreign Medical Schools TOTALS 1977 23 2 I I ll I I 1!17!1TOTAL 20 61 1 -I 2 2 2 :1 I I I I -I 197!1 2 I I :1 32 2:1 25 80 :1 !I - . Pennsylvania College of Optometry 2 2 TOTALS 2 2 Pennsylvania College of Podiatric Medicine Ohio School of Podiatric Medicine California College of Podiatric Medicine 2 I 3 -I 2 2 !I I 7 TOTALS 6 6 5 17 University of Pittsburgh Dental School Case Western Reserve Dental School Temple University Dental School New York University Dental School Fairleigh Dickinson Dental School 2 I !I 8 3 2 I 5 I 2 TOTALS 3 3 Temple University Pharmacy School 5 5 5 15 TOTALS 5 5 5 15 When asked which majors take the admissions tests, Rozelle · responded that students in any major can take the tests and be admitted to a medical or other professional school provided they meet the requirements for admission. Those requirements for admission. These requirements usually state that a student should have at least a 3.0 .cumulative average, a 3.0 average in all science and math courses, and in the case of medical schools, a grade abo~~ !!le !iftieth r·. ..· · · percentile on the MCAT. In addition, course requirements usually include several credits in chemistry, physics, biology, and math. Rozelle commented that many times if a student cannot get into one professional school, the college will help them get into another one. Louis Czachor ~ < l l , _=___ ····•·.w.w.- ............. •·• ·• •.•.••w•.·········· ... .. ..... . ·, ·,·'Ill Philadelphia College of Osteopathic Medicine Kirksville College or Osteopathic Medicine New England College or Osteopathic Medicine Des Moines College of Osteopathic Medicine New Jersey College of Osteopathic Medicine 5 TOTALS 5 2 6 KIRBY HEALTH CENTER ANNEX 63 N. FRANKLIN ST. WILKES-BARRE 824-8921 MON.-FRI. 8:30 a.m. to 5:30 p.m. Eveninis by Appointment I I GOLDEN ACC ENT KENSINGTON JEUNESSE The perfect way to show your love when it's for keeps ... A Keepsake diamond reflects your love in its brilliance and beauty. It's guaranteed perfect in clarity .. .for fine white color ...and precise cut. You can choose no finer diamond ring . Keepsake® iulistettd Diamond Rings CARLYLE &Co. ~Sldblislted 1322 Wyo ming Valley Mall Confidential services available regardless of age, sex, marital status, or ability to eay-. {~merican Express, Visa, Master Charge} } or Our Custom Charge Plan. f i(t::·;:::-~t:::;:::/t::~=•=;=~;;::=: :::,: :=:: ::::::·: : :.:-:-:=:=:·:=:-:=:=:=:=:=:=:=:=:=:=:=:=:=:====== :=:===:::i::::::::.-=-·-i!I! ��Page 10, The Beacon, March 20, 1980 Grapplers Place Third In EASTEIINS The 1979-80 edition of the Wilkes College wrestling team finished the year with a 19-2 dual meet record to set a new school mark, placed third in the 75th annual Eastern Intercollegiate Wrestling Association (EIWA) tournament and qualified four grapplers for the NCAA event. Wilkes 134 pounder Bryan Billig of New Tripoli won his second consecutive EIWA runnerup trophy to advance to the nationals. Billig wrestled NCAA champion and runner-up title holder Darryl Burley of Lehigh in the finals and found the going rough. The Colonel stalwart breeEed into the finals with two pins and a major decision and the Wilkes fans were upset-minded, as was Bryan. But Burley was too big, to quick and too strong for Billig, who ended on the short end of a 26-7 verdict. The junior matman went out to the NCAA's which were held at Oregon State University in Corvallis and gained a modeat eighth seed. Billig decked Western Michigan's Ron Voss in 5:42 during the first round preliminaries and took another step when he pinned . Purdue's Jeff Tolbert in 5:25 in the next round. But then Bryan was pitted aganst the number one seed and the NCAA champion to be, Randy Lewis of Iowa. Bryan wrestled a tough match and was able to stay with his AH-American opponent for two periods. At the end of the first, Billig trailed by a narrow 2-1 score and was at a lo-6 deficit at time of the fall in 7:30. Bryan then lost a 12-11 heartbreaker to UCLA's Harlan Kistler to be.eliminated from further competition. Sure, Bryan was disappointed, but look at his ac. complishments throughout the season. He finished the year with an 18-3 dual record and a respectable 23-6 overaH mark. Bryan was the first athlete of the year, and first Wilkes athlete to win WNEP-TV, Channel 16's "Athlete of the Week" award. His name also remains in the final individual rankings by Amateur Wrestling News as the ninth best wrestler in the country at 134. Billig etched his name in the record book when he registered 10 falls during the dual season and decked four more foes in post season action to total 14 overaH. He tied Al Zellner's dual mark and Jim LACROSSE, GOLF, MEN'S TENNIS AND WOMEN'S SOFTBALL PREVIEWS WILL BE FEATURED IN NEXT WEEK'S BEACON. Weisenfluh's overaH pin record. He also duplicated the school record of 18 victories in a single season which was established by Mark Densberger last annum. Bryan will get another shot at winning and NCAA place-finish next year and you can bet he will leave Wilkes College among the "Top 20" AllTime Dual Wrestlers. Wilkes c~aptain Mark Densberger, Danville, dropped a knotch from last year's championship title and was forced to settle for runner-up. Densberger sat out a few weeks and it showed in his bouts during the third period. ln fact, Densberger led his finals opponent Jim Reilly of Lehigh until Reilly pulled off a cradle late in the . third period. The Blue and Gold 158 pounder was leading 7-0 after the first period and Reilly initiated a gradual comeback to win 12-7. Densberger posted a fall, a superior decision and regular decision to reach the final round. In the NCAA's he picked up two wins, while losing two in the competition. In his opener, he scored an 8-5 decision but lost the next bout by a 6-3 verdict. In consolation action Densberger showed his Ship- Wilkes history with a 54-10-2 pensburg opponent Toby Brion the lifetime dual slate and .843 percenlights in 1: 20 but lost to Reilly of . tage. Lehigh again, 2-0 in overtime. Bart Cook, co-captain from NepDensberger showed a 13-3 dual tune, N.J., qualified for the namark while finishing 17-6 overall tionals by virtue of his third place this winter. finish in the Easterns. But Bart In addition, Mark is tied for the travelled to Oregon and was 7-lOths most dual victories in one season of a pound over the required 177 (18), has wrestled the most dual limit. Bart was working-out to loose matches of any Wilkes wrestler the weight but was caned for a skin (66) and set a new record of 54 dual test which is mandatory for all convictories in a career. Danny House testants. He lost time to shed the exwas the former holder of that tra weight when he had to stand in record with 51: Mark leaves the line for the test and consequently team as the 17th best wrestler in didn't make it. Cook finished the season with a .IUIIUIIIIIIHIUIHUIIHIUIIIIIIIIIIIIIIHIIIIIIHIIIIDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIUUIIIIIIIIIIII. 13-2 dual and 17-3 overall slate. He became the 19th best wrestler in the ALL-TIME TOP 20 list with his .833 percentage. Bart had a 37-7-1 all time life dual register in a Blue and Gold uniform. Unlimited Bob Matzelle, ~ The Wilkes CoHege baseball team DeFelice, a pro prospect is 9-3 in .360 and Marino's .340 clip._ returned from its annual "southern his first three seasons at Wilkes and At first-base Wilkes has junior Lindenhurst, N.Y., dropped an 11-3 swing" this past weekend and Dave owns a 2.48 career era. Last year he slugger Chick Andre~scavage, who decision to Lehigh's Drew Deiser in the championship finals to bring a Kaschak feels the trip was a suewas 4-3 with a 1.98 era and had 47 earned All-Middle Atlantic Conrunner-up trophy home. Bob adcess. In a 5-5 tie with Randolph k's in 50 innings while allowing only ference honors in his freshmen Macon, the Colonels were led offen45 hits. Carl, a former Central Colyear. Last season the burly one vanced through the EIWA's with a sively by Phil Marino, Harry Arumbia star, was 2-0 his first season from Pittston swatted at a .320 clip default, a superior and a regular doline, George Kavulich and Jim and 3-0 in his sophomore year with while leading the team in doubles decision. In the NCAA's Bob won Morrissey, with two hits apiece. a 1.85 era. and homers. Chickie is a .332 career his first contest by a hefty 16-0 score, but was pinned by Dr. Death Sophomore Dave Taylor was imAnother veteran expected to aid hitter who cuts his errors down to - Steve Williams of Oklahoma - in pressive on the mound with three the Colonel pitching corp is junior only ONE last year after committhe following round. Bob got back perfect innings. Jim "Rainbow" Kearney, out of ting 11 miscues in his freshmen into the competition's consolation After a "snowed out" game at Coughlin. Kearney is 3-2 in his campaign. bracket, but suffered another setLynchburg, the Blue and Gold career witha 2.55 era .and four A battle for the second-base spot back to be eliminated. Matzelle downed previously undefeated saves. Also expected to bolster will be between senior vet Rick knotched a 12-3 dual slate and 16-6 Guilford -14-6. Guilford was 3-0 goKaschak's pitching lineup are letMarshan, frosh Ross Zanghi and overall for the Reesemen. ing into the game .and coming off a termen Tony Vlahovic, Steve Swansophomore Chris DaRe. Joe Wilkes finished with 8.25 points in win over Wake Forest. Winning pitson, Randy McHenry, Dave Taylor Malatesta should be the favorite at the NCAA Championships to finish cher for the Colonels was and Ken Rodick. Newcomer hurlers the shortstop spot but will be in 32nd place. In duals, Wilkes sophomore Ralph McGuiness, out include: freshman Rich Geffert challenged by a few newcomers established a new school record of of Meyers. Veteran Carl DeFelice from Coughlin, Bob Miller and while Marino holds things down at 18 consecutive victories and will looked good in three hitless frames, McGuiness. the "hot comer" - third base. enter next year's schedule with the while sophomore Tony Vlahovic AH-MAC Jim Morrissey is back Next week's BEACON will win streak. came on to pick up the save. as catcher and lie will be pressured feature a preview of the Colonel Wilkes landed three other placeSenior Rich Borofski had two hits by freshman Sam Berto. Also at teh outfield and its season in general. winners in the Eastern tourney; including a homer against Guilford receiver position are: Jim Adams, Wilkes will be looking to return to Billy Dodge, Lenny Nelson and while Paul Yurko added a single Ned Sandercock, Wayne the form which brought them three Rick Smith. Dodge, a junior from and double and three runs scored. Yankowsky and Pat Romich. Morstraight 20-plus win seasons and Arlington, Va., started like a "ball Ardoline, a newcomer, again had rissey was the third leading hitter three-NCAA Regional bids before of fire," knocking of the No. 7 and two hits with two rbi's while Bob on last year's team with a .339 last year's 16-9 campaign. No. 2 seeded wrestlers, but then Luby chipped in with three safeties :iw•r:i,,,. behind Dave Hungafiler's Eddie White was cooled off and took sixth place and two runs batted in. The Colin the 126 pound category. onels were expected to meet John -Nelson was the only freshmen to Hopkins on Sunday. garner a place-finish in the tournaThe 1980 Wilkes diamondmen will be led by senior tri-captains Phil ment, as he took a fifth place trophy. Nelson, unseeded in the Marino, Carl DeFelice and George Kavulich. Marino is an All-MAC event, knocked off the sixth seed in the first round, and then lost to third-baseman from Wilkes-Barre and Bishop Hoban. DeFelice, the third seeded Dennis Reed, Lehigh. ace of the pitching corp, hails from Nelson posted two victories and lost Mifflinville and is another AH-MAC one in the consolation bracket at 142. Nelson ended with an 11-5-3 selection while Kavulich, a slick overall record. outfielder, is from Olyphant. At 190 - Rick Smith dumped his Marino is a .358 career hitter who first two opponents with two falls in batted .340 a year ago. Phil enjoyed an aggregate time of three minutes. his finest season in his sophomore He then lost a tough 5-4 bout to campaign with a .418 average and EIWA champ Mike Brown of fielded his position at a .914 clip that Lehigh. Rick won winless in the year. Kavulich owns a career consolations to take sixth place and average of .249 after last season's finish with a 15-5 overall mark . .246 and is a .922 percentage career fielder. At 118, Kris Rowlette, a freshmen, lost a 14-5 decision to number one seed Rich Santoro in the first fray and dropped a decision in the consolation's to be ousted from the competition. Kris finished 6-6 and 6-8 overall. In 167 competition, Dan Miner was eliminated in the first round of competition, losing to Eric Wenzell I DeFelice, Marino, Kavulich Captains; I I - I Colonels Back From Southern Trip l EMERSON'S ~~~~~~~~~~~~~~~~~~~~~~7 ~ I~ features: · - Friday Thursday PHIL PILORZ II .lI, I~ IL..,...__..ALEX ROMINE ...............,.....,.............. ..,........~..,....,..~...,... .--.. . ,. .. . . .. ., ,. . ~.............. ,. . ofF&M. BASEBALL TRI-CAPTAINS AND COACH - Shown above k. neeling is Wilkes baseball head mentor Dave Kasc.h ak ... tanding left to right are tri-captains Carl DeFelice, George Kavulich and Phil Marino. (PHOTO BY MILLER). •: S. - •• ~ '. •• - :, • "°"W •- •••• •• ••••·•••w •·- '❖°y;.~"@."~,:~ Overall, Wilkes took third place in the tournament with 83 points, following Lehigh and Navy respectively. Bob Gaetano . . J �Kendig M ,VP~ between the white lines by Eddie White All-Time Scorer 'fhe Wilkes. College women's basketball team of first-year coach Nancy Roberts, accomplished its most successful year in history. The Colonelettes finished with a 1610 slate while advancing to the Middle Atlantic Conference playoffs for the first time ever. " It was a learning season for all of us," said Roberts. " Some of our underclassmen really grew up this year." Wilkes was led by junior All0 American candidate Diane Kendig, who led the nation in scoring while averaging 25.0 points a game. Already she has been named MVP of the MAC and to the first team of the NPWIAA league, of which Wilkes was co-champions with Marywood. Senior guard Mary Jo Frail made second team in the JQcal league while senior center Lynn Yedlock garnered a honorable mention. "Lynn was overlooked by many people this year. She deserved more recognition than she received,'' added the rookie coach. Frail and Yedlock each com- pleted their careers for Wilkes as they finished high on the career statistical 1.!sts. Their records stand at. t<'rail 897 points, 2nd alltime ; Yedlock 750 points, 3rd place . all-time; Frail 254 career assists is school record and Yedlock is the all-time leading rebounder with 600. Other records set this year both team · and individual: ~ Most rebounds a game, 19 by ~ edlock; rebounds season, 268 by Yedlock; most assists season, 86 Frail ; most points season, 600 by Kendig; most points career, 1571 Kendig. The mark for most points in a season by a team was set with 1651 and most rebounds a season with 978, .most steals a year 338, most assists 277, most free throws season 265-435 and most victories a season with 16 and best won-lose percentage and free-throw percentage. Diane Kendig led in scoring with 600 points and a 25.0 average and field goal percentage with .42 percent. Yedlock led with 268 rebounds. Gary Mack MIC Standings Announced J~ Gries, the voice of WBRE Radio Sports and head of the station's Metro Intercollegiate Conference (MIC) involving Scranton, King's and Wilkes, has announced the league's standings after completion of the winter sports. Scranton ("Duh U") remains in first place with 25 totals points ahead of King's (II) and Wilkes with nine. Last year, the Royals took the MIC title, which involves nine sports, over King's and Wilkes. Scranton's women's teams have lifted the Royals in the competition. In men's basketball, " Duh U" took the top spot with five points followed by Wilkes with three and King's with one. Those three finish- ed in the same ,order in cross coontry. Scranton swept the three women's sports too - basketball, v~lleyball and tennis - while King's garnered all three second place finishes. Wilkes took a third in the ladies events. Four spring sports remain and the-Royals look like they will wrap up another MIC title. The four sports left include men's tennis, baseball and golf and women's softball. The MIC banquet will be held May 2 at the Holiday Inn and a speaker will be announced next week. Last year, former Olympian Donna DeVaronna spoke. Al McGuire is a possible choice for speal!_er. •SOPHOMORES~ -NO MORE OPTIONS If you do not avail yourself of ARMY ROTC Benefits now, you will miss out on the $100 (tax free) per month available to ALL juniors and seniors in the Advanced Program. Serve on active duty · as a Commissioned Officer or with the Army, Reserve or National Guard in your civilian community. An Exciting Paid Six Week Summer Camp or Local ''On Campus" Session Can Qualify You! SEE CAPTAIN BOB KEENAN IN ROOM "C" SHEEHY STUDENT CENTER, KING'S COtLEGE or CALL COLLECT (717) 961-7457 Wilkes junior Diane Kendig was named recently as the Middle Atlantic Conference basketball women's "Most Valuable Player" for the 1979-80 campaign. . · Joining the former Wyoming Valley West standout on the first team were _Mary Beth Bowler and Kandi Karuzza of King's, and Denise Cappoccia and Fran Harkins of Scranton University. Kendig, Wilkes' all-time leading scorer, earned All-MAC honors in her first two years with the Colonelettes. She has been nominated for small college All-American honors and is a bona fide candidate. :~r::::::::::::::::::::::::::::::::::::::::;:::::::::::::::::::;::=:=::;::=====;=========~: N,C AA [: :r Q u· I z· j/j[ ;:;: :=:: :::: :;:; I). Who holds the NCAA individual on~-game scoring record for a regional'gaine? 2). Who holds the one-game rebounding record for the NCAA Tourney? 3). Who is the only three-time winner of the NCAA championship's most outstanding player award? 4). True or false: DePaul won its first regional title in 1979? 5) . What team ended UCLA's record string of 10 straight regional titles? 6). What team was runner-up to Al McGuire's Marquette title team in 1977? 7). What team was runner-up to Norm Sloan's North Carolina State title team in 1974? 8) . Who holds the Mideast Regional record for field goal percentagein one game? HINT: He played with Jacksonville in 1970 and WAS NOT Artis Gilmore. 9). John Wooden won his last title in 1975 and Al McGuire won his in 1977. What coach won in 1976 and what was the team? 10). Who is the all-time leading scorer (points) career wise in the NCAA cage tourney? ANSWERS 1. Oscar Robertson scored 56 for Cincinnati against Arkansas in 1958. 2. Nate Thurmond pulled down 31 in 1963 for Bowling Green against Mississippi. 3. Lew Alcindor, UCLA, 1967, 1968, 1969. 4.TRUE. 5. Idaho State beat the Bruins 7675 in 1977. 6. North Carolina. 7. Marquette. 8. Pembrook.Burrows. 9. Bobby Kniglit, Indiana. / 10. Elvin Hayes, Houston, 358 points. ;: :::: · J ;;::: ·.:.· Had a chance to take in some quality high school and college championship basketball this past weekend. On Friday we journeyed to Philadelphia to see the NCAA Eastern Regional Tourney. Iowa, playing more like a TEAM than any other in the country, was really impressive in its win over Syracuse and cry-baby coach Jim Boheim. The night-cap; which featured Georgetown over Maryland, was another barn-burner and left " Lefty" Driesel) still with the "great recruiter, lousy coach" tag. Usually in the "final four" there is ONE " Cinderella" team, but in this year's F.F., there are TWO - Iowa and UCLA. Iowa has come out of nowhere to display its TEAM-work and what can you say about UCLA. Any tea m that can handle DePaul, Ohio State and Clemson, well WHEW! You have to give Larry Brown and UCLA coaching staff credit. They turned a bunch of freshmen, who earlier in the year plainly STUNK, into bonafide championship quality players. Their win over DePaul shocked this writer, and then they downed a super Ohio State team. And whoever thought they would beat Clemson, which has a front line of 6-10, 6-10, and 6-10. The big test for the Californians is this week when they go against a veteran, legitimate "air-craft carrier" in Purdue's Joe Barry Carroll, We would predict Purdue, but with the way the boys from UCLA are playing now, they could probably knock off any of John Wooden's old teams. We've been saying all year that Sam Worthen of Marquette was one of the top guards in the country and he is, but recently we've added DePaul's Clyde Bradshaw, Louisville's Darrell Griffith, Maryland's Greg Manning and Georgetown's Eric "Sleepy" Floyd. Floyd and Manning put a show on Friday in the Regional. Floyd, only a sophomore, had one of the most awesome dunks of the year against the Terps, while Manning, a junior, was deadly from the outside to keep Maryland in the game, while Albert King took the choke. Manning, the best white guard in the country, played against Nanticoke Area when he played high school ball for Steelton-Highspire. Floyd, by the way, was named as the Eastern Regional's " MVP." In this year of the "team-play" concept, we like Iowa to take it all on Monday night. Luke Olson has done a super job as mentor of the Hawks and you might remember him as the coach of North Carolina-Charlotte, which went to the final four not too long ago. On Saturday, we took in the Class AAA playoff game at Pottsville between Bishop Hoban and Daulphin East. Hoban lost despite Mickey Banas' 29 points. We don't like to harp on such things, but we'll just say the officiating in that game was as good as in the Wilkes-Scranton game at Wilkes. Get the idea? The Wilkes wrestlers had a rough time in the nationals this past weekend, but that's expected. Let's face it, we'll never win any national titles in Division I, we're too small. This reporter feels, Wilkes should go Division II, if possible, in most of its sports. It would take a lot of money for scholarships, but it would also help the Division III coaches with recruiting. Remember, Divisions I and II can give scholarships, but Ill can't. It is a long and controversial problem. Scranton is trying to go II, but probably won't succeed. I guess we'll have to suffer along with King's and Scranton, through Division Ill programs. Did you know? Dept.: That Wilkes assistant basketball coach Steve Justice is now serving the school as lacrosse coordinator. " Gate" is one hard worker and did you know his basketball room-mate at Minnesota was current San Diego Padres superstar Dave Winfield. Trivia question: Name the teams in last year's NCAA "Final Four." Answer a little bit later. Upsala College lost in the Dividion Ill national championships game to three-time champ North Park (Ill . ). Upsala is led by a 7-0 foot freshmen center. The four teams in last year's I title series were champ Michigan State, Indiana State (where are all their fans now?), DePaul and, and - Penn. The sad thing about watching NBC's coverage of the NCAA basketball tourney, by the way the most exciting sporting event in the nation, is that it's the last time we get to see and hear Dick Enberg, Al McGuire and Billy Packer. They're the best team on the air covering the best game in town - college basketball, ther~~_1_1~t~if!g like it! BOWLING The Wilkes College Mixed League resumed play last Friday and, though the divisional leaders re11\ained the same, much shuffling took place elsewhere. The biggest change took place in the Pacific Division where Colleen Darrell's miraculous 194-477 led the BS'ers to a 3-0 sweep of the first place Avengers. The BS'ers, the new second place Whippets (Keri Lesniak 474), and the erratic EE's (Joe Rauschmayer 211-548) all moved into contention with 3-0 evenings. STANDINGS Atlantic Division Bud's Compressor &Supply 16-5 ~!other Brothers 752Crew Poky's Veterans Club I Midwest Division Aristocrats Assorted Nuts Good News The Pack The Force Pacific Division Avengers Whippets EE's BS'ers Veterans Club II Nukes 13-8 · 12-9 10-11 7-14 12-9 11-10 8-13 8-13 8-13 13-8 12-9 11-10 10-11 9-12 5-16 �.. Regi•tra~ion Schedule SENIORS-Class of 1!)81 Pre-Registration-Monday, March 31 and April 1 Registration-Tuesday, Wednesday, April 1 and 2 S-Z-8: 30-12: 30-Tuesday A-E-12:30-4:30-Tuesday F-L-8:30-12:30-Wednesday M-R-12: 30-4: 30-Wednesday SOPHOMORES-Class of 1983 Pre-Registration-Tuesday, Wednesday . & Thursday, April 8, 9 & 10 Registration-Thursday & Friday, April 10 & 11 Monday & Tuesday, April 14 & 15 S-Z-8: 30-4: 30-Thursday A-E-8: 30-4: 30-Friday F-L-8: 30-4: 30-Monday M-R-8: 30-4: 30-Tuesday JUNIORS-Class of 1982 Pre-Registration-Wednesday, Thursday, April 2 and 3 Registration-Tuesday and Wednesday-April 8 and!) S-Z-8 : 30-12: 30-Tuesday A-E-12:30-4:30-Tuesday F-L-8:30-12:30-Wednesday M-R-12:30-4:30-Wednesday <I-P can register with S-Z because they registered last as Sophomores). FRESHMEN-Class of 1984 Follow the same schedule as Sophomores, Class of 1983. � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 March 20th Date A point or period of time associated with an event in the lifecycle of the resource 1980 March 20 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/ca1070066b52e279ea4ffad79df0a097.pdf 8a002ba7f56e79030fad05be003a51a7 PDF Text Text f' te"e Forbert Cance Regarded A Success Student Government President Dave Blumfield announced at the Monday meeting, that he considered the Steve Forbert Concert a success. He commented that he "thought it went over very well," but that ticket sales were not as high as he had hoped. He pointed out that 1250 tickets liad been sold and he noted that a little over $2000 will be returned to the SG treasury. This will put the total in the treasury at over $10,000, which is considerably more than the amount left in SG's treasury at this time last year. When the $2000 is returned to the treasury, SG will have expended a total of $2500. Blumfield does not regard this expenditure as a loss, since he believes the money was put to good use in that is has been a long time since there was a concert on campus. He further noted that about 500 Wilkes students were present at the concert and that that was a larger representation of the Wilkes population than at most concerts on campus in recent years. Senior representative Bill Keba, referred to the $2500 "lo_ss" and stated that since only 500 Wilkes students went ito the concert, the $2500 figure seems to represent a loss of $5 on the part of SG for each student who went. IDC President Mike Stapleton responded by saying that there was no limit on the number of Wilkes students who could attend the concert and more could have gone if they wanted to. He inferred that the money spent by SG was for everyone's benefit, but not everyone took advantage of it. It was noted that 40 people got in the concert for free. Blumfield explained that 40 free tickets had been given away by radio station WEZX. It was further noted that in some instances the concert received poor publicity. Circle KFund Request In other business, two fund requests were voted upon and two new fund requests were presented. Some discussion and _debate took place regarding a request by Circle K for $400. Circle K President Jeff Gavlick explained that the money would be used to help with the expenses of sending 25 Circle K members to the organization's Pennsylvania District Convention in Carlisle this spring. After much discussion, the motion was put to a vote and was defeated 9-10-3. Blumfield asked the representatives to explain why they had defeated the proposal and most explained that they had voted against it because they felt that 25 people were not needed to "go to a convention to party." A debate began primarily between Bill Keba and Mike Stapleton. Keba felt that fewer members could be sent to the convention, and Stapleton felt that it was good that so many members were interested in going and he pointed to the numerous services Circle K has provided to the campus and to the community. Representative Tim Palmer made a motion that instead of $400, SG grant Circle K $200 for the convention. Following more discussion, Palmer withdrew the motion and Stapleton moved that $390 be given to Circle K. The motion was voted upon and pased 14-7-1. When asked by Blumfield why they changed their minds, the reps replied that they realized that the club really is interested in doing good for the college and that the convention should prove valuable to them. The other fund request that was voted upon was presented by the Biology Club. They asked for $180 to send a maximum of 12 people to an intercollegiate science conference in April. The motion was passed unanimously and any unused money will be returned to SG. "Parties Unlimited" Continuing the discussion of the past several weeks regarding "Parties Unlimited," SG unanimously passed guidelines .for the new subcommittee of the social committee. The Guidelines are as follows: 1. All profit money will go into account at Parrish Hall. Name of account shall be Social Committee; 2. No withdrawals can be made without the signatures of the Student Government Treasurer, President, and Advisor; 3. A comprehensive financial report shall be given to the SG Social Committee within three business days following the Continued on Page 2 College Named Second Party In Lawsuits Filed Against-Campus Food Service Co. According to Charles Abate, quested that the case be turned Business Office Manager, the over to the college's insurance carschool has received notification rier, North American Insurance that it has been named as a second Company. · party in three separate lawsuits filThe Business Office Manager ed against M.W. Wood, the campvs pointed out that to his knowledge, food service company, by three none of the tests being conducted by •students involved in the February - the state on the food samples under of 1978 food poisoning incident at question are conclusive, thus leavthe cafeteria. ing the possibility that anyone. in Abate explained the school's the·food service chain can be liable. notifjcation further by stating that This liability could include in two of the cases, a writ of sum- growers, packers, shippers and mons and trespass was received, retailers as well. If the state agency while in the third instance, a letter conducting the tests, which infrom the student's attorney re- cludes ail investigator who worked lndepend~nt A~icle News To· Campus An article which appeared in the February 24 issue of the "Sunday Independent" stated that Wilkes is considering a 20o-unit dormitory complex, although many of those involved in making the decision were unaware of it. According to Dr. Andrew Shaw, Dean of Management, the proposal is highly speculative right now. "It's possible, but no real decision has been made," he stated. He also : said that the Board of Trustees will make a final decision concerning -. the issue. The proposal has not been discussed with the board yet. The possibility of a new dorm is formulated in Space utilization ; Study and Planning Aid, submitted , to the college by planners and ar- · chitects Pyros and S~ndersoli, which is being condensed in the Beacon. The study suggests that a: dorm be built on West South Street or West Northampton Street. The Sunday Independent stated the dorm would be built in the present Conyngham parking lot on South River Street. Dr. Shaw stated that if a dorm were built, that parking lot probably would not even be touched. The second site the Sunday Independent includes is West South Street next to Bedford Hall. The photograph of the site is incorrectly identified as West Ross Street. Dr. Shaw stated that as far as he knows, no one at the college said many of the things included in the article. After the meeting of the Building and Grounds Planning Board meet this week, and the Board of Trustees next week, more definite statements can be made concerning the possibility of a new dormitory. on the Legionnaires Outbreak, cannot determine the one specific food item that caused the poisoning, then everyone in the food process will jointly be responsible. Mentioning no dollar amounts in any of the claims, Abate said the first case was filed in June of 1978, with the second one appearing in September of the same year. The final claim was not received by the college until January 30 of this year. Stressing that insurance is required of every food service on campus, the business manager expressed· strong beli~f that the college will not be held liable in any way. He continued \hat one of the few ways the school could be held responsible is if the lavoratory facilities were found to be unsanitary, but because cases of food _ poisoning occured in the same time period at other schools supplied by M.W. Wood, this possibility is highly unlikely. Abate once again stressed that the administration feels the college will not be held liable in any way, and continued to say that because there has been no permanent injury reported by any of the students to date, there is a good chance the suits will be handled out of court. Peter Steve NOTICE Due to Spring Vacation the next Beacon will be published on March ' 20th. The deadline for articles will be Monday, March 17. Patti Sparlow Gries, Glunlc & Hf:4rdy Nominated To Seek Re-electiPn Fo~ Office _ Nominations for next year's senior, junior and sophomore classes were held this past Tuesday and the turnout was poor. Ofihe 12 offices open for election, seven have one candidate listed on the ballot and the one office is open. It appears that nominations were first advertised as being held on Tuesday, then changed to today and then finally held on Tuesday. In the confusion, some students were not aware of when nominations were being held and were not nominated. They are, however, eligible to run as a write-in candidate. Each candidate runnti)g for the-· . had a successful year with its preoffice of president in the three , sent leadership. We'd like to keep classes was asked by the Beacon 1 this active tempo up for our final why they are running for president. , year of school. Their responses are listed below ex-1 In the Class of 1982 the candidates cept in the case of the Class of 1983- are: President, Roya Fahmy, Dan .in which their responses were lost. ; Glunk; Vice-President, X.aura The nominees in the Class of 1981 \ Danowsky; Treasurer, Steve are: President, Colleen Gries; t Voyce, Sue Palmer; Secretary, Vice-President, Joe Rubbico; , Theresa Gabana. - Treasurer, John Moffatt, Norm t Roya Fahmy - I would like to be Witko; Secretary- Margaret · president of the Class of 1982 Scholl. 1 because I feel our class needs a Colleen Gries - I would like to be · dynamic, active leader and I feel I re-elected as the president of the am qualified to meet this requireClass of 1981 because the class has ment. I also have an added qualification; I was a commuter last year and I am presently dorming. This gives me an insight into the lifestyles of many more Wilkes students. I feel this will help me promote and improve an important issue on campus: commuter-dorm student relations. Dan Glunk - This past year has been a successful one for the Class of '82. We have sponsored many original activities. For example, the sophomore class had the first Student Center party, sponsored Mother .Tucker Day, sold ValenContinued from Page 2 �Page 2, The Beacon, February 2s," 198o I SG Body Continues Wilkes College Family Schedules Trip Several Discussions To New York City For March Weekend the Student Government Social ContinuP-d from Page 1 On the weekend of March 21st to the 23rd, the Wilkes College family will be discovering the magic of Broadway, the Statue of Liberty, the Empire State Building or whatever sights and attractions one could want in New York City. Under the direction of Dean Arthur Hoover, three busloads of Wilkes faculty, administration, alumni and students, wQI leave Wilkes-Barre on Friday afternoon and then return Sunday evening from the fifth annual Wilkes New York weekend. The weekend, which Dean Hoover has been in charge of since its inception, is not structured in any way, only that you must be in the designated area at 7 p.m. on Sunday evening when the bu~s will leave to come back to the campus of Committee. Under Committee .Reports, the academic committee asked the representatives what their advisors had to say about the proposal to · clrange the deadline for course withdrawals from ten weeks to four weeks. The reps' responses ranged from agreement with the proposal to allowing students to drop courses until the end of the semester. Committee chairperson, Ana Nunez announced that members of the committee will be going around to various faculty members to explain the students' point of view before the proposal ~omes to a vote at the faculty's March 13 meeting. Blumfield noted that he will be speaking at the faculty meeting. Faculty committee reports were also given at the lengthy SG C~mmuter Council will h<? spon- dropped of in front of the Learning meeting. It was reported that sonng a bus trip to New York on Center. Ticketsare$9.50andwillbe budgets for the Beacon, Amnicola, March 1. The bus will leave Wilkes on sale all during this week. Tickets and "Manuscript" were passed for College in front of the Stark Learn- can be obtained over in the Sfudent the 1980-81 school year by the Stuing Center at 8 o'clock and will ar- Center. John Moffatt, is the dent Publications Committee. rive in New York where students chairperson of this event. Last Blumfield said . that he had inwill be discharged in front of the semester, a similar trip was sponvestigated the awarding of scholarRadio City Music Hall. sored and it was very successful. The return trip is scheduled to Also discussed at the meeting_ ships to the editors of the publica- · tions. He noted that he went right to leave New York at 11:30 and was the St. Patrick's Party slated the top of the administration to find students will be brought back and _ for March 14 at the Sterling Hotel. out why scholarships are awarded Free beer and wine will be served and he found out that the scholaralong with snacks and the band ships have been awarded tradi"Nature's Way" is·expected to pertionally. He further noted that some form. Tickets will be $4.00 and will people in the administration feel go on sale after the break. Any adContinuedtrom Page 1 that he, CC President Bill Lewis tine's Day Carnations, sold Class ditional information can be obtainand JDC President Mike Stapleton mugs and now is completing plans ed by calling the Commuter Council should not receive scholarships for for the Freshmen-Sophomore Din- Office in Weckesser Hall. their work. They receive full tuition The relatively short meeting conner Dance. The class has done scholarships for their service. many things and had many suc- cluded with an update on a tenative The Student Life Committee cesses, but we failed in one area. Block Party slated for April 25. The reported that a committee has been Block Party will consist of a blue Coming into office a year ago, I set up to look into ways to help hoped to bridge the gap between grass band and a suggestion was foreign students academically. commuter and dorm students in the made to have a guitar playing conAlso, they noted that the Dean's test at the Block Party. It was also class, but this has been difficult. Council is looking into the matter of There is definitely more room for noted that there will be a Social putting the students' rights on Committee meeting today, Thursimprovement in this area and I paper. day 28, at 11:30 either in Weckesser sincerely hope that if I'm elected I ,Louis Czachor _can achieve this goal, while conti- Hall or Franklin Hall. Darlene Schaffer nuing many class functions. Under the Class of 1983 those running are: President, Dennis Hardy, THE GREAT NEW IN-PLACE Carl Kadtke; Vice-President, Eric Farber; Treasurer, J.ean Colonna; ~ FOR THE "COLLEGE" CROWD Secretary, no nominees. .Elections will be held March 13, --r' LIVE ENTERTAINMENT AT tne Thursday after Spring break. __ _ _ _ party. The report shall include ticket price, itemized expenses, revenue, and gross profits and-or losses; _4. All profits exceeding the fifty (50) dollar limit, shall be turned over to the Student Center Board Bill Miller for renovations; 5. All events spon/ sored by "Parties Unlimited" must NOTICE comply with all regulations set There will be a meeting of the forth by the Social Committee; 6. Junior Class this Thursday at 12:00 "Parties Unlimited" will be a subin S.L.C., room 166. committee under the auspices of Wilkes. Accomodations for the weekend are at the Abbey-Victoria attending, contact Dean Hoover on the second floor of Weckessar Hall. A non-refundable deposit of $10 is required to guarantee your reservation. Hotel which is located at 51st and Seventh Avenue in the heart of the theater district. The-cost of this excursion will be $53.50 per person which is an exceptional bargain for the services included. The cost of your ·bus ticket, your hotel, and your baggage handling is all figured into that price. "The last time I was in New York, which was quite recently," adds Dean Hoover, "the cost of those same items was over$120." Many members of the Wilkes family have already made their reservations to attend this fun filled weekend in-the "Big Apple." "We already have two busses almost completely reserved," adds Hoover. So if anyone is interested in N•w York Trip Slated By Commuter Council 1980-1981 Acade1Qic Calen4ar Sammer - Fint Day Session Classes Commence Classes End ·Second Day Session Classes Commence Classes End Monday, June 16, 1980 Friday, July 18, 1980 (Includes Final Exams) 8:00 a.m 12:00noor Monday, July 21, 1980 Friday, Aug. 22, 1980 (Includes Final Exams) 8:00a.m. 12:00noon Monday, June 16, 1980 Thursday, Aug. 7, 1980 (Includes Final Exams) 6:00p.m. 10:00p.m. Monda,>7, Sept. l, 1980 Friday, Oct: 17, 1980 Wednesday, Oct. 22, 1980 Tuesday, Nov. 25, 1980' Monday, Dec. l, 1980 Friday, Dec. 12, 1980 Monday, Dec. 15, 1980 Sunday, Dec. 21, 1980 Monday, Dec. 22, 1980 Tuesday, Dec. 23, 1980 (7½ days for Finals -70days) 8:00a.m. 5:00p.m. 8:00~.m. 10:00 p.m; 8:00a.m. 5:00p.m. 8:30a.m. Nominations Evening Session · Classes Commence Classes End ' FALL SEMESTE✓R Classes Commence Fall Break Classes Resume Thanksgiving Break Classes Resume Classes End Final Exams Begin FreeDay Finals Resume Finals End 8:30a.m. ll :30a.m. SPRING SEMESTER Classes Resume Spring Vacation · Classes Resume Easter Vacation Classes Resume Classes End Reading Days Final Exams Begin FreeDay Finals Resume FinalsEnd . · .. Monday, Jan. 12,1981 . Friday, Feb. 27, 1981 Monday, Marhc 9, 1981 Thursday, April 16, 1981 Tuesday, April 21, 1981 Tuesday, April 28, 1981 (Tuesday, April 28, will follow Friday schedule) Wed. & Thurs. April 29 & 30, 1981 Friday, May 1, 1981 Sunday, May 3, 1981 Monday, May4, 1981 · Sunday, May 17, 1981 m~days for Finals -70days) MOTdRCfC[EFOR SALE I 1973 HONDA STREET TRAIL 350CC Asking $400 . 8: 00 a.m. 5:00p.m. 8:00a.m. 10:00p.m. 8:00a.m. 5:00p.m. "1_,-...,""'_.,.,....~,-~...,"'llw JIM DANDY'S ,1111 .... t I Book and Record Mart _ 18 S. Main St. 8:30a.m. • ' . 8: 30a.m. , ll :30 a.m. / ~ MARK PLAZA, EDWARDSVILLE APPEARING FRIDAY NIGHT •• REESE PEL TON WIikes-Barra BOOKS-RECORDS-TAPES 825-4767 AT THE PIANO WITH SONGS EVERYONE WILL REMEMBER •• Cliff and Monarch Notes Beer by the Pitcher '• (Proper I.D . Required ) Relax in the friendly atmosphere with exciting, vibrant people Januzzi's Pizza and Hoagies -HAVE A FABULOUS TIME-------No Cover or Minimum Burgers & Beef Sandwiches Served 21 Different Ways 125 Academy Street Home Delivery -\OPEN 7 DAYS 11-1 Good Condition I Call 829-4096 -:•:•:•: Stop_in before or after the movies Mon .-Sat.: 11 a .m. to 2 a .m. Sunday: 3 p.m. to 2 a.m . . -:•:•:•: . ;~~~~;;~rt~~~i~~~~t~~~~~~~~~~~~~~~~~~i~~~~~~~~~~~~;~~i~~=~=~=~=I=~=~=~=~:i=~=~=~:~=~=~=~=~=i~}~~~~~~~~~~~t~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~=~=~=~=~=~~r~~~r~~~~m~~f ~~~~f �February 28, 1980, The Beacon, Page 3 1st World Karate Pentathlon Champion To Present Martial Arts Demonstration Hidy Ochiai is considered to be one of the best professional martial arts performers in the world. He is best known for his spectacular demonstrations, one of which will take place Wednesday, March 12th at 7:00 p.m. in the Center for the Performing Arts. world, he is the first World Karate Pentathlon Grand Champion, being number one in the total score in free fighting (sparring matches), form (kata), weapon use, self-defense techniques and demonstrations. The Karate Pentathlon Competition determines the world's best all- ... Entertainment three times in a nationwide telecast during 1973 and 1974. His keen insight and openmindedness have enabled him to make a successful transition from the old country's traditionalism to modern karate world, while still maintaining the true · samuri virtues of self-discipline, courtesy, respect, constant training of mind , andbody. Ochiai also has been particularly successful in transforming the art of karate into a modern tool for selfdevelopment for each individual in our modern society, emphasizing physical fitness, self-discipline, and the method of concentration and relaxation. Hidy Ochiai has been selected to the most martial arts honor, Black Belt Hall of Fame as 1979 Karate Instructor of the Year. In 1978, Ochiai accomplished an unprecedented record of the triple . crown by winning the three largest tournaments in the country; the Battle of Atlanta, PKA National and the U.S. Open. Hidy Ochiai is being brought onto campus by Student Government, Commuter Council, InterDormitory Council and Concert and Lecture Series cooperatively. ment is pleased to announce that Mr. William Tersteeg, a noted area ceramic sculpturist, will be holding a one day workshop on Tuesday, Feb. 26th, 1980. This workshop is open to all interested people. I 8'"'.,r~..,c,o,-..A:>""J'"J'"J'"J'"J'" ✓ J'" ✓✓ --g --------~~-------.._._,.___---------______,..,..,,._..,,._.,.-.,.,,...,________.,.,,..,...,..,~ § BROOK' s N.Y.STYLEPIZZAandSUBS·at § BARBER ~~-~ 8 SHOP ANTONIO'S §- . ;,; . ·SUBS STROMBOLI - located Right Across the ;I SI , . • STY LINGFORMEN&WOMEN H"'• cotoaING & c0NoI1!0NING PERM"NENT W"VING •H"I•s1•"IGHTENING • SC"LP I. F"Cl"l TRE"TMENT MANIcuRING. sHoE sHINE CALLFOR"PPOINTMENT 1 s ' li MAINFLoo• i • ~ - SICILIAN· Along with the body of choreography developed by its founder, artistic director, their group's tours and major New York performances also feature pieces created by outstanding guest artists. This company is widely known for its percussion dance plays, where the dancers play hand held instruments, creating their own musical environment as they move onstage. Rodgers has also developed his own approach to sculptural movement landscapes which was described_ ~ a DANCEMAGAZINE critic as "some of the most exciting abstract movement around." Some of their most important work has been described by major critics as "powerful social commentary" and as "a unique dance celebration of Afro-American experience." Rodger's most recent experimental pieces feature live musicians § I t M § • 24 23.25 Si Ri (a•F000:~Ks~:,tt~o-•G.')nesS•RTo"'° ~PR 0P Bridge, in the Narrows Phone 288-7663 or 288-7664 Fresh" · for advance orders · "NUMERO UNO" "Oven and city agencies as well as private corporations. The Rodger's Company was chosen for a six-week goodwill tour to Sengal, Nigeria, Kenya, Zambia, Syria and Portugal by the United States International Communications Agency in the spring of 1978. The company has toured extensiveI throu out the United States. NOTICE The Wilkes College Art Depart- around karate practitioner. Ochiai has toured the United States and Europe as a member of the International Master's Exhibition Team. He has appeared as a feature performer in ABC's Wide World of Sports and Wide World of . d a II t h e rest, You ,ve fr,e Now try t h e BEST!!! The Rod Rodgers Dance Company will be performing their unique style of dance on the stage of the Dorothy Dickson Darte Center for the Performing Arts on March 18th. The group will appear under the Concert and Lecture Series. The Dance Company, primarily a touring company, came into being from a choreographic exploration and experimentation of its founder, artistic director Rod Rodgers. The company has been in existence for about 15 years ; its activities have been supported by federal, state Margaret Scholl Hidy Ochiai In Action Hidy Ochiai has won the United states Grand National Kata Championship from 1971 to 1974 consecutively, and in 1975 he received the title of the International Grand Kata Championship. In addition to being the top kata p~rform~~-in the RodRodgersDance Co. To Appear March 18th _ 15s ,uNwN ~1. . w11KEs .amc • &,,✓-)0-""/"_,.,......ocr ✓-r~L,...,_.~~-----~~------~~-----....,.,,...,..,,...,-~~-~..,._,,...,...,_.~..,._,,...,-~..,._._ ~...-....-.~.._.....,.. ....... ....r.......,_.....,....._....__...~~ "-[JI ~.[JI r[JI I] 11"-I]lJ ~ l I c:. LIi [ii [ii [JI L.ll[ii • i \ ~ ) :i J Layaway Aval_lab_le i1Jr \i we Accept Moster Charge & Visa [Jl]rTI ll I] fl flfliS r.ra[I SIJSlflrTIS J 1..:,T ......h...... ey:::h:;:.a_ve_a_lso-m-ain-t-ain_ed_a-co_m___ons_ta_ge-w-ith-th-e-da-n-ce_rs_in-an-e-xJ mitment to bringing programs to uberant collaboration called "Jazz \ community audiences which have Fusions." The incredible scope of ~ had limited opportunities to see this versatile ensemble's work professional concert dance. During challenges widespread stereotype r its years of successful activity, the notions of what today's dance integrated but predominately black theatre can encomoass. group has dramatically Margaret Schell demonstrated its ability to appeal 1 to audiences of all ages and ethnic j origins. SHOP 9 w. Northompton St. lk p 18701 Wi es-Barre, a. · Boutique•Jewelry•Clothes r I\) NUMBER 9 l l l l L-------- 288-3751 1· ·Chuck Robbins... OFF ANY I PURCHASE WITH ·t THIS COUPON I See Joe, Bob, and Danny MON.-THURS. 11 A .M.-9 P.M. - TUES., WED., FRI. & SAT. 11 :00 A.M.-5 :30 P.M. 10% DISCQUNJ · I . I PU■LIC SQUARI OR Ml SPORTING .GOODS COMPANY We Accept Master Charge and Visa 39 West Market Street Wilkes-Barre, Pa. 19701 ' 11 Phone: 822-1333 Free Parking I at Sterling I • PATRICKHotel BURK!, 9~ne! _l _ I ' �Page 4, The Beacon, February 28, 1980 Romeo's Tune Student Government sponsored its first concert of the year and it went over with great success. The music and entertainment of Steve Forbert was greeted by a friendly crowd. It turned out to be one nice evening on campus. . Though a financial loss was incurred, this campus was m need of a concert and Steve Forbert turned out to be just the right thing. Concerts in the future will not be allowed to lose as much money, but SG took a gamble and it may have broken the ice. Future concerts of this type will be successful if the campus knows what to expect. We predict and hope that the possible concert in April will prove so. Good Luck SG and thanks for a change of pace, a nice concert and the nerve to take a risk. Campus Commentary The Visual Stimulant My heart rapidly pounded inside my chest ; my moist skin felt cold and clammy; and my sunken, vacant eyes appeared widely dialated. Twenty-four hours had passed away since I quit the 'junk,' but I had began to suffer painful withdrawal symptoms. A day later, my symptoms multiplied. My head ached from anxiety and I had trouble sleeping. l desparately craved for a 'fix,' 'shot,' or 'puff' of my lifelong addiction. I pleaded with my parents for a couple hours of happiness bu~ t~ey were deti!rmined to get me off the 'stuff' for good. I begged for an mJection of "One Life To Live," a single snort of "Different Strokes," or a solitary sniff of "Saturday Night Live." Equally habit-forming as heroin or morphine, my withdrawal was from the boob tube. Over a two week period, I quit watching television cold turkey. I reached a point in life where television became my Lord & Master. I found myself watching T. V. at any time of the day or night. I no longer selected programs but viewed anything on the screen. T_.Y . even began regulating my social life. I would make excuses to my fnends as to why I didn't want to go out; the real reason being that I wanted to watch T.V. I started watching popular shows, regardless of whether I enjoyed them or not so I wouldn't feel left out when they were discussed the next day. T.V. became more important than studying for tests, working my job, or doing my chores. I was helpless under its glowing, oppressive power. Once I turned it on it would remain ori until all the stations were off the air. Many times, I found it hard to stay in school, after a late night lineup of Kojak and Johnny Carson. Unfortunately, the intoxicated individuals .addicted to television far surpass the numbers dependent on chemical highs. Wilson Bryan Key, author of Subliminal Seduction and Media Sexploition, claims "it is estimated that an average North American child spends about 11,000 hours in classrooms through grammar, junior high, and senior high schools. During the same period, however, the child will receive ove_r 25 000 hours of 't...V. loaded with subliminal sell techniques." the add1ti~n of 'H.B.O.,' videotape machines, and cable television provide an unlimited capacity for increasing viewing hours. The lack of educational programs indicate that more people are turning on but not tuning in. Mr. Keys states that "North America is a visually oriented culture.'' Thus, T.V. has become the modem day, . miracle cure, aspir~n-like, panacea. It requires little more conscious thought than changmg the channels. Every show is our private "Love Boat" journey to "Fanta~y Island.'' For a culture that 'sees the news asit happens,' we are surprisingly ignorant of the outside world. . . Certainly, sueh docudramas as Roots and Holocau~t, enhghte~ed many to history's horrors. The medium has great potential for rea~h1~g and teaching millions of individuals. However, the real danger hes m what we pretend not to understand. Wilheim Reich <Listen ~ittle Man) asks if "You want to know, Little Man, how you are? You listen on the radio to the announcements of laxitives, dental creams and deodorants. But you fail to hear the music of propaganda. You fail ~o perce_ive the bottomless stupidity and the disgusting bad taste of thmgs which are designed to catch your ear. Have you ever paid close attention to the jokes which a master of ceremonies makes about your whole small miserable world? Listen to your laxatives' propaganda -and you learn who and how you are." Good night, Walter. · David Clanton 'Spoof'. Column Draws Attention From Kovacs To the Editor: The irresponsible joumalim in part of last week's Beacon is certainly an educational insight into the most widely read publication on campus. I refer specifically to the column "This Is No Spoof" appearing February 21, 1980 in The Beacon. Understandably the paper cannot assume responsibility for the individual writers. A student publication must be flexible to meet the changing needs of students. It is to their credit that The Beacon provides a separate forum for responsible commentary in the form of editorials. However, I question the journalistic value of one who abuses the responsibility of a supposedly informative column by expressing personal unqualified accusations. Purely incidentally, I take offense to the Great Spirit's accusation that "because other people are not working up to par that have to try to make her look bad ! ! !" While I speak only for myself, I could not consider this to be an example of responsible journalism. An information gossip column such as "This Is No Spoof" is undoubtedly an inappropriate place for un- found slurs. Just as I attest to this editorial by subscribing my name and addressing it to the editor, I equally expect everyone to present his or her opinion as just that, and not under the security of anonymity or under the pretense of providing only information. James E. Kovacs "Bangor" Editor's Note: The above letter's comments are directed towards the following paragraph that appeared in last week's "This Is No Spoof" column. "The Great Spirit thinks this petty letter writing that's going on is absolutely DUMB!!! Leave Colleen alone!!! She's doing a great job and just because other people are not working up to par they have to try to make her look bad!!! Well, this is a warning 7 there's no . way to make her look bad!!! CORRECTION The Beacon apologizes to the Assistant Food Service Director, Calman Baggs, for misspelling his name in last week's issue. NOTICE This is the last week to buy your WI.Iles Comfort T-Shirt. Only $5.00 while supplies last. Buy one today! NOTICE On Thursday, Feb. 14, the Cooperative Education Staff will be in the lobby of the New Men's Dorm from 11:00 to 1:00 to discuss Summer and Fall Job Placements with interested students. Ti.IE N[w ~R '':>::\ . .>:::· ARMY =- \JAN1S T6 JO\\'t \OU! _- ;·- ~ ~-- -~ I ·-)) / ,-------7 \..--(_J \ ...:..- Letter Policy Letters to the editor are welcomed from all interested parties. Let. ters MUST be typed neatly and submitted by . the Sunday before ,publication at one o'clock. A box has been placed in the library for this purpose. Letters may also be delivered to The Beacon . office, room Z7, Parrish Hall. All letters MUST be signed IN INK, but names will be withheld upon request. Editorial discretion will be used in all cases, especially where questionable language is used. All letters will be typed as written, without corrections ( except for the precttding case), and the views expressed in letters are NOT the views of The Beacon, USPS 832-c»l8 Editor-In-Chief Jim Edwards Sports t,;ditor Eddie White Ill Mauging F.ditor BillTurcan Copy Editor Patti Sparlow News Editor PeterSteve Op-Ed Editor Perry Lichtinger Asst. Op-Ed Editor Margaret Scholl . Asst. News Edi&Gr Louis Czachor Photographer Bob Gaetano B ■shiess Manager Sue Freda Advertising Man..:,.: er Vanessa Martz Circulalion l\lananger Michele Serafin . REPORTERS: Cindy Ercolani. Lisa Gurka, Mary Kutz. Sue Loveltt. Gary Mack. Bill Miller, Rich Nord~eim. Ana Nunez. Mary Kay Pogar, Darlene SChaffer. David Stahl. Advisor George Pawlush Parrish Hall II S. River St. NOTICE The Wilkes College Art Department is pleased to announce that • Mr. William Tersteeg, a noted area ceramic sculpturist, will be holding a one day workshop on Tuesday, Feb. 26th, 1980. This workshop is open to all inter,ested people. Wilkes-Barre. Pa. 1117M PIIIIUsW weekly during the school year from September i. May except f• vaeatiea periocts and semester breaks. Entered as second clan ,ostace paid ill Wilkes-Barre. Send form ne. 3579 to The Beacea, Willes College, Wilkes-Barre. Pa. 18711. Suncrlptlon rate to DOR-stlldents: U per year. Advertisillg rate: $%.50 per column lach. Pboae: (717) 82~--1'51, Ext. ~73 · AU views expressed are those of the individual writer and not necessarily ol the pnUcatien of the college. �. February 28, 1980, The Beacon, Page 5 . Review•································•·························· r► Steve Forbert Concert "I thought it was excellent," "Great," "Super," "Fantastic." "They were much better than I expected." These replies came from students who attended the Steve Forbert concert this past Sunday in the Wilkes Gym. The concert started on a strong 'note' when the crowd chanted for an encore of the warm-up group. While many warm-up groups are rejected and pushed off the stage, this duet was called back. Although they didn't return, the crowd still applauded. The highlighted musician "Ricky" got special attention after his solo with his electric violin. Then Steve Forbert and company invaded the stage and a warm reception was given by the crowd which whistled, applauded and even howled. Forbert with his 'boyish' face, not only...has an excellent voice, but also a good show. Many people I spoke to felt the acoustics part of the show w.as the best, but this writer thinks the show was better when all the musicians were playing. In his acoustic solos, Forbert played several selections with harmonica, guitar and both, but didn't use the electrics. When the other members came back on stage, the show went on. The set had someone for everyone, so to speak. On the guitar, a long-haired -guy about 17 years old; on the table base, a monster mash type fellow; on piano, organ and accordian, an Italian from the Bronx ; on drums. ~· -► . . -~aggie Says- ~► "] What,s Happening ::::::,e»-c:==----==::::::,-c1►ic:::=~-11ot-c:==--:•-:==-ut-ic:::=::)C-X:::=::::::,nc:::tl his famous "Romeo's Tune," but it seemed like the audience was intrigued more by other selections he played. On the whole, the night went very The awards presentation for the Regional Scholastic Art Awards Exhibition will be held Saturday, March 1 in the Schaeffer Lecture Hall. The works will be on display through March 9th in the Sordoni Gallery. Hidy Ochiai will give a demonstration on March 12th i~ the Center f_or _the Performing Arts at 7:00 p.m. He is one of the best martial arts spec1ahsts in the world. The Rod Rodgers Dance Company will appear on campus under the auspices of the Concert and L~cture Series March 18th.The presentation wilfbegin at 8:00 p.m. , ROMEO'S TUNE - Steve Forbert performed to a crowd of over 1000 Sunday in the gym. Five hundred Wilkes students were in attendance. an older musician with grey hair and a moustache; and of course, "Mr. Everything" singing, playing harmonica and guitar. By the way, where did that saxaphone come from? The 24-year-old is well-known for ~ Christine Donahue will give a voice recital March 15th in the Dorothy Dickson Darte Center for the Performing Arts. She is a 1974 graduate of Wilkes and will be appearing under the auspices of the Concert and Lecture ~ Se,ies. . ________ _ The ticket price is $9.50 which includes bus fare to and from New York. ~ 1st. The day is to do whatever you want to do in the city. Tickets are on sale in Commuter Council will sponsor a bus trip to New York, Saturday, March well and many commented it was the "best time" they ever had while btudent Center. MIC Mk HM "-,at Wilkes. It was the first concert in our gym in a long time and securiNOTICE ty, tickets sales and hospitality was This is the last week to buy your well prepared. Wilkes Comfort T-Shirt. Only $4.00 Bob Gaetano while supplies last. Buy one today ! . . R evrew ---------- .----------------------------------- - _---------- 'Waiting For Godot, Termed Excellent . ►M M Lyr i ~ sOpraDO To perform Voice Recital ~ Most students have read "Waiting for Godot" at least once in their college careers. Those who missed the recent weekend performances, also missed an excellently staged, very funny · and moving presentation. / Paul Kerrigan and Chris Lonstrup turned in fantastic performances as Vladimir and Estragon, · respectively. Kerrigan having much success in past roles in the college, certainly came out with another winning character. He was entertaining and gave true life to the character. Lonstrup equalled Kerrigan's performance in perfection. He became funnier and more entertaining as the performance progressed. Most of the play is ,centered around Kerrigan and Lonstrup who keep the play rolling at a smooth Larry_ Barrett, performing as Posso, came out shining with his portrayal bringing many uncontrollable laughs long to be remembered. John Chervak won a great deal of approval with his acting and his hysterical monologue which was done to perfection. · The set and lighting by Klaus Holm were magnificently done. A bare stage was transformed into a very realisitc and distinctive road side setting. The work put into the production by Dr. Leonard Powlick was extremely evident in the distinct flow and a technically great performance. Not to be overlooked is the great Christine Donahue job done by Michael Flamini with AAAAAHHHHH! ! ! _ Paul Kerrigan and Chris costumes. The Theatre Department L . C has once again triumphed with a ync soprano hristine Donahue Lonstrup- are still "Waiting- for Godot." will appear on the Wilkes campus superb performance by all. h I under the Concert and Lecture _r_a_te_t_h_ro_u_gh_ou_t_t_he_e_v_e_n_in_g_.- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -·______M_a_rg_a_r_e_t~_c_o__i_ - series March 15 at 8:00 p.m. in U1e Center for the Performing Arts. Donahue graduatea from Wilkes in 1974 with a Bachelor of Science 00 NOT degree in Music Education and 'fOU<.tt .'t\t£ went on to Julliard where she SL.ttl.f'fuK£s studied for three years receiving a Jo( Master of Music degree in Voice and Opera. Donahue is currently a student of Elena Nikolaidi in Houston, Texas. - · Donahue's various awards include the Berlin Arts Fellowship and a second place in the Metropolitan Opera National Council Regional Audition Finals. Some of the songs that ·Donahue has chosen for her recital are by Giuseppe Verdi, Alban Berg, Sergei Rachmaninoff and a selection of "Songs of the Auverne" arranged by Joseph Canteloupe. �PIii 6.. ne a.u-. f'ebrwary 28, 1981 . Dr. Richard Aston D.e dicated To Enginee~ing; Chooses Teaching Over Aerospace Research I As I sat conversing with Dr. making, looking te .selve specific tions. Those who wish to enter the Richard Aston, assorjate professer problems. Thus, today's technology job market have little problem." of Engineering, the nervousness I is very closely related to the evoluAston notes, "There has been a had started out with quickly disap- tion of man himself. great demand for Wilkes engineerpeared. At first, I mistook him and As a people, he feeis we are faced ing students. Alumni know the prohis soft spoken tone of voice to be with the very serious problem of gram is good and readily recomthat of an introverted scientist controlling the technology we mend our students to others." obsessed by oscillating currents of possess. We have learned how to Dr. Aston finished by saying, "I · electricity with no interest in control vast amounts of energy, and have a feeling of belonging here, anything outside his sterile, dial- the problem is how to intelligently my allegiance is strong. The atfilled laboratory. Soon, I learned apply this knowledge. The major mosphere here is excellent ' how wrong I was. stumbling block of doing this is that because, it is a very personable What I had mistaken for introver- there ls almost no way of predicting school. There is a very close insion was actually the quiet content- what effects our innovations will teraction with students and ment of a good natural man whose have. Two perfect examples of thii; teachers." long list of accomplishments stands are the automobile and the televiPerry Lichtinger out even more so considering his sion. young age of forty-three. No one could have possibly In 1959, Dr. Aston received an predicted the social implications Engineerng certificate from Wilkes these products have had on our NOTICE College before moving oil to Penn society. There will be a brief meeting for State where he earned a B.S. in '61 One of the major problems we all student interested in working and a M.S. in '64, both degrees com- have as Dr. Aston sees it is that Dr. Richard Aston backstage on the theater's producing in the field of EJtectrical many important decisions concerntion of "Angel Street" Thursday at Engineering. By 1969, Dr. Aston has ing the use of technology are 6:30 in the chorus room of the CPA. received his Doctorate in Electrical political and not always in the best eternal." graduating from Wilkes in Those who are intersted but unable Engineering from Ohio State interest of society. This is one Although Dr. Aston's teaching Engineering, and who go on to to attend should contact Jay D. University. _ reason why alot of top positions in and research take up the majority graduate school have done better Siegfried at extension 392. Before returning to Wilkes in his corporate management are now be- of his time, he does find time to than students from other institucurrent position, Dr. Aston spent ing filled by engineers who are in a relax by either spending time with ~veral years teaching at other in- better position to grasp the implicahis wife and three children or, stitutions of higher learning. His tions of our technical advances. singing in his church's choir. He first assignment was at Bucknell Dr. Aston strongly believes the also has developed quit~ a talent for University where he served as an study of history is important. It is writing poetry. A few of his pieces engineering instructor. Later, he important in that it helps increase have even been published. moved on to the Rochester Institute our understanding of what has hapOne of his favorites is titled, (800) 452-1589 X-2 (Pa. only > Phone Toll-Free (800) 523-11974 X-2 of Technology and spent two years pened in the past so, that we can im"Intelligence In Outer Space" and as an assistant professor. prove our judgement in the future. deals with man's efforts to contact and talk to forn,er (Md., W. Va., Delaware. Kentucky only> Concurrently with his other posi- . As part of the Freshman Studies other life forms. His poem comes to tions, Dr. Aston studied part-time program, Dr. Aston taught about the conclusion that if life does exist ; volunteers about It's a number that could .at the National Technical Institute the history of tools by focusing on in outer space they will probably change your life . for the Deaf where he was involved the evolution _of technology. This find us first, if they haven't Peace Corps in the special education for deaf semester, he is emphasizing the already. people. purest form of education wh!ch is Another shorter poem written by and VISTA During the years between 1972-78, the seeking of truth despite the conDr. Aston is titled, Dr. Aston worked full-time con- sequences. We must come to realize ducting independent research and that everything we do is .going to development in the Aerospace In- · have consequences beyond the ac"By the River." dustry specializing in active tual product. By understanding Peace Corps and VISTA will be standing by waiting for microwave systems. this, our perspective ·is broadened your call about what's happening now . At General Dynamics Dr. Aston hopefully improving our decisions. By the river there stands a willow researched microwave systems for Ik. Aston's philosophies are that I had meant to down Peace Corps volunteers serve 2 years in a developing nathree years. Then, for another two strongly influenced by his religious tion of Africa, Asia, Latin America, or the P acific . They until I thought about its roots help people of emerging nations meet their basic human and a half, he worked on an beliefs. "Religion has always been deep within the ground. needs. amplHier for his microwave important to me," but he admits, system. While at General "I'm not altogether orthodox in my The claim the willow had to be, To qualify, volunteers must be U.S. Citizens, motivated Dynamics, many of his reports and beliefs either.'' the claim the willow had on me, to serve, and have a usuable skill. Students with memos were published. In May of His concept of religion is one of a backgrounds in Education, Math-Science, Health fields, • the claim it had upon that spot, Business and Economics are especially needed . 1977, Dr. Aston was at,ked to speak more cultural and pract.ical nature. standing there in earth and rock, at the United States Pentagon on Socially, l~arning to live together in giving shelter to the flock Benefits Include paid living, travel. and health expenses the topic of "Active Solid State peace is one of the most important every spring and fall, plus a $3,000 readjustment allowance after completion of Transmitter Research." The list lessons to be learned. A society that gave a meaning to the fall: 2 years service. can not exist in peace will soon goes on. VISTA (Volunteers In Service To America ) volunteers Recently; he has been perfecting become extinct. Heaven's for those who would be serve 1 year in poverty-related programs in the United a ·biomedical project that enables "The statements of wisdom passfree States, and Its territories. They wor k in Health, Housing, deaf people to use tactile sensation ed down through the ages by free as a soaring Bach, Consumer Affairs, Business Development and other as an aid in speech therapy. The in- religion can not be proved except in broken out of earth and rock. areas. Their main thrust is to identify community an strument produces vibrations in a a historical perspective." Dr. Aston' neighborhood leaders and help orga)lize key board that corresponds to a continues, "The commandment, coalitions to combat problems in low-income areas. that hold predetermined code. 'Thou shall not steal' can not be pro- . In 1978, Dr. Aston was awarded ven to be the best way to live but, ' "I've always wanted to become a Americans down. United States Patent number 4,121- history has shown that people who teacher," Dr. Aston stated. "The 174 for an instrument h~developed . stealfail." student-teacher relationship is an VISTA volunteers ·,n ust have a unachieveable goal, an ideal, and a called an "Adjustable Microwave He adds, "The wisdom passed usua ble skill . Stu<Jents with Power Combiner for Plurality of down to us is thousands of years old model for all relationships." He backgrounds in social services, social work and legal training Coaxial Circuits." If you want to and has survived the test of time. adds, "The lesson it teaches is that areespedally needed . know what that does you'll have to · Because they have been accepted it is possible to learn something by so many people, they carry from everybody, from the people ask him yourself! By phoning toll free (800) 462-1589 X-2 (Pa. only >and (800) 523-0974 X-2 Besides being involved in the acauthority." we relate to." (Md., W. Va .. Delaware, Kentucky only), tual construction of electrical inPeople have said that technology "Engineering has been apart of yoa can learn more about Peace Corps struments, Dr. Aston is very much Wilkes since its inception. The has brought on an epidemic of and VISTA department · here compares concerned with the place "Future Shock" caused by the ever technology plays in our society. increasing rate of change, but, Dr. favorably with any I've been to," According to him, the evolution of Aston counters by saying, "When Aston comm_ents and adds, -"The technology can be thought of as one · we leave our traditions, when we laboratory involvement is very end product of man's physical and break from our roots it is easy to be good, and the emphasis on the mental development. As man's dex- overcome by feelings of loneliness liberal arts provides a good balance terity improved, he concentrated and alienation. People tend to for the students." more on his energy towards tool forget that religious beliefs are He continues, "Students I REACH OUT ra �Fe....-y !&, fll8e, The Beacen, Pa,e 7 Circle K To Hold 28 Hr. Dance Marathon To Benefit Juvenile Diabetes Foundation ,.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .1 ~ ~ ~ ;11111 ~ II"'! ~ ~ ~ I I CIRCLE K DIVISIONAL DANCE ,,tARATHON NORTHEAST DIVISION: FOR JUVENILE DIABETES FOU NDATION The Divisional Circle K Dance Marathon is a 28 hour marathon to raise funds for the disease of Juvenile Diabetes. The Circle K Clubs in the Northeast Division are seeking sponsors for this project. You can sponosr a dancing couple for $.25 an hour or simply donate an outright amount of money for the cause. (name, organization or bi::~1!::s~ate tosponsor _ _ ' ~ ' (per hour or donation ) _ __ _ _ and _ _ _ _ __ _ (couple's names) to dance for ~ ;11111 ~ II"'! ~ ~ ~ ~ I II All ~ in the Circle K Dance Mara th: :or Juvenile Diabetes. r, I l ........................................................................................................................-4 repare For April Exams! The Wilkes College Circle K Club, in conjunction with Circle K clubs throughout Pennsylvania, will be sponsoring a dance marathon for the benefit of the Juvenile Diabetes Foundation. The marathon will take place at the 109th Armory in Nanticoke. Dancing will begin on Friday night, March 7, at 10:00 p.m. and will continue until Sunday, March 9, at 2:00 a.m., a total of 28 hours. The Circle K needs· as many dancers as possible. It is not too late to dance, since you can sign up at the door. They also need sponsors who can give an outright contribution or sponsor a couple per hour. Circle K requests that all clubs and organizations on campus get involved in this worthwhile endeavor by either dancing or sponsoring someone else. Prizes, including a stereo system, will be awarded to the winning couples. - Music will be provided throughout the marathon by live bands, with disc jockeys entertaining between bands, Circle K will supply food and medical aid for the , dancers. Annette Jacek is the general chairman of the marathon. She reminds all students to show their support in helping to find a cure for diabetes. Anyone interested in obtaining more information about sponsoring a couple or dancing in the marathon is urged to contact Annette or any member of the Circle K Club. Hip-Pocket Scholarship Offered By AFROTC Air Force ROTC is offering a Committed · Program or " HipPocket" Scholarship to Wilkes students who meet certain qualifications. Students who qualify are assured of a two year scholarship which includes: full tuition, fees, books and a $100 monthly allowance. Capt. Kenneth Johnson states, "Students who are majoring in engineering, physics, chemistry, computer science or math are eligible if they have at least a 2.5 cumulative grade point average. The student has no.obligation to accept the scholarship until his junior year." Those who accept the scholarship are obligated .to enroll in a two year ROTC college program, which means taking ROTC classes along with the regular studies. Obligations also include four years of service in the Air Force after graduation, as well as summer camp training for six · weeks. After successful completion of the program, students will be commissioned as a second lieutenant in the Air Force. Capt. Johnson adds, "There may be a chance to apply for a master's degree, especially in engineering.'' Freshman Scot T. Lefebre has recently been named to receive one of these "Hip-Pocket" scholarships. Lefebre is an engineerng major from West Islip, N.Y. He has Groh's Assistant - - - - - - - - - - - Bruce Phair Fills Position As New Technical Director LSAT • MCAT • GRE GRE PSYCH • GAE BIO GMAT •DAT• OCAT • PCAT VAT • MAT • SAT NAT'L MED BOS ECFMG • FLEX • VQE NOB • NPB I • NLE ~-+l lUIPIAN EDUCATIONAL CENTER le~t Prt.'p.irat,on Spcr, .11,~,~ Since 1938 Please Call Collect for Information . ( 215) 435-2171 Masonic Temple Bldg. 1524 Linden St. Allentown, Pa. 18102 Classes Formin Now! It was announced earlier this week that Bruce Phair, a 1973 Wilkes graduate, will fill the recently formed position of Technical Director for the Dorothy Dickson Darte Center for the Performing Arts. He was chosen out of 9 applicants for the job, which was advertised locally and in New York. Phair's main task will be to assist Al Groh, Cultural Activities Coordinator, in the overall functioning of the C.P .A. According to Dr. Thomas Kelly, Dean of External Affairs, some of the former music major's other responsibilities will include stage preparation, coordination of student production crews, and the operation of the film projector for movie presentations. Conducting most of his work in the evenings and on weekends, the " in house manager" will also attempt to establish a more effective security system for the building, added Kelly. He went on that a better check-in system of countability · and more control of issued keys to the facility are two plans which are presently being discussed. In charge of all non-theater department productions, Phair has been involved with on and off-stage theatrecial activities both. During his stay at Wilkes, he performed in such plays as "Cat on a Hot Tin Roof" and "Cuckoo's Nest," while also contributing to such musicals as ' 1Godspell" and "Trial by Jury." Phair's backstage involvement at the school included set construction, publicity, box office, lights and make-up. The new Technical Director has participated in community theater work such as the Little Theatre, Wilkes-Barre, the Showcase Theatre, Wilkes-Barre and the Regional Theatre of Nanticoke. He has appeared in various plays and musicals during this time such as "The Feast,""Thieves, '"'Rainmaker,""See Saw," and "Kiss Me Kate." Phair has also participated in the Fine Arts Fiesta and the Cherry Blossom Festival and was judge for the . 1977 and 1978 Pennsylvania Speech League Eastern Regional Drama Festival. He is a patron member of the Little Theatre where he chairs the Remodeling and Repair Committee, and is a member of the Play Reading Committee as well. Viewing the C.P .A. as an asset to the college and the community, Dr. Kelly stated that Phair will be working with outside groups who want to use the building, and it is hoped that the technical director's position will ultimately increase the use of the facility. Peter Steve met all qualifications and will be required to take aerospace studies along with his normal engineering curiculum. Capt. Johnson states, "Second semester sophomores should be advised that they must apply for the scholarship before April 30th of this year in order to be eligible for the Fall seme--ster." Anyone requiring more information can contact Capt. Kenneth Johnson at ext. 371 or make a visit to the ROTC offices in Kocyan Hall. Bill Turcan Big Brotlaers Sisters Club Formed Here Be Someone! Get Yourself Involved! Costs nothing but your time. Brothers, Sisters and Friends is a new club forming at Wilkes in conjunction with the Big Brothers of America program. Club members will be involved in recruiting Brothers and Sisters, fund raising events, and get togethers with other Big and Little Brothers and Sisters in the Wyoming Valley. All are encouraged to join now. Being a Big Brother-Sister is not a requirement to being a member of the club. Meetings will be held twice a month, usually Sunday nights. Again, all are encouraged to attend our meetings. If interested, contact Tim Ryan, Slocum 300, for applications. Let's make it our turn to help someone. NOTICE The Census Bureau will conduct its national census of population and housing in the spring of 1980. All colleges will be cooperating with the census bureau. and Wilkes will provide, when asked, the name and address of students who are enrolled. Because of the Family Educational Rights and Privacy Act (FERPA) -which governs educational records, the college is hereby notifying all students that the aforementioned data will be provided unless particular instructions to the contrary are forwarded to the Dean's Office prior to March 1. NOTICE The Wilkes College Psychology Club is finalizing its plans for this years Eastern Phychological Convention, being held in Hartford, Ct. Dates for the trip are April 10-12. Anyone interested in joining the club on the trip can sign the sheet in the club roon, SLC 333, or attend the meetings in the same room Thursday at 12:00. Deadline for reservations is March 13. If you would like any further information you can call Cissy Riley at 824-4818. �. / Page 8, The Beacon, February 28, 1980 J □91 . §1 ·, ! L ~ _ ~~J21]==- -·• 16~:: ._•.~ .• ~ , mGJ~□~ ~leW~IE'-~~~00.~E Jh;jkhl_J1full · -iitthe third and final part of the ' Space Utilization and Planning Aid entitled Appendix, various clarification materials such as charts, graphs and surveys are presented. · Under user ~eeds, the first topic of discussion, it is stated how a campus survey helped in the final preparation of the study.. Out of the survey group which consisted mainly of students, 69 percent commuter and 31 percent resident, Stark Hall is listed as the most frequented building on campus, with the Dining Commons, Parrish Hall, Darte Hall, Pickering Dining Hall and Farley Library following. With 55 percent of the students surveyed naming the car as the best means of transportation, many commuters stressed the need for added parking facilities. Other desired facilities included outdoor athletic space, indoor recreation, indoor athletic space, outdoor recreational space, and privatepersonal space. · "The most important data recorded by the needs surveys documented user patterns - particularly pedestrian paths, frequented buildings; and core open space." The summary of this section confirms that "maintenance and environmental controls . . . remain the significant user needs not presently met" by the college. In the second topic of discussion, concerning commitments of space, Wilkes is compared to other Pennsylvania colleges, which were selected on criteria such as the type of Institution, environment, degree offering and size. This section states that if the 79,588 gross feet of unused basement and restricted space is deleted from the measurement, then Wilkes utilization rate would be 63.9 percent, considerably in line with the state average of 69 I ~_&.-_-...~...... percent. Because there are 2.26 commuter students for every dorm student on campus, when compared to other schools, Wilkes is referred to as a 'commuter school.' Even with this title, "Wilkes did not commit as high a proportion of space for instructional purposes as other commuter schools, and does not commit a commemsurate proportion to Student Services." The report · also points out that residential uses occupy the least space while laboratory uses have the highest prooportion of utilization. A summary of the space commitment section makes five important statements including a low overall utilization factor, a minimal availability of dormitory space· , more general classroom area needed, and an apparent lack .of students service buildings such as athletic facitlities and recreatiollal areas. The developing norms section .of the Appendix several assumptions were made by the planners during the course of their work. Some of their assumptions a~ut the school include: there are too many buildings to account of, parking remains a significant problem, the college faces uncertain enrollments, computerization .pf bUUding-us~ data is possible and desirable, and dormitory beds have increased substantially while enrollments stabilized. The fourth and final division of the Appendix deals with_the college setting its own patterns or trends. Taking into account rooom by room space inventory, station by room inventory, student hours per week, departmental requirements for labs, and other scheduling data, the school has a 51 percent utilization for class rooms and a 34.1 percent utilization for labs, both of wbieh Comparison: Statewide Private Colleges (Residential Not Included) Net Assigned Area Per Full Time Equivalent Pa. Private Colleges Use Overall Space Excluding 190.7 Residential Total 53.2 Instructional Total Non137.5 Instructional 20.2 Classrooms -19.0 Labs Faculty Space differ from the 80 percent class room and 60 percent lab average projected by the Pennsylvania Department of Education. Discussing the recovery of in. structional space, the college could recover that if a goal of 67 percent utilization is used, the college could recover 23,998 sq. ft. of unused space. The study goes on to say that it 8 a.m. and 4 p.m. classes were scheduled regularly, roughly 9,200 net assigned square feet could be obtained for added use .. Reviewing the use· of the oflice space on campus, the planning aid mentions that although office space utilization is not a major problem, opportunities do exist for the reassignment of large offices· to smaller rooms. It added that there is a general need to reduce the overall buildi~ stock, and that in two· instances, the Library and Weckesser Annex, use patterns result in crowded offices. The report found the athletic facilities on campus to be minimal. With an 11,000 net assigned square feet required for physical education, the school's present facility measuring 13,580 appears to be adequate. But · because of intercollegiate athletic programs which place an added strain on the facility's space, the study shows that more space is needed, with the present gym being used at a rate of 17 hours a day, 7 days a week. Another interesting point this section of the Appendix dealt with is· the amount of lounge space on campus. The subdivision listed some ninety-eight\ distributed ' among thirty-three campus buildings, with their use described as informal and non-scheduled. The section stressed that there is no difference noticeable among commuter and residential institutions, "Wilkes . maintains as much as twice the 177.6 Room Size (in sq. ft.) less than 180.0 81.7 , 98.3 . 16.8 135-200 200-270 One Two Not Suitable Any room +Should have a maximum occupancy of two faculty. 270 Buildings with "unsuitable" office use characteristics' 004 Guidance 078 Butler 058 Franklin Hall 030 Weckesser Annex 059 Music 054 Library ,ends with a conclusion titled using norms. The main detail brought out in this conclusion is that with the use of such a study, "efficient. and workable arrangements of space can be planned with a greater degree of predictable success long Dionne Warwick says: "Get your blood into circulation:' appointment. + --- - - - - - - - -- - ' PREGNAN T? NEED HE LP? 198.0 Confidential Counseling Pregnancy Testing Library 22.6 S_pace 17.3 The statewide figures in this chart are averages, covering_various types of private colleges and can be interpreted only as 'guidelines' and not 'norms' in themselves. FTE equals "full-tim~ equivalent." :;:;- J more than 42.1 (156 Faculty) Faculty Desirable Occupancy Not Suitable f°" a blood donor Wilkes College (2362 FTE) before costly and haphazard change is implemented. Stressing that the plan must be approved and-or is • subject to change by the Board of Trustees, Dr. Andrew Shaw, Director of the 135 Call Red Cross now· (PerFTE faculty lounge area actually needed." After briefly summarizing some points discussed earlier in the study concerning storage facilities, dormitories and apartments, and health care facilities, the Appendix Allentown Women's Center I ( 215) 264-5657 Institute of Regional Affairs,. expressed extreme confidence that the · Space Utilization Study and Planning Aid will assist the college in the redevelopment of the campus. Peter Steve �February ZS, 1980, T~e Beacon, Page 9 ~GrapplerslnEasterns This Weekend The 1979-80 Wilkes College wrestling team set a new school record of 18 dual meet victories in a row with a 24-19 decision over Old Dominion University, 23-16 triumph over Virginia Tech and forfeit over University of Richmond Saturday in a quadrangular meet at Blacksburg, Va. With Rick Smith and Bob Matzelle on the injured list. Coach John Reese was forced to do some juggling and put Pete Creamer in at 177, who won a bout and dropped one. Bart Cook then wrestled up at 190 and unlimited and answered with two triumphs. Cook was bumped up to heavyweight and won the Iflatch for the Blue and Gold as the score was tied 19-19 after 190. Cook also defeated highly-touted Mark Miller of VT in the 190 pound fray. Colonels stellar 13~ pounder Bryan Billig met stiff competition in ODU's outstanding Souther champ Buddy Lee. Bryan was the victim of the opening takedown ·but fought back to take 3-2 elad after two periods. Lee escaped and registered a takedown in the last period to clinch the 5-3 decision. Billig copped a 2-0 decision on a near-fall against his Virginia opponent and won on forfeit to finish the year with an 18-3 slate, tying the school record for most dual wins in a season. Double-winners for the Colonels included Lenny Nelson, Mark Densberger, and Bart Cook. Nelson copped two falls in the quad, showing ODU's Bob Rome the lights in 3:55 and decking VT'S T. Chamberlain in less than a minute. Densberger fashioned a fall against -his ODU opponent and a superior decision against Tech. Cook· collected a 9-7 decision over highlytouted Mark Miller, Tech and a superior over Mark Caider of Old Dominion. Hopefully the long and suffessful dual meet sea~n will help our Colonels in this week's "Big Event". The quadrangular meet was an excellent preparation since the rnatmen were able to wrestle two bouts in one day. In the Eastern's, the grapplers are expected to wrestie two or three matches in one day. Wilkes will be out to retain its own top-place finish in the 76th annual Eastern Collegiate Wrestling Association (EIWA) tournament which unfolds Friday and coneludes Saturday_evening at Lehigh University's Stabler Athletic Complex. Last year the Colonels surprised many of their EIWA opponents and copped second place laurels behind champion Lehigh University. The Engineers amassed ll8 points while the locals scored 104 tallies and crowned two champions. In the third place slot with 91 points was Navy which was followed by Ternpie and Yale University respectively. .,,, One champion, unlimited wrestler Danny House graduated while 158 lb. Mark Densberger is back to defend his title. Densberger will get stiff competition from Reilly, Lehigh; Washington, Yale; and DeGenova, Temple. The Yale grapplewr_w 1kas un1d34efeateddat pnrtess tBime. 1 es -poun e ry ryan Billig garnered runner-up in the 136 lb. bracket last winter and will tangle with NCAA Champion Darryl Burley, Lehigh and EIWA champ Br;_ :m "Nip" Brown this year. There are rumors that Burley may shift to the·142 pound class to .avade All-American Randy Lewis, Iowa. However, why should one great wrestler with a lot of class like Darryl Burley move away from "Mr. Everything" Randy Lewis? He's beatable! They should both be in the NCAA finals at 134. If Burley goes 142 it's all his and Billig should claim the 134 pound title. Doug Parise, Temple will be the one to beat with Gene Nighman, Cornell; Dave MacDonald, Army; Bill Sweezy, William & Mary ; Dennis Reed, Lehigh and Lenny Nelson, Wilkes topnotch contenders. The 150 pound class is " wide open" . Tom Bold, Lehigh, Mark Troutman, Wilkes, Frank Schaeffer, Navy, and Colin Grissom, Yale will "draw straws." Returning champ Jim Vargo, East Stroudsburg will be string at 167 with John Reich, Navy; Mantella, Temple; Colin Steel, William & Mary. Colin Kilrain, Lehigh gets the nod at 177 with Bart Cook, Wilkes, Gregg Fronczak, Wm . & Mary and Mantella, Temple if he stays at 177 adding competition. The 190 category is "stacked" to say the least. Returning champ Mike Brown;Lehigh leads the field with two-time Southeast Conference champ Gaffney, Temple, Rosa, Syracuse, Blackman, Franklin & Marshall, Boyle, Yale and Colonels' Rick Smith battling to reach the finals. Drew l{eiser, Lehigh and Jay Craddock, Columbia are big heavyweights and will receive stiff tests from Bob Matzelle, Wilkes and Matt Lauck, Temple. The lightweights will be led by 118 pound freshman Rich Santoro, Lehigh and 126 pound competition !** ** *** ** !* ** ** ** !* ** *** ! ** *** ** * !* ** will be a "toss-up". Also in contention at 118 is Ray Broughman, Wm & Mary; Princeton's Bill Hawley and Dale Mill, Syracuse. Yale's Andy Velez and Army's Palzer are also tough. . Steve Bastianelli may compete at 126 or Pete Schuyler representing the EIWA's with his 6-6 slate. Freshman phenomena Mark Popple, Wilkes-Barre and sophomore Billy Dodge, Arlington, Va. handled the 126 pound class. Popple saw most of the action until he suffered an unfortunate neck injury in the Penn State match. The yearling Billig. Mark leaves Colonel land with his name etched in the record book for winning 18 duals in one season. While at Wilkes he collected victories against losses in dual meets. Dan Miner, a junior from Chambersburg bolsters a 9-6-2 slate ·pr• •·- .. . **********~*******BART COOK******************* Lehigh. Both are tough wrestlers but have to beat Mark Iacovelli, Syracuse, Steve Cifonelli, Temple, Kirk Dabney, princeton and John Mousetis of Franklin and Marshall. Billy Dodge, Wilkes or Jim Pagano, William & Mary could pull upsets. A complete season wrap-up follows : At 118, varsity duties were shared between junior Eddie Johnson, Chelmsford, Mass. and freshman Kris Rowlette, Nashua, New Hampshire. Johnson registered a 4-3-1 record before his leg injury, while Rowlette will represent Wilkes in ** *** ** *** ** ** *** ** ** *** ** ** *** *** * : ** ** ** compiled an 8-3-1 dual record against formidable opponents and will be a top contender next year as he was no doubt one of .the top freshmen in the country. Dodge, who capitalizes on physical strength registered a 7-3 slate and will down the varsity stripes in the tournament this weekend. Bryan Billig enjoyed a fine dual meet season and should be considered a top-notch competitor for All-American honors. The junior from New Tripoli shows an 18-3 log, including lO wins and leads the squad In team points with 93. Billig tied the school record for the most dual victories in a dual season and also tied the record for most pins. The win record is shared with teammate Densberger, while the pin mark was set by Al Zellner. Sophomore transfer Steve DeGiso, Brockton, MA. owned the 142 slot during the early part of the season and yearling Lenny Nelson, Richland, N.J. stepped in after six duals. DeGiso finished at the 4-3 mark while the rookie posted a record of 8-2-3. Nelson will represent the Blue and Gold in the Eastern tournament. An!)ther outstanding freshman, Mark Troutman, Toms River, N.J. wrestled to a well-respected record this season and will compete in the 150 category at Lehigh. Trout wresUed last weekend, despite being ill and saw his dual slate fall to 12-f Prior to the quadrangular meet, Trout had won -seven matches in a row. Sophomore George Cherrie, Fleetwood, saw limited action at 150 and 158 and garnered two wins. Senior CO-!!aptain Mark Densberger, Danville will try to win his second EIWA title in the 158 spot. Mark has been bothered by an knee injury all season, but appeared in top form last weekend and will take a 13-3 slate into the contest. Mark fashioned six falls to rank second on the team, behind and will vie for a top place-finish this annum at Eastern's. Dan was the only unbeaten after the first five meets and has a lot of talent. Also fllling in at 167 was first-year grappler Rich Sampson, Westfield, N.J. who won three and lost one in varsity competition. Another frosh, Pete Creamer, Bellmore, N.Y. wrestled at 167 and 177, for the Reesemen and boasts a fine 6-4 slate against tough adversaries. Senior co-captain Bart Cook, Neptune, N.J. placed third in the Eastern's twice and is expected to reach the finals this winter. Bart will probably get the number 2 seed on the basis of his previous success and 13-2 mark. Cook nailed down 64 team points this past season, including five falls. The 190 slot was suppoorted by Junior Rich Smith, Walden, Vt. who registered a 13-3-2 record. Smith gained three pins and compiled 68 tallies for the Wilkesmen. Big Bob Matzelle, . Lindenhurst, N.Y. has placed third and fourth in the EIWA's and could better those positions this weekend. Bob produced a 12-3 mark, with two pins and 46 team points. MAT MATTER: It was the last dual meet ·in a collegiate uniform for seniors Mark Densberger, Joe Gray, from Allentown, Bart Cook, and Rick Smith ... Like it was written in the pre-season, Wilkes had a tough schedule, but tougher wrestlers pulled it out for our Col. onels ... The Colonels .won several close matches only 'because our n,atmen didn't give up!!! Many noted Wilkes grapplers winning in the l!lst few seconds and being lucky!! But it wasn't luck because it happened more than once ..-. If the team personnel carry their spirit into next season, Colonel opponents better beware ... EIWA adversaries better not count Wilkes out in the tourney because they have the "WILL TO WIN"! Bob Gaetano �-----Men's Cagers End At 10-13, Coaches Get Two of Three Goals · : by Eddie White Ill Page 10, The Beacon, February 28, 1980 1 BETWEEN THE WH ELIN The Wilkes College Men's Basketball season is over. The Colonels ended the 1979-80 campaign with a 10-13, 10-12, 10-12-1 or whatever record. Really, the Blue and Gold finished the year at 10-13, bufthe team itself and coaches Ron Righter and Steve Justice feel the Scranton-Wilkes ' brawl game should not count - therefore the record would be 10-12. Either way, the C~lonels finished just below .500, which isn't bad considering we won nine games last year and five the previous season. What was a "downer" for Wilkes was ending the Middle Atlantic Conference season with a 6-7 slate (good for third place behind Scranton and King's) after starting 3-0 in the MAC. • Before the season started, Righter and Justice had three goals - win ten games, beat King's, and get into the MAC playoffs. Well, as the song goes, "two out of three ain't bad." They won ten games, but could have won a few more, did beat King's in two super games, and blew their chance at the playoffs. Anyway, a report on ,ast week's final game of the year: Division II Bloomsburg State College traveled to Wilkes for the final game. The Colonels played well in the early going - holding a seven-point lead midway through the period, but as has been the case in Colonel games lately - the Blue and Gold folded, eventually getting hammered 7!J-67. Tony Madden, the team's MVP, led the Blue and Gold in the final.game with 17 points and ten rebounds. Aiding the Colonel attack was Women Still Playing It's been a season of firsts for the that Kings, who finished 3rd, is trywomen's basketball team of First ing to lay claim to the title also.'Acyear coach Nancy Roberts. This cording to a working agreement by the NWPIAA Schools, the first year's team was the first Wilkes women's team to win more than 12 game played between two member games, they won 16, the first one to schools counts in the final standings. The Kings girls lost in its make the playoffs, and the first 1000 first game against LCCC, but came point scorer and the school saw its back to beat them in the second enfirst 600 point scorer. Last Tuesday the lady Colonels counter. According to teh NWPIAA took on a King's College team that rules, the loss should count on the had beaten them twice previously. record. Kings Coach Wilma Schier The winner was to then travel to says it should be different. It sounds Juniata to face a nationally ranked similar to what Mrs. Shier tried to Indian team. The Colonettes pulled say over the MAC ruling of the playoff game to be held at Wilkes. off a stunning 68--65 come from behind victory and made its initial Rules should be followed and not venture into the playoffs. Wilkes changed to suit one school. We will report on the NWPIAA's decision in was lead by all everything, Diane Kendig with 19 points. Lynn the Beacon's next issue. Also watch Yedlock added 16 points and 9 refor the final season statistics in that bounds. Joanne Grismondi had 10 issue. Gary Mack points while Stacey Keeley hauled in 16 rebounds. The halftime score was 34-24 with Kings in the lead. King's top scorer, Mary Beth Bowler, scored 12 first half points. FAVORITE CHEERLEADER Then the Wilkes women went into a Do you have a favorite box and one on the young Monarch, with Mary Jo Frail performing the cheerleader? If you do, listen up. BASKETBALL chores. Frail held Bowler to just 4 EASTERN magazine is looking for the pretsecond half points. The ladies then traveled out to tiest cheerleader in the East. They Huntington to face Juniata on are taking nominations now. Wednesday evening. The Indians Anyone can submit a nomination by came out on top 88-63. The Wilkes sending an 8x10 black and white girls were just to tired and over- glossy photo of the cheerleader in matched. The big bright spot for her school's official uniform. Also, Wilkes was Lynn Yedlock. She has please include name, address and the finest outing of her four year phone number along with a few career as the senior from Wilkes- lines of biographical information. EB's editional staff will select the Barre P.()Ured in 25 points and pulled down 19 rebounds. Both are career finalists whose pictures will be highs. The problem against Juniata published in a future issue. It will was placing only 4 Colonettes in the then be up to the readers to select scoring column. Kendig had 19 the winner. Send all nominations to c-o EASTERN points, Keeley added 11, and Frail Cheerleaders, came in with 8. Keeley also had 16 BASKETBALL, 7 May Court, West Hempstead, NY 11552. Any number rebounds. The girls then finished its season of girls from the same squad may with a big 72-51 victory over be nominated. RAH, RAH!!! Misericordia. Kendig was again high with 26 points. The last point gave Kendig her 600th career point, a first on the campus of Wilkes. GOLF TEAM CANDIDATES Yedlock and Frail ended their - Anyone interested in trying careers with 15 and 14 points ._out for th~ 1980 Will!es College respectively. Rumor does have it that the girls golf tea·m is asked to register may play one final game, for the immediately with the athletic WWPIAA championship. Wilkes secretary in Weckesser Annex finished tied for first place with on the second floor. Marywood. The only problem is CHEERLEADERS . GOLF · senior captain Kendall McNeil, . Move over Jimmy the Greek, here we come. If you took our adplaying in his final game and junior vice last week, you would have won a bundle by picking Marquette Mike McCarrie with 16 points University to upset Notre Dame in college basketball action at apiece. South Bend. That's two-in-a-row ( we picked MU to beat Duke the McNeil ends his career with a week before) and we're on a hot streak. total of 1429 points - good for seMarquette might not have the bench or as much talent as other cond place on the all-time Wilkes teams in the country, but they have hustle and heart - very imporscoring list. McCarrie is moving towards being the next 1,000th-point 1tant ingredients, just ask the United State's ice-hockey team which is truly America's TEAM. scorer as he ends his junior year A te~m with little talent and much h~art is a blessing. That unit with a career total of 892 tallies. .can win. A team with talent and no heart is a disgrace and we've A look at the final 23-game stats seen that at Wilkes. Another top college athlete with heart is Kenfor Wilkes shows that four tucky's Sam Bowie who won a game for the Wildcats last Sunday on Wilkesmen were tough enough to a play few people noticed. Tied 72-72 with LSU after regulation, the play in all 23 encounters. The ironheart men were soph guard Pat Mc- ·I game went into over time and the LSU team stalled for almost. the cue, McNeil, Madden and soph Pat whole extra period. Romich. Kevin "J.J." Walker Then with time running out, about : 11 left to play. Bowie came played in 22 while McCarrie missed out to near ~idcourt and f(!rced a jump-ball. He got the tap and two games with an injury and Kyle Macy hit a 20-footer at the buzzer for the game-winner. LSU played in 21 contests. s~ou_ld have won the game, but it was Bowie that made the play to McNeil took top field-goal atwm 1t. If Kentucky got the ball to Bowie thirty times a game, they tempt honors with 305 and hit for WOULD NEVER lose. 153 for a .501 percentage. McCarrie was behind him hitting on 138 of 280 for a .492 percentage. Madden went Talk about heart, let's send congrats out to our own Wilkes to the foul-line more than any other wrestler Bart Cook. Cook moved up TWO weight classes ( from norColonel, but hit on only 60 or 100 mal 177 to heavyweight) in this past week's quad-event in Virginia from the charity stripe. McNeil led because of an injury to Bob Matzelle. Bart came through in the the team in scoring with 372 points and a 16-1 average. _ clutch against Old Dominion, when with the scored tied l!J-19 before McCarrie was second at 15-0 and his bout, he_powered his way to a 18-2 superior decision. Way to go 316 points followed by Madden with Bart! We wish all the wrestlers and Coach Reese much luck in this 268 tallies md an 11-6 scoring wee~end's EIWA Tourney at Lehigh University. Remember. average. Madden, who hasn't you've got to have heart! played organized basketball for two years before coming to Wilkes, led in rebounding with 181. Walker was next with 138. We think ABC did a super job in its coverage of the Olympics. We Mccue, who shot 61 of 74 for a .824 really can't picture Olympic coverage without Jim McKay and the from the foul line, led the team in excellent ABC supporting cast. If the USA enters the Moscow assists with 130 with McNeil and Olympics (we won't), NBC will handle coverage, but don't hold McCarrie tied· for second with 56 your breath. A boycott is the best thing right now! assists each. McCue's 56 steals led Eric Heiden followed the footsteps of Mark Spitz and Bruce Jenthe team. Walker blocked 28 shots n~r, and is this Olymp_ics' "golden boy." Heiden, a super athlete for a team-high. with an even better attitude, does not have to worry about working As a team, Wilkes shot .498 from any more after-winning five gold medals. A big disappointment was the field (638-1281) while opponents Lin4a Frantianee, who we felt all along was over-rated. There is a were .487 (663-1360). Opponents lot of pressure in the Olympics and the truth is, she choked. She is were betterfoul-shooters with a .692 no where near Dorothy Hamill and could not shine Dot's skates. percentage while Wilkes came in at W~at about the U.S. hockey team. winning the gold at Lake .676. The opponents outscored Wilkes 1635-1606 for a 71.0-69.8 Placid. It's not only the greatest American win in Olympic history, average. but probably the greatest in all sports anywhere. Yeah. even better The season was a good one on the than any Super Bowl, World Series or PIAA Championship. whole for Wilkes. Considering they Those guys were super. All through the Olympics they and their lost all-ECAC and nation's No. 3 coach, Herb Brooks, told reporters that they were not that good. leading rebounder John Zapko and The truth is, they were not. Really, they were not the best <talentRighter didn't get a chance to wise) team in that Olympic tourney. But with their heart and recruit to being hired late, 10-13 is a desire, they became a better team and this came to a peak last Frigood season after a 9-15 campaign. day when they upset the so-called greatest hockey teani on earth Righter knows a lot of changes Russia. have to be made and things must be They °!ade_ the commies look "red" in the 4-l victory, coming cleared up during the off-season from bebmd hke they had done so many times, to score two goals in and he and ace assistant Justice are the final period to win. What a win, not just for the players and working hard on the recruiting coaching staff, and not just for the United States, but for the entire trail. free-world. It was like saying to the U.S.S.R., take Afganistan and TIP-INS: ... in the latest MAC the '80 Summer Olympics and stick 'em. stats, McCarrie (16. l l is 12th in Here was a bunc.h of college kids, living out their own little trip to scoring and McNeil is 14th at 05.6) Oz. They gav~ the USA the support it needs and more important ... Madden is the league's seventh brought some light into each and everyone of our hearts. We will rebounder and Walker is 10th ... always remember this team and its win. We can honestly say, there Walker is 11th in field goal percenwill never be another like it. · tage with Madden 12th-and McCue The award ceremony for hockey was super. The play"ers wanted bas moved up to sixth in free-throw shooting ... in the MAC playoffs to share their awards and the victory with the crowd. Not only those this past weekend at Scranton in attendance, but all over America. It's something that we'll never University, Albright nipped King's forget. We owe a lot to that team and Herb Brooks. Those guys in the first-round while Scranton made some people, who never watched hockey before, listen to the hammered Lycoming ... in the title game Friday and get up early Sunday to follow them on their trip game, "Dub U" rode the homefor liberty. · crowd to a convincing win over Will · A great quote came from one of the team's members. He was Renken's Albright team ... Renken ~sked h~w important. w~s the gam_e with Russia. "The papers say it is supposed to retire after this 1s very important with the standmgs and everything." he began, season ... Now the Royals host the "But with all the political issues, a lot of people say it is a war. But NCAA Regionals and with their really it's more than that." fans supporting them, don't be surHe's right! Come on, one more time, "U!S!A! U!S!A! U!S!A!" prised to see Bessior's bead-men win that tourney. Eddie White I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ----------- I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I �- . February 28, 1980, The Beacon, Page 11 · Butclaka.,itz, Bello & Maguire Earn Honors --:-------------------------------- Sa, im Team WinsSeven .MedalsAtMAC's Peggy Butchkavitz, Reed Bello, and Michelle Maguire all won medals at the MAC Swimming and Diving championships held at Ursinus College this past weekend. As a team it was the best performance for Wilkes in re- · cent years. . Winning the first medal for Wilkes, Reed Bello captured a third place finish in the 1-meter diving event with a score of 345.45. He finished ahead of other Wilkes divers Perry Lichtinger and Frank Gardner, who ended up tenth and fourteenth respectively. Bello hit his dives well and didn't break under the pressure during the 11 rounds of diving. It should be remembered that .Bello is only a freshman and has three exciting years of competition ahead of him . Bob Lewis.. should also be noted for his fine work as diving coach. It was the first year Wilkes has ever had a diving coach of their own and it certainly made a difference. His presence next year with the team will continue to be an important factor. Michelle Maguire was the first Wilkes swimmer to earn a medal at the championships. She ended up with three, all sixth place Tinishes. Her first event was the 200 yard Individual Medley which she did in 2:26.6. The 100 yard butterfly was next. In the trials she finished tied for sixth and it was necessary to have a swim-off to see who would qualify · for the finals. It was a close race but Michelle went on to win and did a time of 1:05.5. Her third came in the 200 yard butterfly with a time of 2:25.9. In IN TRAM URALS FINAL STANDINGS "A" Division Chumlies Benton Boys CAOS Crazy Horse PrepH A.O.A. Champagne Jam 7-1 4-4 4-4 4-4 4-4 3-5 2-6 this event Maguire came within a second and a half to qualify for nationals. Maguire was the ony person on the team to win any medals at the championships last year. Swimming the best over everyone op the team, Peggy Butchkavitz won three medals with her best showing in the 200 yard breaststroke. She finished second with a time of 2:42.1 which is one second off from qualifying for nationals. Since Butchkavitz is so close to qualifying she has decided to continue to swim for a "mini-meet" to be held in the near future set up for the sole purpose of those who are close to qualifying for nationals and need to get theoffical time . "I think she has an excellent chance of making a nationals, '' said coach Bob Greenwald who is very proud of Peggy's swimming at MAC'S. Nationals will be held in Meadville, Pa. the weekend of March 13-15. Her other two medals came in the 100 yard breaststroke in which she earned a fourth and fifty yard freestyle fiqishing fifth. Overall, the Wilkes swim team brought home seven medals. Last year Maguire brought home the only three medals f~r Wilkes while the year before diver Cindy Glawe earned the only medal for the team, a gold. Sea•on Summary Looking over the entire season, one comment comes to mind-What an improvement!· Last year the season ended dismally with a team record of 0-11. With expertise of first year coach Bob Greenwald and the addition of freshmen team members, Bello; Butchkavitz and Dave Gergen this year ended on a bright note. Greenwald's dedication and leadership was the driving factor behind this. The season record ended at 4-7-1. Wins came from Ur- sinus, Lycoming, Elizabethtown Michelle Maguire. dow of the van the way she did and Utica. Two other meets, a loss · 100 Yard Freestyle; 52.6; Jim Eddeserves a lot of respect. Next year, to Swarthmore and a tie to Lycomwards. Megan, let's make that "W" a little ing, should have been wins for 200 Yard Backstroke; 2: 22. 7; Ron smaller ... Alan "Disco Flipper" Wilkes but didn't fall that way. Sweeda. Shaw never.taught the team how to Ten out of the 14 team records 100 Yard Backstroke, Ron dance. After No. 9 shaved his legs, were broken and of those ten, two Sweeda. arms and chest, .he should have had been held since 1971. Every 500 Yard Freestyle; 5:24.6; Dave been ready to burn. What happenteam member except for Maguire Gergen. ed? ... Speaking of No. 9, we should did their best times and Improved 200 Yard B~ststroke ; 2:32.0; have dropped her off at Macconsiderably. The spirit among Rob Doty. Donald's and left her there ... The team members was fantastic and 100 Yard Breaststroke; 1:08.4; Five Musketeers took relief on the the support they all gave each other Rob Doty. way home holding their swords in was Impressive. 400 Yard Freestyle Relay; 3:37.6 ; hand ... Rob, Joe and Pat did a nice The top eight team members who Dave Gergen, John Moffatt, Enrico job of buying everyone gifts. Reed earned the most in total points this Ratti and Jim Edwards. Bello was so overw-helmed with his season were as follows: ADDED ,EXTRAS: Megan gift that he pulled a "Samsel." ... I) Dave Gergen 96 Caverly is alright in our book. "Hey. Peggy, where are your 2) Reed Bello 90 Anyone who left a "W" on the winhands?" 3) Jim Edwards 83 4) Michelle Maguire 66 5) Peggy Butchkavitz 59 6) John Moffatt 46 7) Rob Doty 26 8) Enrico Ratti 25 Other team members who round- ed out the squad were Kim Bush, Megan Caverly, Frank Gardner, Perry Lichtinger, Joe Milazzo, Alan Shaw and Pat Slowey. Next year the team will only lose three seniors: Captains Jim Edwards and Alan Shaw and diver Perry Lichtinger. Greenwald has been recruiting and been thinking about next year for some time now. There is talk of a possible trip to Florida during the Christmas break for-a week of double session practice. For the only team in the · MAC's that has no pool to call their own, things are looking up. TEAM RECORDS 400 Yard Medley Relay; 4:18.0; John Moffatt, Rob Doty, Jime-Edwards and Enrico Ratti. 1000 Yard Freestyle; 12:20.2; Jeff Boberick. . 200 Yard Freestyle; 1:56.8; Jim Edwards. SO Yard Freestyle; 23.5; Rich Marchant and Dave Gergen. . 200 Yard Individual Medley; 2: 14.3; Jim Edwards. MAKING WAVES - Peggy Butchkavitz (left), Reed Bello and 200 Yard Butterfly; 2:24.6; Michelle Maguire brought home a total of seven medals from the MAC Michelle Maguire. Swimming and Diving Championships held this past weekend at Ur100 Yard Butterfly; 1:05.5; sinus College. " B-1 Division" *Harriers *ROTC Diaz Eat Them Monsoon 5-1 4-2 3-3 2-4 1-5 "B-2 Division" *Bob-Ballers *Baroqs *Luke's Skywalkers *Buckateers Sophia's , Bedford Molo'sAMF 8-0 6-2 6-2 5-3 2-6 0-8 1-7 " B-3 Division" *Chico's *Whippets Vets Whipppets II Scrap Pack Dartans 5-0 5-0 3-0 2-4 2-4 0-6 INTRA NOTES : Coach Dave Kaschak, who runs the program, wanted it publicly known that he commends Bedford and Dartans for showing• up for every game although they didn't win any. He also said that any referrees not paid yet for basketball are asked to see Sandy in the athletic office. · ATTENTION SCIENCE AND ENGINEERING MAJORS! The Air Force has openings for young men and women majoring in selected science and engineering fields . Like Aeronautical. Aerospace. General and Electrical Engineering. Mathematics. Physics and Computer Technology. To help prepare for one of these. Air Force ROTC offers two and four-year programs of study which will defray some of your college costs. After completion of the AFROTC requirement. and upon your graduation. you 11 be commissioned an officer in the Air Force. Then comes responsibility. experience in your specialty with some of the best people and facilities in the world. and a mission wiih a purpose. You'll get excellent starting_salary. medical and dental care. 30 days of paid va' cation beginning your firs t year. and more. Look into the Air Force ROTC program right away . See what's in ii for you . See how you can serve your country in return . You'll be glad you put your major to work on a job that really counts. Sophomores!! ! Ask about our "Hip Pocket" scholarship. Call Captain Johnson at extension 371 or 372. HOTC Ga teway to a great way of life. �~ .,-s \J~~ .~<~ the◊beacon Wilkes College Wilkes-Barre, Pa. Vol. XXXII, No. 20 February 28, 1980 - Final Florida Plans Travelers to Florida who are taking the baa, will leave-the Wilke• College Gym on Soath · Frank~in Street on March 1, 1980 at 11:00 a.m. lti• suggested that travelers be there at 10:·4 5 a.m. at the latest. · To Sunshine: Plane will be leaving Philadelphia lnternationalAirport at 4:30:p.m. from Domestic Terminal D. Bat yoa mast check: in at the Air Florida ticket counter at the airport by3:00: p.m. We will arrive in Ft. Laaderda,e at 7 :00:p.m. From Sunshine: Plane will be leaving Ft. Lauderdale International airport at 1:30:p.m. bat check in ti~e will be at 12:00 noon at the Air . Florida ticket counter, Con coarse F terminal. .PLEASE follow schedules that Wain wright travel has mailed to yoa. , , . I ' ' , I I · Peggy Butchkaviti was the first swimmer in recent years to win a silver medal at the MAC Swimming and Diving Championships which were held this past weekend. Here she is caught in a moment of concentration between races. Michelle Maguire and Reed Bello also won medals for the Colonels. See the sports page. (Photo by Buoys> • I ~ I � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 February 28th Date A point or period of time associated with an event in the lifecycle of the resource 1980 February 28 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/7071dcf44e9cfc157ce3c49197f92c33.pdf 108fdf84b6cadffe42f3ef89f86eba32 PDF Text Text 10 Academi~ Departments Have Applied Faut De/ends Policy To Offer Minor Concentrations Next Fall In Front 0/ SG Body Dr. Owen Faut was present at Monday night's meeting of Student Government where he explained the proposal of the Academic Standards committee to change the course withdrawaL..policy. Faut began by reading the proposal as it will be read before the full faculty when it comes to a vote on March 13. When Joe Galli asked why the change has been proposed, Faut replied that, "Wis not a grade." He went on to say that the ten week policy has fostered the belief that "W" is a substitute for a "O" or a "1, '' and as a result gives the impression that the instructors are afraid to give low grades. He added that it makes it look like the college just does not give failures or D's and makes the overall college grade average appear false. He further eiplained that it is not necessary that an exam be given for a student to decide if he will stay in the course since the result would be that again the "W" would be a substitute for a grade. He told the SG body that in shortening the withdrawal time the college is trying to encourage students to take a closer look at a course and to talk with the instructor before dropping the class. Marla Brodsky pointed out that in most courses the first few weeks are introductory material and you do not get really involved in the course until later on. Faut responded by saying that if that is the case, students are being cheated. He said, "You are paying good money for good instruction from the first day of classes." Faut continued to explain that with the newpolicy the value of a student's transcript will increase. He added, "Wilkes is relatively young and we are still building our reputation," and he views the new withdrawal policy as one way to help do that. He stated, "There may be an increased number of low grades, but the purpose of this institution is to test how good you are and if it does not do that you are wasting your money.'' When asked why the committee had chosen four weeks as the deadline for course withdrawals, Faut explained that four was picked because itlookedlike it was the most reasonable compromise between what is, what was, and what should be. Ana Nunez asked Faut what he would consider adequate reasons for dropping a course after a four week deadline. He answered that good reasons would be illness for long periods of time, personal situations at home, or if a student finds that he simply cannot do the work required in college. Two representatives of Parties Unlimited, Mike Mey and Rick Chapman, were · present at the meeting to explain their proposal to have parties in the Student Center on weekends when no else schedules parties. Continued on Page 2 Academic Dean Dr. Gerald Hartdagen, bas confirmed that ten academic departments have applied to offer minor concentrations in their disciplines beginning next · fall. The ten departments are Art, Biology, Chemistry, Commerce and Finance, Earth and Environmental. Sciences, Language and Literatures, History, Mathematics and Computer Science, Political Science, Sociology and Anthropology. Hartdagen expla~ed that the proposals from each department will be voted on by a sub-committee of the curriculum committee. The approved proposals will go before the full faculty at the March ' FORBES -Sr. Editor Schedalecl To Lecture On Ba~iness Of Today -. Malcolm S. Forbes, Jr. vicepresident and secretary of Forbes, Inc., and Senior Editor of FORBES Magazine, will give a lecture entitled, "Business and the Economy," Wednesday evening, February 27th at 8:00 p.m. in the Center for the Performing Arts. · FORBES Magazine is one of the country's oldest and most important business management publications. Mr. Forbes graduated cum laude from Brooks School, North Andover, Mass. in 1966 and from Princeton University in 1970. While at Princeton, Mr. Forbes was fouding editor of Business T~ day, a quarterly publication design- ed to give students a balanced perspective of the business world. Business Today became the country's largest magazine published by students, with a nationwide circulation of 200,000. The magazine continues today, still being produced by Princeton ... University undergraduates. Immediately following bis active military service, Forbes joined the business pUblication founded by his grandfather in 1917. He became a director of Forbes, Inc., in 1971 and .was appointed Vice-President and secretary in 1973. In 1976, he became Associate Editor of the magazine and was promoted to the post of Senior Editor in 1978. His duties include writing editorials for each issue of FORBES, the third generation of his family to doso. In both 1975 and 1976, Malcolm Forbes, Jr., was awarded the crystal owl presented annually by the U.S. Steel Corporation to the reporter making the most accurate economic forecasts for the coming year. In addition to being a consecutive win, it was the first time that any writer won the award twice during the competition's 40year history. Mr. Forbes was runner-up for 1978. meeting for final approval. A list of the approved minors and their requirements will be forthcoming. Most departments will require 18 credit-hours of work, but departments offering four credit courses can require as many as 24 credits. In addition, some departments may offer minors in more than one .specific subject area. Hartdagen indicated that he is pleased with the response of the departments at this point. "I had no expectations that all of the departments would apply," he continued, "some may start one later." He pointed out that there are 16 departments that have the potential ability to ofter a minor and he expects that more departments will start minors in the near future. · Although it bas not been decided how a student will sign up for a minor H he wants one, a procedure bas been suggested which would include a form where a student would indicate his advisor but he would be welcome to consult with people in the department of his minor. When asked H graduates could return, Hartdagen answered that anyone, including graduates, could come back and complete the requirements for a minor at any time. Lollis Czacbor Publications Committee Approves Budgets'' For Beacon, Am.nicola And 'Manuscript' The ~ campus publications, decrease in funding was the the Beacon, Amnicola and Beacon. Editor-in-chief, Jim Ed· "Manuscript" requested their wards presented the costs of the yearly budgets for the 1980-}981 newspaper. The projected income academic year at the February from advertising is listed as $7000. meeting of the Student Publications The request for $11200, a $95 Committee. All three of the budgets decrease from last year's request, were passed unanimously. was passed by the committee. The Requesting $3750, a $1200 in- ·Beacon publishes 25 · issues per crease over last year, Janet Hockacademic year. ing, editor-in-chief of the George Pawlush, advisor of the "Manuscript" stated there has Beacon, states be would like to have been no increase in the budget for · a center for printing which could be the past five years. She continued · used by the Beacon, Public Relathat because of a lack of funds, the tions, and students in the Compage space is limited, and the munications Studies major. amount of contributions must also Although initial costs would be be limited. Moreover, there can be high, be explained, "It could save no graphic arts, so a lot of artwork the school between $30,000 and cannot be published. Dr. Lee Terry, $40,000 a year." He also stated that chairman of the committee stated it the Beacon is only 40 percent adverwas an acceptable and reasonable tising, much less than most budget. The "Manuscript" publish- newspapers. es once a year. Mary Giblin, editor-in-chief of the Dr. Walter Karpinich, committee Amnicola stated that . because of member, questioned the attencosts, the size of the yearbook dance at the "Manuscript" sponwould be decreased by 94 pages. sored films. Janet Hocking replied The number ordered will also be that the attendance is greatly im- decreased to 400 from 550. The Amproved over last year, when a film nicola requested $7800, a $200 in- . would sometimes be shown for one crease over last year's budget due person. This year, there are at least to an increase in printing costs 50 people at each film, she stated. because of the fewer number The only publication to ask for a ordered. Art Hoover, adyisor of the Amnicola, stated that · they are presently planning to increase the activity fee of each student to include the price of a yearbook, then every student would receive one each year. If this move passes Student Government and administration, it would be in effect tpe year after next. Presently, there are approximately 170 unsold yearbooks. The Amnicola publishes once a year. _ Under other business, Dr. Terry stated a contingency fund of $500 is being considered for the committee in case of emergencies. He would also like to merge all committees on campus and have one non-academic committee supervising all campus activities.. Dr. Bradford Kinney, committee member, asked which activities would be included in the new committee. Dr. Terry replied that it has not been decided yet, since it is only in the early planning stages. Dr. Terry also announced that this would be bis last year as chairman of the Student Publications Committee. Another one half or three-quarter ·scholarship will be given to the "Manuscript" at the expense of the other publications, stated Dr. Terry. "I cannot in good conscience ask for more than 10 scholarships," he said. Therefore, he will arbitrarily divide the scholarships between the publications. He feels the "Manuscript" bas been short changed the past several years. At the April meeting, student personnel for next year will be examined, and the scholarships awarded. Faculty and administration and students are invited to the March meeting of the committee to voice any complaints or praise for the three publications. , NOTICE The Census Bureau will conduct its national cenius of population and housing in the spring of 1980. All colleges will be cooperating with the census bureau and Wilkes will provide, when asked, the name and address of students who are enrolled. Because of the Family Educational Rights and Privacy Act (FERPA) which govems educational records, the college is hereby notifying all students that the aforementioned data will be provided uleu particalar instructions to the contrary are forwarded to the Deaa's Office prior to March 1. �Pa_ge 2, The Beacon, February 21, 1980 Student Government Continued from Page I Pictured above are members of this year's Polar Bear Club. In the center of the group holding skis are from left to right: Charlie Zezza, vice-president- . treasurer: Charlie Issacs, president: ;nd Sue Issacs.secretary. Polar Bear Club Promotes Participation In Skiing , Do you like meeting people and making new friends? Do you like having a good time? Do you like to ski? If you answered yes to these questions, then the Polar Bear Club may be your cup of tea. According to Charlie Issacs, President of the club, "We bring out skiing within the college. We want people to try skiing and get to know each other. It's basically a social club with 90 to 100 members." The Polar Bear Club sponsors weekiy trips to Elk Mountain every Wednesday, a yearly trip, and a picnic at the end of the year. To enjoy these activities, you don't have to go to Wilkes - everyone is welcome. Issacs commented, "The more people, the better the time you have." Of course, there is a $3 yearly dues which is mainiy used to keep the club in operation, and helps to]lay for the gas for the trips to Elk. ~ p_~st yea~~ -~~ub took its yearly trip to Sugarbush Valley, Vermont. Approximately fifty people went on the trip. "Everyone had a good time in spite of the lack of snow," Issacs stated, "and we are invited back next year. Sugarbush is probably the best mountain in Vermont." Issacs went on to say, however, that he is also looking into a trip to Vale, COiorado for next year. While at Sugarbush, Wilkes entered a ski race sponsored by Nastar, and raced against each other. There are three categories (beginner, intermediate and expert) which are run on the same course, and there are three trophies for each category. The course is run timed and clocked, and handicaps given. Medals are given for a good time against the pacesetter. The winners for this past year are: Beginners: first place, Dorene Strops; second place, Darrell Evans; third place, Jay Lafkowitz. THE GREAT NEW IN PLACE FOR THE "COLLEGE" CROWD Live Entertainment At JIM DANDY'S MARK PLAZA, EDWARDSVILLE Intermediate: first place, Mark Bell (bronze medal) ; second place, John Keating (bronze) ; third place, Brian Selenski (bronze). Expert: first place, Charlie Issacs (silver medal); second place, Chip Brill (silver) ; third , place, Brad McLennan (bronze) . Officers of the Polar Bear Club include Issacs; Vice President, Treasurer Charlie Zezza; and Secretary Sue Issacs. "They are good officers," Issacs commented. "Being president is a lot of work, but I enjoy leading this group and I get a lot of respect.'' They added that they want to get more interaction between commuters and dorm students and they plan to offer more than just music and beer. Their goal is to see that there is a party on campus every Friday and Saturday night. They explained that they will supply their own workers including people .to clean up, set up and act as security. When Marla Brodsky told them that everyone is wondering what their motives are, they explained that they just want to have a good time. They said that they are involved with students and they get a lot of feedback and as a result they think they know what students want and they are·willing to give it. Students attending a party given by Parties Unlimited would have to pay $2.00 at the door. Any profits realized from the parties would be put in an account to be used for future parties. Aproposal was made that Parties Unlimited become a subcommittee under SG's social committee. The proposal was passed 20-0-2, and guidelines will be made for the new subcommittee. NOTICE This is the last week to buy your Wilkes Comfort T-Shirt. Only $5.00 while supplies last. Buy one today! NOTICE There will be a meeting of the Junior Class this Thursday at 12: 00 in S.L.C., room 166. NOTICE There will be an organizational meeting next Wednesday at 9:15 in Stark Lobby for anyone interested in working on the Cherry· Blossom Festival. EORGE WASHINGTON' BIRTHDA V!!! . . ALL WEEK PRESIDENTIAL SPECIAL CHILI DOGS BUY ONE - GET ONE FREE All Students Welcome CLASSES BEGINNING FEBRUA RY 24 AT KING'S COLLEGE 1 Spring 1980 * (Proper I.D. Required) LIKE EXCITING NITE LIFE ·? Have a fabulous time this Thursday night with Call Days Evenings & Weekends (215) 435-2171 **** 1524 LINDEN ST. Allentown, Pa. 18f02 GARX EARL and his "l;)andy" guitar **** Burgers Beef Sandwiches . Served 21 Different Ways Stop In Before or After the Mol'ies Mon.-Sat. 11 a.m. lo 2 a .m. Sun. 3 p.m. lo 2 a.m. y ( Lisa Gurka Relax in the friendly atmosphere with exciting, vibrant people BEER BY THE PITCHER No Cover or Minimum l Educational Center TEST PREPARATION SPECIALISTS SINCE 1938 REGISTRATION at 10:30 a.m. Cl~ss Location: Sheehy Student Center Conference Rooms A&B, Lower Level " �----JDC February 21, 1980, The Beacon, Page 3 . ·Proposed Four Wk. Policy Calnan Baggs A~cepts Po~ition · Seen At Student Expense As Asst. Food Service Manage r At the Inter-Dormitory Council's .Sunday night meeting the proposed four week withdrawal policy was discussed. Ana Nunez, student representative to the Academic Standards Committee, presented the proposal to the IDC representatives. She stated that one of the purposes of the policy is to allow the faculty to have more control over the academic affairs of the students. It was also expressed that the policy may bring about increased responsibility in the faculty. However, almost all the IDC reps felt that this increase in faculty responsibility to the students is being sought at the expense of student rights. As the policy stands now, even with the decreased time for withdrawal, professors will still not be forced to test students or provide students with any evaluation of their performance in a course before the four weeks is over. Instead, the emphasis is placed on "talking with the professor," before withdrawing from a course, according to Nunez. IDC President Mike Stapleton announced that the report on Co-Ed Housing has been completed and was presented to the Student Life Committee, which voted unanimously to back the proposal in Dean's Council. If the proposal passes in Dean's Council, it will go to the President's Council, where the possiblity of having the co-ed housing on campus will be decided. It was also reported that the Valentine's Day Party held on Feb. 15 was a huge success. Stapleton thanked all the reps who helped with the party. · · Mary Kay _Pogar The assistant Food Service Manager, Randy Morris, is leaving Wilkes to pursue a similar position in Corning, New York and his replacement, Calnan Baggs, will take over the day to day running of the dining hall. Baggs said his duties include such tasks as ordering food and making sure the shifts are adequately staffed, but these duties are · familiar to him. He managed the dining hall in the spring of 1977. During that time, he instituted the · salad bar. The following fall semester, a policy of second on food was established. --~~~ a~ ~~king for input from Pr~posed Four Week Withdrawal Policy Main Discussion Topic At ~C -Meeting Commuter Council's main topic of discussion at its weekly meeting was the proposed 4 week withdrawal policy. Ana Nunez, a representative of St1:1dent Government e_xpla1!1ed the Januzzi's Pizza and Hoagies 125 A cademy Street Home Delivery · OPEN 7 DAYS 11-1 .J policy and the attitudes ot many concerned students and faculty on campus. She pointed out that there is a lot of controversy over the policy and went on to explain that the policy will accomplish two basic goals. "The policy is to create dialogue between the professors and the students, while also providing greater control over the faculty and the students." Ana continued, "the primary function of the policy (according to several professors) is not the students' rights, but rather the image of the school. " The discussion ended with studerits being asked to discuss the withdrawal policy among themselves and to share their ideas with professors. . .--t~I ~..r....✓.,..-..-oo!f You'll be amazed at all the opportunities and advantages the Army offers men and women . with BSN degrees: .BROOK'S BARBER JHi_OP , · • 1 t ~ • Excellent starting salaries and benefits, including a liberal vacation policy. • Real ~ pportunity for advancement and professiona! growth-every Army Nurse is a commissioned officer. • No basic training for nurses; just a bas,ic orientation course to familiarize you with the Ariny Medical Department. • The chance to travel; time to do the things you enjoy. • Opportunity to qualify for specialized roles, teaching or additional education. Call collect to See if you qualify. ~~· • ST YLING FOR M;N & W OMEN • HAIR COLORING & CO NDITIONING • PERMANENT WAVING • HA IR STRAIGHTEN ING •SCALP, FACIAL TREATMENT • MANIC URING • SHOE SHINE ~,'ill FQR APPOINTMENT FRANK• PETE SART°"IO · PROP . 82.4-2~j e:6'~~sE:l6G, ) MAIN FLOOR 15 s. f iANKIIN ~I. . WIIKES .BAH [ r'III ~iIIJIIIJ r'llllJ~II 113 S. MAIN ST. Downtown Wilkes-Borre DAil Y 10 a .m . to 5 :30 p;m . Mo n. & Thurs. Iii 9 p,m . 1 : : : : : Address _ _ _ _ __ _ _ _ _ _ __ _ _ Apt. _ _ : I I I City, State , zrp ______ _______ ____ Phone _ _ _ _ _ __ _ _ _ _ _ _ _ _ _ Age _ _ 1 ~ _ _ __________________ _____ _ ____ _ ___ _ CASS /NE RRC _j 1 i1Jr ~r1[1 , - - - - -- ---- --------------- - ------- - --- -- - --7 For more information, write: The Army Nurse Corps. Northeast Region, U.S. Army Recruiting Fort George G. Meade, MD 20755 Name_.,.-_ _ _ _ __ _ _ _ _ _ _ _ _ _ _ _ _ - [JIJrTI ll11r1 Elflls The Ar my Nurse Corps. 1 • =x>O""~~. 301-677-4891 : : : : students like or what we are doing wrong unless they tell us. When someone complains in the lunch line, it doesn't help much. We need more than that." , He says that the food service feeds eight-hundred people, three meals a day. "The food service here at Wilkes is above average for colleges. I've been to other campuses where, H the menu says chicken, tbey get only one choice: chicken. Here, a person had the option of three or four entrees, and if he doesn't ilke that, there's always Calnan Baggs a salad bar. Students sometimes the food service •committ•ee.'' complain, 'we're having spaghetti Baggs said. •~w~_~on't know what again. We just had it two nights ago.' What they .don't realize is that, with all.the plates we serve, there has to be some :overJap.'' Baggs said, "We have a good operation, but we can't please e~eryone. People expect to get The Student Center report was meals as good as Mom's but this is given by John Moffatt who explaininstitutional food. We can't please ed that there are some new · everyone or make everything:'' machines in the center. Baggs didn't list any specific problems · with the food service, but Under unfinished busmess, tne said he would like to make the Valentine's Day was deemed a sucoperation nicer. He would like to cess. According to CC President see more events like bread day or ; Bill Lewis, "The Valentine's Party ice cream day. One idea is for a shows that IDC and CC work best float day, where rootbeer floats and when they work together." The such would be offered. He said that . next major party is the St. though the food service cannot Patrick's Day Party on March 14. make special dishes for Jewish The top 40's band, "Nature's Way" students, the cafet~ria plans a will perform and tickets will be special passover meal for Jewish. $4.00. students, so they will not have to Also under unfinished business, break any of their traditions. "This the Ice Skating Party scheduled for is a very ethnic region," .he also 1 the Coal Street Ice-A,Rama has said, "and it would be nice if we been cancelled. According to Bill could give something like a Polish Lewis, "there is no time available night, where Polish food would be to schedule a skating party over at served." He would also like to add Ice-A-Rama." ..-Students are reminded that Com- .more to the salad bar. muter Council will be sponsoring a He said he would like to make the atmosphere more appealing, poin- · bus trip to New York on March 1. Students will be picked up af 8 ting to the fact that there were little valentines day decorations up in the o'clock in front of the Stark Learning Center and will be dropped off dining room. He would also like to at the Radio City Music Hall. The see more students to help with the bus leave New York at 11:30 p.m. manpower. In order for these to be achieved, more students would Tickets are $9.50 and can be obtainhave to be willing to get involved. ed at the Student Center and the Cafe. David Stahl Finally, the sophomore vacancy is now filled by Molly Sammon. SIJSiflrns See Joe, Bob, and Danny ARMY PANTS . PAINTER PANTS FARMER JO-NI SWEATSHIRTS -,LANN£t·SHIRTI ~ F...icNllet MON.-THURS. 1 1 A.M.-9 P.M. TUES., WED., . FRl.&SAT. 11 :00 A.M .-5:30 P.M. 288-3751 �Page 4, The Beacon, February 21, 1980 To The Editor: Remember last semester when we made a plea for Letters to the Editor because we wanted to hear your opinions and suggestions? Obviously some of you do and since then we have been occasionally bombarded with letters covering many subjects. We are flattered and grateful to see that many of you consider this paper THE main channel of communication on this campus. If you want everyone to know what you are feeling there is not a better way to get your point across than to submit a letter. Everyone on campus reads them, from President Capin right on down to that naive freshman who sits next to you in History class. Lately, however, certain people have been submitting letters that are attacks against personalities around campus. To be specific, in our February 7, 1980 issue, two letters were submitted that were directed towards the integrity of our Athletic Director John Reese and the Junior Class President Colleen Gries. We decideg to print both letters for specific reasons that will not be discussed here. What bothered most people was that the author~ of these letters declined to have their names printed below their writings. Some say there is nothing wrong with that. It meets all the requirements of our Letter policy which states that "all letters must be signed in ink, but names will be withheld upon request. '' Our letter policy is not unusual for any newspaper but things are getting out of hand. The policy is not .going to change and names will continue to be withheld upon request. What we would like to see, however, is a little more responsibility on the part of those who do submit a letter of this type.· If attacks or gripes are going tp be . aired in this paper, we strongly suggest that the author sign his name to it and face the music. The credibility of any article or letter is only as good as its source. Remember that. If you want your letter to have impact, put your signature at the end of it and let everyone know who you are. Wallace Upset With Presence OfSecurity To the Editor: It should be brought to the atten- tion of the Wilkes Family that the IDC-CC Valentine's Party was a success. However, what would have been a completely enjoyable evening was slightly marred by an episode which I feel is unnecessary at Wilkes. Quoted as being "a bummer," was the presence of certain individuals which detracted from the festive atmosphere of the party. I speak, of course, of our security people. Their multi-manned, uniformed showing, complete with night sticks and pistols had all the warmth of a German war movie featuring the Gestapo. Their pacing and congregating at parade-rest was impressive! While these antics were tolerated by some, they disturbed others. I certainly agree that security is needed; but, are the nightsticks and pistols really necessary? Must they congregate, pace and stare? Are they so intent on preserving their ' own "Starsky and Hutch" images? In the future, might we not consider a lower profile for security people, without the armament, to lend a more enjoyable atmosphere to our gatherings? Robert S. Wallace NOTICE The Accounting and Business Club will sponsor a speaker at their meeting today a 11 : 15 a.m. in the audio and visual room in the basement of the library. The ~peaker will be Charles Lengle, vicepresident of Marsh McGenen. He · :~!~:::.ak about business and in- Campus Commentary High School Years "High school isn't a time and place," Frank Zappa once said, "It's a state of mind." Especially in recent years as we have lined up for "American Graffiti," "The Summer of 42," "Grease," and watched "Happy Days" on television, America has become sort of an on going high school assembly. As the most tribal experience many of us will undergo, high school must be memorable. Never again are we ranked so precisely by those around us and on so many scales. Through the popularity polls of our classmates, and their inexperience at tact, daily feedback is conveyed about how we are coming across. Such merciless judgement will not easily be forgotten; it's the last time in life we will know just where we stand in the scrutinizing eyes around us. Consequently, insight into a person's high school behavior can usually give us an accurate picture of how that person will be in future life. Knowing what an individual was like in high school can make, or seem to make, everything fall -into place. Because study after study shows that there is seldom much difference in behavior between adolescence and adulthood. A look at one group of students 13 years after high school reports their "remarkable persistence of personality trends.' ' What this means is that they were probably stuck for life with the behavior they displayed in high school. If noisy then, they would most likely be talkative in later life. Self-assured as teens, they will appear on. top of things later. For those who want life to be different after high school, this is discouraging news. But here is the encouraging news : although our behavior may not change after high school, the setting does. What succeeds in school won't work later on. Physical gifts, looks, a winning way and an easy smile - except for the ocassional Robert Redford or Raquel Welch - are qualities that won't get you two seconds on the evening news. On the other hand, qualities that lose your status in high school - aggressiveness, imagination and an independent turn of mind, may ~ just the qualities neede~ to make it in a larger setting where performance counts more than style. "A study done by a Columbia research team of the 20 socially most popular and prominent members of the senior class showed that this group did not maintain a relative advantage or success in either social or other areas of young-adult performance when compared with a matched group of socially non-prominent peers. '' In other words, things do change after high school and roles can reverse - radically. David A. Clanton -------the·<~beaeon------USPS 832-0tlt Brodsky Speaks Up & Claims Identity_ As Author ofLetter In Feb. 7th Issue To the Editor: On February 7th, a letter appeared in The Beacon which expressed the sentiments of myself and many other students. My job as student representative is just that; to project the feelings of my fellow students. It's purpose was to clarify a mix-up and to question the praise given to an event run by the Junior Class President; unfortunately, the message was misinterpreted. To start off, I am very pleased with the job Colleen Gries has done as President of the Class of 1981 ; her diligent efforts and concerns are highly commendable and appreciated by many. But, to go out of your way to secure a movie Is not such a terrific feat, especially when you have to do so to correct your own mistakes. The event went over • well; however, the praise given it was a bit too lavish. My Jetter · has been misinterpreted as "smacking with jealousy," yet I work for the students, not for self-recognition. Because individual efforts are merited differently, I cannot compare my job energies to Colleen's. As a result, I am not jealous of Ms. Editor-In-Chief Jim Edwards ( . Gries, because we work for two different causes; she for the Class of • '81 and myself, for the student body. These are the reasons we were elected to different positions. As Vice-President of Student · Government, I am very much aware of the happenings and mlshappeniilgs on this campus. I get first-hand information, which enables me to objectively compare efforts. I received direct information from Colleen myself, about the "Surprise" mix-up, which I made clear in my previous letter. So, it seems ironic that you "knowledgeable concerned students" could have backed up your criticisms with wrong information! ! ! If positive remarks are to be made, take credit for it; why were you reluctant to reveal your names? If you are willing to make comments concerning another student, make your identity known, so that your actions may be questioned, just as well. you discussed the "controversial letter" by a "Wilkes Alumnus" who "brought out many issues . . . none of (which) were documented and there was no proof along with the allegations.'' Later you stated, "To Eddie White III Copy Editor Patti Sparlow News Editor Peter Steve Op-Ed Editor Perry Lichtinger Asst. Op-Ed Editor Asst. News Editor Margaret Scholl . Louis Czachor Photographer Bob Gaetano .... Advertising Man.:.;er b.siness Manager Sue.Freda Vanessa Martz Circulation l\lananger Michele Serafin Marla Brodsky 'Between The White Lines' Provokes Reader Response To the Sports Editor: In your February 14, 1980 column Sports Editor Managing F.ditor BillTurcan the person who wrote the letter, we say you're a jerk and you're probably lying about being an.alumnus at Wilkes." I am curious to know if these issues are documented, and if you have any proof -of your allegations. I welcome your reply. ¥ Wasilewski . REPORTERS: Cindy Ercolani. Lisa Gurka, Mary Kutz. Sue Loveitt. Gary Mack, Bill Miller, Rich NordJieim. Ana Nunez. Mary Kay Pogar. ·Darlene Schaffer. David Stahl. Advisor George Pawlush T Parrish Hall Ui S. River St. Wilkes-Barre. Pa. 1117M Plllllillled weekly d■rlng the school year frem September te May except f• vaea&IN periods ud aemester breaks. Entered as sec:Nd clau ,-&age paid la WUkes-Barre. Send f«m no. 3571 lo The Beacoa. Wilkes Cellege, Wfllrel.Barre, Pa. 1117N. Slllllcrlptioa rate to D011-sttNlellt1: S-1 per year. Affel'tlliq nte: per celam■ lach. .. . Plleae: (717) 12-1.-SI, •;xt. -173 · All views expressed are tJlole ol tJle individual writer and aot ■eceaarily .,. . ,-Bca&lell., Ille ane,e. n.se l �• • . , February 21, 1980, The Beacon, Page 5 Sets Sights On Teaching Career•·••.•···································~···································~· Cardillo Active In Campus And Community I . imagine · walking into a classroom to observe students that you will be teaching for 11 weeks and finding the little darlings in one of their rowdiest moods; probably a thought going through your head would be what have I gotten myself into. This is similar to what Ann Cardillo, a senior from . WilkesBarre, experienced a few weeks ago. ' Upon graduation Ann will receive a Bachelor's Degree in both Education and History and also will be certified to teach the social sciences in any grade from kindergarten to 12th grade. Anyone pursuing a double major has their work cut out for them; but to also be involved in most everything on campus as will take a great deal of time. Among Ann's activities are: Student Government, where she is the only commuter serving on the body; vice-president of the Education Club; secretary and .financial treasurer of the National Historical Honor Society; Student Aide in the Engineering Dept. ; an active member of Theta Delta Rho Soroity; and is a chairman of the Red Cross Variety Show to be held in April. "There are some weeks where I have a meeting everynight; I complain but I also enjoy it very much!" Ann said, •~•m nosey and I like to know what's going on! " She was recently involved with the Winter Weekend Olympiad where she coached a team of commuters. Ann gets a certain degree of satisfaction from teaching and it is understandable why her students are very responsive to her. Ann's smile shows the caring and patiene it takes to teach small children. Ann has been involved in several praticums and also teaches Sunday School. "It's so great to see the smiles on their faces when they accomplish something," the popular student commented. "I have a special philosophy of education which is that a child is born with a naturalistic ability; my job as a teacher is to try to fulfill these abilities," Ann continued, "I have to try to help them reach their full potential through the use of multiple teaching methods." She also feels that she must give them respect in · the same amount that she expects from them. Reflecting back on her first en- . counter with that unruly class, she thinks teaching them will be a "challenge and a half." She stated emphatically, "Maybe I can be a probation officer after I'm done with this class." By listening to Ann for about an hour it is evident that her first love for a career choice is teaching. Saying with pure sincere- ty and an undying smile, "I really want to teach. I like kids and people in general. Teaching is a very exciting and rewarding career.'' Ann is quite active in local politics in addition to all her activies on campus. She recently was on the committee to re-elect the an all consuming desire to go into the theater, or be a theater person." He thought "I'm 18 years old, I'm in no hurry to grow up, I want to be here and now, seeking fulfillment, and exploring it." As a student, Paul had a unique role in the development of theater Paul Kerrigan I department here at Wilkes. "When I came, there was no theater degree or major so to speak of." Many people told him that he might be better off at another school. However, Paul believed "the atmosphere was right for development." Since that time, enough to be involved with the creation of the theater major." He believes ,the theater degree program grows stronger each year and it is a good department. is her guide off-campus. Oddly enough, her nickname among friends is "mom," because she is always there when someone needs to talk. Why is Ann always there, very simply, "I care about my friends very much," Ann stated. True to Ann's smile, she is a very optimistic person. "I always try to look at the bright side;_there has to be sometldng good happening as well as bad," the smiling co-ed explained. "I'm a procrastinator when it comes to school work; I'd rather be running a meeting. When it comes to reading materials, I'd much rather be talking." In closing, Ann knows that a teaching career is going to be hard work but feels that it is worth it. In her search for a job, Ann ideally would like to stay in this area and feels going to far away would put a strain on her close family ties. Knowing Ann, it would benefit everyone involved if she stays as close as possible to this area. . . ,e~!l'h.. • .-- ._,,,·. (,~'<>. -···" " ·~-- . Margaret.Scholl three Wilkes-Barre councilmen. "I like politics, expecially American. I really like to talk politics." Currently keeping her hand in politics, she is working to get Kevin Blaum elected as State Representative. one can at~ays count ·on Seasoned - Performer Kerriga•: 'Caesar,,_'Teddy' And 'Vladinair' Waiting for Godot has been Paul Kerrigan's occupation for quite some time. Paul is a senior theater arts major and will perform in this play starting tomorrow. Dr. Leonard Powlick, an assistant art professor in the department of language and literature, directs the well-written Samuel Beckett play. Other actors featured in this play are Chris Lonstrup as Estragon; John Chervak as Lucky; Larry Barrett as Potso; and Tara Buckingham as the boy. The play, although fast paced, takes place without an. abundance of props or performers. Pauls acts the part of Vladimir in this production and has performed in many other plays at the C.P.A. You might recognize him as Caesar in George Bernard Shaw's Caesar and Cleopatra or Teddy in When You Comin' Back Red Ryder. In addition to a full load of school work, Paul rehearses over 15 hours · a week. Although Paul has firmly established himself as a very good actor, he originally started his college career in a major far removed from the theater. Originally enrolled and studying at another university, Paul had "the opportunity to come here because-the door was open and the people were friendly. I knew where I was at, Navy ROTC and business, was not where I wanted to be. I did not want the security of it, I want to make some mistakes, gain some control over my living." In high school Paul had performed in several school productions and further developed his talents working summer stock with his older sister. In spite of this, he says, "it wasn't Ann being there as a true friend to help; she has been helping Donna Grontkowski in her quest to become a state delegate to the National Presidential Convention at Madison Square Garden. "I've constantly been involved with politics, " Ann· stated, in reference to being senior class president in high school. "I like to see what happened in past politics and compare it to the present and future." Ann continued on another subject. "I guess I've always considered myself a women's Uber. I feel that the family shoula be joint, the husband and wife should WQrk together but I also believe in the Importance of the mother." When it comes to women being drafted, she thinks that they will probably not see combat duty but will be put into clerical duties. • Ann also considers her friends on campus to be very influential towards her but claims her mother Like many actors, Pauls (eels most comfortable when performing on the stage. However, his talents are not confined only acting. He has been playing the piano since age seven and lately, he has started directing plays. "As far as compos1 ing things, writing things, I don't have the discipline. I would rather take what someone has given and perhaps give it some shape, and my own imput to it, I think there's some value to that." He says, "That's way I like performing better than writing ... it's a temporal thing, if I make a mistake, I have to go on." Paul's musical abilities complement the acting side of his personality. He is better able to interpret sounds and follow the tempo and rhythm of speech. Paul states, "the theater is for everyone and it's all give and take." A close interaction exists between the performers and the audience. "Each performance will be different because one can never capture a moment." The audience will be an integral part of this play because Beckett constantly alludes to the audience and to their existence. Paul Kerrigan, besides being pleasant and inquisitive, is a talented individual who has come ·into his own here at Wilkes. He works very hard to improve and refine his talents, and eagerly shares those gifts with people around him. To put it quite simply, he describes it as "a labor of love. " . I can hardly wait to be part of this year's performance. In the meantime, I'll be Waiting for Godot. '· David A. Clanton /, .,,, . ··•·•···· ............ .········· Greetings Everyone!!! ........ · It's here!!! It's here !!! It finally made it! At first I wasn't sure so I . looked it up According to Webster - "Solid precipitation in the form of white or translucent ice crystals." Yep, that's it. SNOW!!!! The Great ' Spirit knew sooner or later Mother Nature would get at it. She's even promising a foot for·Easter. So what if it's a little late. Enjoy!!! Enjoy!'!! . The Great Spirit dropped by the Valentine's Party last Friday. All seemed to be going well ... except for a little dry spell .. . Plenty of kissing going on, and not just lovers either!!! That was quite a song the band played Friday night. Can you dig it? Can you dig it?? ? Other party bits include . . . why was everyone yelling "trip" when Carol and what's-his-name were doing their thing on the dance floor; it was a prime night for fighting with lover's squabbles occuring with CC couples; who was included in the "Dallas Gang" who went to get their bottles before the party? Keep smiling at the clerks, M.G. :,Virginia was sure having fun with a freshman and other guys at the get-together make any enemies. Wheezy???? Who was the silly couple that laughed through the slow romantic con.test song? Congrats goes to CC and IDC for another great party! ! ! Speaking of CC, the Great Spirit heard that a certain CC president like chunky peanut butter with raspberry jelly with seeds of course! ! ! I'll be trying to explore the tastes of the other presidents in the upcoming weeks. · The Great Spirit thinks this petty letter writing -that's going on is absolutely DUMB!!! Leave Colleen alone!!! She's doing a great job and just because other people are not working up to par they have to try to make her look bad!!! Well, this is a warning - there's no way to make her look bad!!! Belie~e it or not, Spring Vacation is almost upon us ! ! ! One more week to go. It Joesn't seem like the semester's almsot over already. Time sure flies . . . ! ! You know what this means? Look out mid-terms!! ! Seniors, do you realize you'ye been through 71/z long semesters? Only a few more weeks! Hope everyone enjoys their week off! Whether you're in Florida soaking up the sun or up here in the cold North catching up on work you've put off until now, have fun! !! The Great Spirit sure will. It's a much needed vacation for me! ! ! Till next time!!! Watch for me! ! ! \ · : .····••·•·•··· ~ ·············· �Page 6, The Beac!>n, February 21, 198() New Anthropology Profeaaor -------------------------------------- SIUSS er Enjoys International Study Does the name M. Catherine Slusser ring a bell? Is she the prime minister of a foreign country? Or, maybe a famous scientist? No. Actually, she ls the newest member of the Wilkes College faculty. The Department of Anthropology . hired Miss Slusser over the semester break to fill the post vacated by Dr. Demory who left to continue her research. At the moment, Miss Slusser is teaching only two night classes but, her hopes are to take on a full -load as soon as possible. Until a full-time position is offered, Miss Slusser will continue to live in Binghamton, N.Y., where she is presently working towards a Ph.d. in Anthropology at the state university. In 1971, Miss Slusser rec~ved her Bachelor's degree from the College of William and Mary, and in 1973 .she earned a Master's degree from New Mexico State University. Both of these degrees were in anthropology. Her previous teaching experience includes a teaching assistant position while at Binghamton, and various summer school courses. She has been giving guest lectures · here for the last two and a half years at the request of Dr. Rasson. As an anthropologist, Miss Slusser's main area of interest and study is spacial cognition, which studies the way people think about, organize, and use the space around them. The field is a very narrow · topic but, it overlaps with many other fields, such as psychology, sociology and architecture. More specifically, Miss Slusser has been studying the spacial cognition of Mayan communities, in detail, who are the direct decendants of the pyramid builders in Mexico. - As part of her education, Miss Slusser traveled to Yucatan, Mexico, and spent a great deal of time living with a studying the native culture. Miss Slusser stated, "The trip was an extremely rewarding experience for me. It gave me the chance to be isolated from the culture I grew up in." She continued, "Anthropologists need to step outside their culture in order to better understand other ways of · life. The science stresses crosscultural experience." As far as future research plans are concerned, Miss Slusser plans include a return trip to Mexico for. a follow-up study. Plans are being made to conduct a joint study with an archeologist who will look at.the material aspsects of space, while Miss Sluss~r looks at the interpretation of these patterns. The goal of this effort will be to develop a more realistic approach to the study of foreign space use patterns. Miss Slusser noted, -"There are very few places in the world that I woilldn't want to go. Yucatan is a very beautiful place and I'd like to return. AI so, I'd like to visit Australia." When asked how the Wilkes Department of Anthropology compared to the other institutions she has attended Miss Slusser replied, "This is the first place where the Anthropology and Sociology departments were combined. All the other places have had a separate Anthropology department." She added "It's really interesting to work with the people from the Sociology department although I'm not used to it." "I'm somewhat disappointed that there isn't more emphasis on Anthropology here because, the T.)CK=:Mte:::::xMaggie Says• response from the students has been good." Miss Slusser stated, "I would find it exciting to be apart of an expanding program if possible.'' "So far, 1'1te enjoyed the classes I have;" Miss Slusser said. "The students seem to be interested in what we're doing. They are lively and like to ask questions which I feel is good in developing a strong relationship between the teach~r and class." The only problem Miss Slusser says she has come across so far is the fact that her classes only meet once a week. Her comments were, "Meeting only once a week leaves little time to really develop interaction, but we've don~ well so far." Although Miss Slusser has very little leisure time, her favorite hobbies include reading, creative cooking, hiking, and sewing. She stated, "I'm definitely not domestic, but cooking and sewing are things where I can be creative. I like reading science fiction and fantasy but, I'm really a dungeon and dragon addict. '' -- ·what,S Happening -- ► ➔- kk - The REGIONAL SCHOLASTIC ART AWARDS EXHIBITION will be in the Sordoni Art Galle!"Y from February 13 through March 9. The Student Government Film "High Anxiety" will be shown Friday, February 22 at 7 p.m. and 9:30 p.m. in Stark Learning Center 101. The Wilkes College Theater Department will present Waiting for Godot by the Irish playwright Samuel Beckett on Feb. 21 at 7:30 p.m., Feb. 22 & 23 at 8 p.m. and Feb. 24 at the Center for the Performing Arts. On Wednesday, February 27, the Concert and Lecture Series will present Malcolm Forbes, Jr. He is senior editor of FORBES Magazine and will lecture on the Business and Economy Today. :I'he lecture will begin atsp.m. On Tuesday, February 26, the Music Department will present a performance by the Wind Ensemble under the direction of Jerry Campbell Dorothy Dickson Da~~~e~~~he Performing Arts at 8:15 n:~:e U:LivaOn will February 28, a piano-cello recital by Herbert Garber and Enzo be in the Dorothy Dickson Darte Center for the Performing 1 1 Arts beginning at 8:30 p.m. : Dean Arthur Hoover will be speaking on "What's New On Broadway," Monday, February 25th. The lecture will begin at 8 p.m. in the 'Stark Leaming Center Room 1. "What's New On Broadway" is open to the college and community free of charge. k Mk ➔- -- - Now comes·Miller time. �February 21, 1980, The Beacon, Page 7 'Angel Street' Tryouts Set; Third Production Of Year Preparations For I.aw Sclaools; Wlaicla Majo~s Take Tlae I.SAT? When people think of fields which ~ for graduate school train/ng,one of the first which comes to mind is law. Many people assume that colleges train students for law school by giving them a barage of pre-law courses and offering them as much back ground in law as possible. Philip Tuhy says, "Wilkes does not really have pre-law courses." According to him the law schools do not recommend students to take many pre-law courses in college. In fact because of the nature of the Law School Admissions Test (LSAT), prior law experience may be a hinderance instead of a help. The LSAT is a test which measure a persor!' s logical reasoning ability and reading comprehension skills. According to Tuhy, the job of a lawyer is such that the law schools are interested in people who have the ability to reasolt' logically. In effect, law is a discipline based upon logical choice and the LSAT are geared to test people on these logic skills. Tuhy states, "To take the LSAT one must answer questions within the context of the facts which are given in each question or problem. A person who has had pre-law courses in college may be persuaded to select a logic~l answer based on this background and not necessarily on the · information given in the question." This personal knowledge may cause the student to choose the wrong answer, which may be logical in his eyes but incorrect by the information given. It seems that there is no one major whose students take the.LSAT; in fact, students from all majors take the tests. Tuhy states that, "English, science, political science and communtiy development majors as well as other Wilkes graduates have taken the LSAT and gone on to law school. These people had the logic background and the reading comprehension s!cills necessary to get into law school. " Preparation for the LSAT is difficut as there is no real way to study for them. Tuhy suggests that the only way to prepare for the test is to take courses in logic, improve reading comprehension skills and REACH OUT Phone Toll-Free and talk to former volunteers about' Peace Corps and VISTA (800) 452-1589 X-2 (Pa. only) (800) 523-0974 X-2 (Md., W. Va., Delaware, Kentucky only > Peace Corps and VISTA will be standing by waiting for your call about what's happening now. Peace Corps volunteers serve 2 years in a developing nation of Africa, Asia, Latin America, or the Pacific. They help people of emerging nations meet their basic human needs. To qualify, volunteers must be U.S. Citizens, motivated to serve, and have a usuable skilf. Students with backgrounds In Education, Math-Science, Health fields, Business and Economics are especially needed. Benefits Include paid living, travel, and health expenses plus a $3,000 readjustment allowance after completion of 2 years service. VISTA (Volunteers In Service To America) volunteers serve 1 year In poverty-related programs In the United States, and Its territories. They work in Health, Housing, Consumer Affairs, Business Development and other -- ~-,;i. Their main thrust is to Identify community an · eighborhood leaders and help organize coalitions to combat problems in low-Income areas that • hold Americans down. • VISTA volunteers must have a usuable skill. Students with backgrounds in social services, social work and legal training are especially needed. By phoalng loll free (800) ffZ-1589 X-2 (Pa. oaly> and !800) 523-ff74 X-Z <Md., W. Va., Delaware, Kentucky only>, yoa can learn more about Peace Corps and VISTA It's a number that could change your life. The theater department is preparing for the next production, "Angel Street," directed by Jay Siegfried. The play is a mystery thriller which deals with a man (Mr. Manningham) who is torturing his wife to insanity. The mystery game begins when a police inspector tries to uncover the necessary evidence ·against Mr. Manningham. Siegfried chose to do this play for several reasons; the cast is small (seven roles) which u1akes it easier to find enough good people to fill the l'(.:es. The production will be a period piece set in 1880; this gives the students and faculty a chance to do some research on costumes, sets, props, and attitudes of the .-time. The play requires a box set which is a three walled set with an imaginary fourth wall. "This kind of a set has not been used at Wilkes this year,'"Siegfried explains, "this should provide the audience with a different perspective than the last two productions. '' "Due to the fact that the play is a suspense thriller the atmosphere is important. This means that the set design, lighting, costumes, etc. play an important role in the production." Siegfried explains. "It is the kind of a play that most people think of when they think of plays," he added, "It will make use of the curtain which hides the set from the audienc!t until it is raised, thus lending an air of mystery to the play.'' He believes the play will be very demanding for the actors. "The play takes place in 1880, which means that the actors will have to do some research into the different attitudes and values of the time. The on stage behavior must coincide with the actual behavior which people had about 100 years ago.'' The play ·was originally presented under, "Gas Light" and has been a success in most of the places it has been performed. "It is escapist's theater at its best," Siegfried adds, "It is a mystery . thriller which does not take itself to practice at taking multiple choice tests under the pressure of a time limit. He further states that many graduates who take the test for the first time do not do well because they are not accustomed to the time pressure of the testing. However, students increase their scores on an average of 30 points the second time they take the test. Wilkes graduates who take the tests increase their scores from 60 to 90 points. Once the students adjust to the time limit factor, they are able to do better. Of the Wilkes graduates who go to law school, the majority of them complete the schooling. Tuhy adds, "Wilkes has a good reputation with many law schools such as Temple and Vilanova. Once our students are accepted there are few who have dropped out." The criteria for acceptance to law school varies from school to school. Some schools look for a maturity factor, this is to say they accept older students to balance out their enrollment. Some schools try to balance their enrollment by geographic distribution. "In these cases" Tuhy states, "those who are from a certain area of the country and apply at the right time get in with very little trouble." Wilkes does not have many records on the success rate of graudates who have gone to law school. It seems that few of the graduate students communicate with or authorize the schools to send records to Wilkes. Tuhy is trying to find some one to update the college records concerning these graduates. He says that some of the political science majors as well as some of the community planning majors go on to law school. But many of the graduates from these fields go into community service and political offices on the state, local and federal levels. Tuhy agrees that this lack of updated records on alumni from these and related fields could cause the college to loose a valuable recruiting tool for prospective students in the future. Bill Turcan Chuck Robbins... SPORTING GOODS COMPANY 1 NOTICE Nominations for class officers for the classes of 1981, 1982 and 1983 will he held next Tuesday, February 26. Announcements concerning the exact time and the loca-_ tion will he posted. We Accept Master Charge and Visa 39 West Market Street Wilkes-Barre, Pa. 19701 Phone: 822-1333 Free Parking at Hotel Sterling !ATRICK BY~~E, ~ne! NOTICE Tryouts for "Angel Street" 'will he held Thursday and Friday, Feb. ZI and 22, from 6:30 to 7:30 in the · chorus room of the CPA. All Wilkes students are welcome. BillTurcan Parenthood Consultation Now Available On occasion, the college has worked with local agencies to provide a sense of community and continuity for the student body. Planned Parenthood Association of Luzerne County in cooperation with Wilkes has started a new service available for the entire student population. Along with other area · colleges, Wilkes now has a student who will act ·as peer counselor to aide students in obtaining information, referrals, consultants, films, literature or just "someone to talk to" in regard to problems concerning sexuality. The objective was to create a program for college women which will increase their awareness of the need for good reproductive health care, including, as appropriate, preventive examinations, contraception, nutrition education and prenatal care. However, this program is not exclusive to women since it is important that men also understand their roles in regard to reproductive health care. Shawn Murphy, coordinator at Planned Parenthood, piloted the program. Although the college is cooperating in any way possible, the peer counselor is under the direction of Planned Parenthood. All contracts with the peer counselor as well as Planned Parenthood, are strictly confidential. Mary Ellen Wright, a senior nursing student, is the campus peer counselor. She is availble on campus Monday through Friday or can be contacted through Jean Reiter at the Housing Office. If you, your group, club, organization, dormitory or friends with further information, contract Mary Ellen or Shawn Murphy at , ,824-8921. Book and Record Mart 10% DISCQUNJ OFF ANY ·PURCHASE WITH THIS COUPON too seriously. The genre for this play is close to that of the television series Columbo." The villain is indeed nasty and was once played by master bad guy Vincent Price. Tryouts for "Angel Street" will be held today and tomorrow (Feb. 21 and 22) from 6:30 to 7:30 in the chorus room, basement of the Center for the Performing Arts. All Wilkes students are welcome. Anyone who is interested but is unable to meet at these times can contact Jay Siegfried at ext. 392 to make other arrangements. II ·1 .I 11 S. Main St. WIikes-Barre -BOOKS-RECORDS-TAPES 125-4767 Cliff and Monarch Notes �Page 8, The Beacon, February 21, 1980 Space Utilization: Part Two, Architect's Suggestions developmental objectives." The projected results of ti$ part of the plan are the consolidation of a physical plant, Improve coherence, strengthen and economize functions through relocation and regrouping, and the reduction of maintenance costs. An appendix and a map accompanying this section help explair) each phase in greater detail. · According to the dormitory action plan in the study, "New dormitory construction will meet Immediate needs, long range maintenance, and econ:omy. Renovation of some existing dorms remains a necessity." Two major priority alternatives for the construction of new dorms are the Northampton Street site which allows immediate action and will replace maintenance burdened structures, and the West South Street site with its prime location in relation · to general facilities. Options for problem .dorms include two priority disposition plans for high cost and maintenance buildings, the phasing out of some dorms such as Gore and Dana Halls for parking, and the rehabilitation of some existing dorms .such as Sturdevant, Waller, McCiintock, Catlin, and Weiss Halls. It should be noted that "Other remaining dorms may also respond well to rehabilitation" although these will "require a later decision, as events unfold corresponsding conditions.'' Historic building preservation 4 5 6 1 8 9 lO 12 ll 16 21 2) 25 ST~RL ING HL CATLIN KAL L STARK LRNG CHASE HALL J<lRBY HALL BEDFORD HL 26• STURDEVANT 29 . WECKESSER JO WECK SSR ANX ll CHURCH HALL WEISS KAINT C0N YN EVANS 36 31 38 PARRISH EQUIP STOR CHAP~ CUI DANCE CAREER PLNG Mc CLlN TOC)( HALL 0F'r AN X A LL':"tN ,. HOLLENBACK GYMNASIUM GORE HALL DINING C"O IN 40 41 42 4J . ., 46 48 50 51 '2 53 SUSO HALL WALLER HALL FIELD HOUSE McBRIDE FH DART£ C PA SHAWNEE HL CHESP / OEL PRES RE S ROSS HALL ROSS GAR DA NA HALL PI C JCERfNG ing and green links, it is pointed out that requirements such as growth potentials and consolidation are needed to assure a successful redevelopment program. Growth potentials for this plan range from new dormitories to a relocated maintenance facilility, while consolidation techniques.. include such things as demolition of specific; structures and the utilizationof existing and off campus buildings. Some of the long and short range development principles discussed in this chapter include the reinforcement of pedestrian links, a major parking area on River Street· to serve Darte Hall, dey_elopment of the Church Hall-Library area, . establishment of a green space behind Conyngham Annex, and the construction of green space in the center of blocks while new structures conform to the regular streetfacade pattern. Under the heading of cost . 55 56 58 59 60 61 64 70 71 74 75 FARLEY LIBR 280 FRANKLN SLOCUM HALL FRANKLIN HL DAR'fE l'tUSlC SULLIVAN HL DENISON HL BARRE HAL L S T RDVNT GAR SLOCUM GA R PRESDNT GAR STERLNG G AR 17 18 19 80 8l 82 83 . 90 91 92 93 ICOCYAN HA LL BUTLER HALL DOANE HALL MINER HALL CONYN GAR KOC:YAN GAR CARPNTR SIIP RALSTON l-'LD NURS I NG CONYNGHAM CARR1G£ IISC BEDF'0RD C.AR Improve movement and utility and to enhance the aesthetics and coherence of the campus core." Phase one, which is expeceted to strenghten relationships and in, crease the number of usable classrooms, ranges from the relocation of student activities into the new Student Center, to the regrouping of functins in recovered space. Phase two calls for the implementation of computerized scheduling and a space management system, and the increased utilization of instructinal and administrative areas. It is hoped that these two goals will result in the "Establishment of minimum and maximum space requirements." The final phase of the action plan seeks the transferring of activities from poorly utilized and maintenance prone buildings to the newly freed space in Stark Hall, along with the recycling of "abandoned space to meet economic or PYROS• SANDERSON • •tltltec ll - •• ·fln e r1 e fle •e1,1 lfl 111 e i11 • h ••I . ,1 .... . ..... . . .... . 11 10 1 ( plans reported in the planning · study aim at utilizing building resources, while recognizing the areas heritage. It is noted that because of incentives available to public and private institutions, it is becoming profitable to practice preservation. Attempting to determine the distinction between old and significant structures on campus, the following concepts were tatten into consideration; federal, state or local , agency recognition,quality and ar· chitectural value, location and campus identity importance, economical use, and long term (projected use) and adaptability. Once a building has been evaluated for its "utilization value, operating cost, and historic significance, and change is imminent," three types of preservation my be used. Restoration attempts to "achieve historical accuracy and preserve architectural integrity," adaptive reuse provides "for functional needs rather than historic accuracy" although "The 'historic aspect' is retained," and conservation suggests preventive maintenance for "all structures which have a useful life expectancy." Other developmental alternatives include; conversion (necessary when a radically new use of a building is proposed), disposition (the sale ofproperties), and demolition (" if a structure is relatively unimportant architec· turally and historically, deterioration advanced, the practicality of reuse marginal and the land is valuable. )" It is pointea-out though that demolition should not be used "except in instances of extreme hazard or conditions of health." · After discussing four topics important to the preservation and development of older buildings;roof repair-restoration, energy conservation, code enforce- . ment, and cleaning, refinishing, and water -proofing, the section finishes with a general summary. In the summary, it is statedthat because of recycling possibilities, old buildings may prove to be a resource of substantial value. The study continues to say though that because of pressures to consolidate the campus and reduce maintenance burdens, many structures including a few 'historic properties' will have to be sold. It stresses that restoration work on these properties should continue since the importance of these buildings is acknowledged, with special requirements of new owners to respect and preservethe structures. The third and final ,part of the Space tJtilization and Planning Aid series will appear in next week's Beacon. PeterSteve epare For April Exams! LSAT • MCAT • GRE GAE PSYCH • GRE BIO GMAT • DAT• OCAT • PCAT VAT• MAT• SAT NAT'L MED BOS ECFMG • FLEX • VQE NOB • NPB I • NLE ~-flMPIAN EDUCATIONAL CENTER le~t Prep.nation Sper1.1l1~h Since 1938 Please Call Collect for lnformatio,:, . (215) 435-2171 Masonic Temple Bldg. 1524 Linden St. Allentown, Pa. 18102 Classes Formin Now! �February 21 , 1980, The Beacon, Page 9 FOUR WOMEN AID WILKES SWIMPROGRAM Co-ed sports are on the upsurge throughout the nation and at Wilkes. Four women are making their contributions to the success of the college swim team. The Blue and Gold swimmers are enjoying one of their finer seasons, sporting a 4-7-1 record with the coeds playing an intricate- role in helping the team achieve their mark. First year coach, Bob Greenwald commented, "They are an added dimension and although they are in some difficult events they are doing well." Coach Greenwald, a reputable swimmer himself added, "I thought they would just gain the experience and prepare for MAC's, but they have helped the team by winning relays and made the difference in winning two meets this year.". The coed .competitors are freshmen Kim Bush and Peggy Butchkavitz while sophomores Michelle Maguire and Megan Caverly are in their second season. Greenwald believes all four girls are capable of winning Middle Atlantic Conference (MAC) titles and pointed out that the men and women will be .separated. . K1m, a graduate of Abbington Heights, started swimming on the competitive level when she was just 7 years old. While swimming for the ©[L~@® ' @[p 5)@@ Grasp ~. -/ Your Future. GRADUATE SCHOOL The University of Scranton One of Twenty• eight Jesuit . Institutions of Higher Learning. offering courses in: art education music education business administration english (thesis and non-thesis) american history and politics history (thesis and non-thesis) chemistry physics general science elementary education secondary education elementary school administration secondary school administration solid state electronics reading rehabilitation counseling counselor education A variety of Correlated Programs are also available in Secondary Education. (NOTE: graduate level course taught at night) September 2 ,3 ....... .. .. . regis1ration September 3 .. . ....... semester begins For information on the U of S GRADUATE SCHOOL Please call (717) 961-7600 or write: GRADUATE SCHOOL OFFICE University of Scranton Scranton, Pa. 18510 Comets of Abbington she plar.P.d or swim teams tn her area, they fifth in the 500 yard freestyle and went to these places to swim qualified for the PIAA state chamagainst their club teams. Megan pionships. Kim will be vying for won second places ln the IM ( inMAC honors in the 200 fly, 500 free, dividual medley) and the 100 100 free and the medley relay this breaststroke in league competition weekend. Kim and the coach, both while her team was the league agree her strongest event is the 100 champions. The IM is a combinafree. tion of all strokes - butterfly, back, "It's hard swimming against breast and free. guys but it makes us try harder," Megan also noted, "coed prac. said Kim who comes from a family of four girls. All her sisters are topnotch mermaids too. Peggy is an alumni of Pittston Area High School and lives in Duryea. She was a fourth-place finisher in the PIAA District II . finals in the breaststroke. He best event on the collegiate level is the 200 breaststroke which-she clocks a respectable 2:44.6 time. "It doesn't matter to . me whether it is separated or coed," noted Peggy. Peggy will enter the 50 free, 100 and . 200 breaststroke and medley relay events in the MAC tournament. She Kim Bush is hoping to reach the finals in these events and Greenwald thinks she can win. Peggy has two brothers who compete in swimming also and says they all got started with the Y team she represented in a state tourney a few years ago. Michelle, a sophomore from Wilkes-Barre · graduated from Meyers High School and comes from a family of swimmers also. In fact, her sister Maureen, who is now a doctor, was one of the first girls to compete on the swim team at Wilkes. Her older sister, Melita, also swam for the Blue and Gold, while her sister, Megan, is a senior Michele Maguire mermaid at Meyers. While at Meyers, Michelle won district honors in the 100 yard butterflytwice.Inherjunioryearshe ., placed first and had to settle for a · runner-up spot during her senior year. Michelle qualified for the PIAA State event twice and explained, "It's a big thing to go to The swim team winded down its state's around here, but when you get there it's hard not to get lost in last week of action with a win over the crowd.'' She was also a member Utica while suffering loses to of the second place relay team in Binghamton, Susquehanna and East Stroudsburg. The final season the district tourney. Michelle began her swimming record stands at 4-7-1, a vast imcareer when she was only five provement over last season's 0-11 years old and swam competitively. tally. Dave Gergen, Reed Bello and She has come a long way since then, and is setting her sights at an MAC Jim Edwards each took two firsts in title or titles in the 100 and 200 yard the contest against utica last butterfly. Michelle noted, "Swimm- Wednesday. The score of the meet ing th.. same distances and training was 73-31 and was held with with the guys is an advantage Binghamton as a tri-meet. because we try harder and in the Vs. Binghamton MAC's we will get the opportunity The meet against Binghamton to swim shorter distance then re- was not as easy as Utica was with quired in the meets." Michelle -.Wilkes losing 66-38. doesn't care if she is competing Again Gergen, Bello and Ed- · against a guy or girl, her objective wards were the only team members ls to win. to pull any first places towards the Megan Caverly is a sophomroe side of the Colonels. swimmer for the Phillipines and the Vs.Susquehanna popular question is, "How did you Swimming at borne last Saturend up in Wilkes-Barre?" Megan day, the team from Susquehanna answered, "by default," but then was just too tough for the Colonels added she was happy with her and won by a score of 57-44. choice. She sent out many applicaMagure in the ,ro yard butterfly tions to prospective colleges but and Rob Doty in the 200 yard was victimized by a mail strike. breaststroke were the only swim'she didn't have any regrets about mers who captured firsts for the · coming to Wilkes which ·was sug- Blue and Gold. gested by her grandparents who Besides Bello's first in the opreside in Shickshinny. tional diving event the SusquehanMegan attended George Dewey na squad dominated the entire High School and was afforded the meet. chance to swim against teams from - Vs. East S&roadsburg Guam, Hong Kong and Manilla. In the last meet of the season, the Since there weren't many schools swimmers from East Stroudsburg s see tices are fine but I would like to separate heats for girls only." Megan said she was frustrated at first, since she knew that she could work very hard and want to win but lose to her co-ed opponent. But will wait for her chance in the segregated MAC's. It's a family affair for Megan also, as both her brother and sister are swimmers. Bob Gaetano .,,i~I V Peggy Butchkavitz Megan Caverly <- . ' f mmers D own, ut f ca, E D. d season A t 4 - 7 -·1 ~"· . ,, won big over Wilkes this past Tuesday in the King's Coll• pool. The final score was Wilkes 30, East Stroudsburg 73. The 400 yard freestyle relay team of Moffatt, Ratti, Edwards and Gergen was the only winning event for Wilkes. They clocked a 3:39.2 for that relay team's personal best all year. Second place fini$1les were made by Moffatt in the 200 yard freestyle, Gergen in the 50 yard freestyle, Edwards in the 200 yard individual medley, Bello in the required diving, Maguire in the 200 yard butterfly and Doty in the 200 yard breaststroke. To say the least, Wilkes has had better showings but the Colonel swimmers have their eyes aiming toward the MAC Championships this weekend at Ursinus College. Coach Bob Greenwald Is planning to have the best showing ever for a Wilkes squad at the championships. With the work the team has put in this past season, many should reap the benefits. Maguire and Butchkavitz will be names to watch in the events for women. Both are tough competitors and will show their true colors when they compete solely against women. Dave Gergen and Reed Bello, both freslu:nen, are expected to also tum in fine performances. �Page 10, The Beacon, February 21, 1980 Ladies-Keep On Win~i~g, In Playoffs For First Time "We're really excited about making the playoffs. It's been a long season and the girls have worked hard for it. They deserve it," said first-year women's basketball · coach Nancy Roberts. The girls suffered through a 1-2 week but were Involved In a playoff game on Tuesday with King's College. On Monday night, junior captain Diane Kendig powered Wilkes over Moravian 72-62. Kendig scored a game-high 30 points and added seven assists and six steals. Freshman Joanne Gismondi added 18 tallies while another frosh Stacey Keely grabbed ten rebounds. Senior Mary Jo Frail accounted for six assists as the Colonelettes were never heard throughout the contest. On Wednesdaf: the Elizabethtown College Blue J ays invaded Colonel-land and went home with a 89-76 victory. The game was close, but at the end, Etown outlasted the Colonelettes. Wilkes again was led by Kendig with 31 points. Frail added 16 tallies while pulling in seven rebounds. Gismondi netted 14 in the game to Franklin Street Complex. The winaid the Blue and Gold attack. ner of that game moved on to HunA powerful Juniata squad came tingdon, Pa., to meet Juniata Colto the South Franklin Street lege in the Middle Atlantic ConPalestra Saturday to meet the ference playoffs. King's coach Wilma Schier is apupset-minded Colonelettes. Kendig again was high scorer with 25 points parently complaining about the site Including her l ,SOOth career point. of the contest. According to The magic number came on an ofRoberts, the MAC views the first game between the two schools as fensive rebound bucket. Her efforts were wasted through as Wilkes the MAC tilt. Because the game dropped a 72-55 verdict to teh 16-1 was played at King's, the MAC says Lady Indians. any playoff game would be hosted by the other ( visiting ) team The Colonelettes tried to play catch-up all game but the taller meaning Wilkes in this case. You might remember Schier caused a Juniata team was just too much. Juniata's only loss of the year came disturbance during last year's tourney. at the hands of Scranton University in a controversial tilt at "Duh U. " On the season Kendig has scored Keely grabbed seven rebounds to · 536 points in 21 games for a 25.5 average, good enough to lead the · lead the Blue and Gold. "We've had a lot of games recently, " said nation! Seniors Frail and Yedlock Roberts. "I think the girls were a have tallied 417 points between little bit tired this past week and we them. Yedlock is tops in rebounding with 219 followed by Keely with 172. hope to be rested for any playoffs.'' In assists Frail has 70 while Kendig King's defeated Upsala Sunday at the "big gym on North Main . has dished out-65. Street" to earn the right to play Gary Mack Wilkes Tuesday at the South 111111111111111111111111111111111111111111111111 St ace y Keely 11111111111111111111111111111111111111111111 Colonels Pass Victory Total Of Year Ago This past Monday's Wilkes College men's basketball game with Bloomsburg State closed out the 1979-80 season for Coach Ron , Righter's crew and due to press time, we won't have a report on that game until next issue. On Saturday, the Colonels played well in breaking their six-game losing streak against Juniata College at home, downing the Indians 84-69. Yes, they did play well, but so can a retired-bowler's . team against Juniata. Anyway, it was a win and lifted the Blue and Gold's overall record to 10-11 and they went into Mon: day's game with hopes of a .500 season. 10-11? You might ask what happened to that 12th loss. Because the game was not finished and neither John Reese or coach Righter have heard any official word, the "fight" with Scranton will not count on Wilkes' record. Last year, . FDU-Madison and King's had a similar situation and each team took a win when a brawl haulted the game prematurely. In last week's action the Colonels suffered an embarrassing 84-69 loss at the South Franklin Street Palestra to Lock Haven State. Wilkes was outscored 30-6 in an eight-minute stretch in the second half. Is that anyway to blow a game, you bet it is! , . Kendall McNeil, who played the final game of his career Monday, led W_ilkes against the Haven with 19 points. Mike McCarrie added 17 and Tony Madderi chipped in 15. Madden, playing better than anybody else on the team, also pulled down 12 rebounds. Pat Mccue, who chipped in nine points had four assists as did Madden. Against Juniata, Mccue (what?) led the way with 19 points. It's the first time Mccue ever led Wilkes in scoring in his career as he chipped in 13 or 14 free-throw attempts. The former Wyoming Valley W_est stan- dout who played for Jack Mascioli with the Spartans, is among the MAC's leaders in free-throw percentage. Four other Colonels hit double-figures in the win: Tony Madden 17, Mike McCarrie 16, Kendall McNeil 13 and Kevin Walker with 12 tallies. In the latest Middle Atlantic Conference stats, Mike McCarrie is ranked fifth in scoring with a 17-4 average. Gettysburg's Bill North leads the league with a 19-7 average. Dan Frascalla of King's is tenth 06.0); Kendall McNeil 11th at 15.9. Ray Graff of Lycoming leads the MAC in rebounding with a 12.2 average per game. Scranton's Irv Johnson is second at 11.7 and Tony Madden is seventh at 8.0 with Kevin Walker eighth at 7.5 rpg. Former Pittston Area standout and Dickinson College performer Ed Ward, leads the MAC in field goal percentage with .725. Walker is tenth at .GO'l, Tony Madden 13th (.559) and McCarrie 14th (.557). Through 21 games, the Colonel's overall leading scorers are: McNeil 16.3, McCarrie 14.9 and Madden 11.1. Madden is the top rebounder with 159 followed by Walker (126) and McNeil (117) . Mccue leads the team In assists (112) and steals (49) . "We played with a lot of intensity out there,!' said Righter after the Juniata win. "That's what had been missing In the six previous games.'' Coach Righter had set the wins as bis team's goal for the 1979-80 campaign and it has been reached. Next year, Righter and ace assistant Steve Justice look for 15 wins and a possible MAC playoff bid. They should get it - if they get the necessary recruits. - McNeil went into Monday's game as Wilkes' second leading all-time scorer with 1413 points and a 16-1 career average. Len Batroney, who played from 1950-54, is the school's leading point man with 1629 tallies. Last season, Kendall scored the second highest single-season point total with 492. George Morgan hit for 512 in 1956-57 season. McNeil is a .520 career shooter and .722 from the line through four years. Junior Mike- McCarrie is moving In on the l,OOOth career point mark. Going into Monday's game, the Philly sharp-shooter had 876 points on .503 career shooting in 67 games. A .813 shooter from the foul line, McCarrie averages 13.0 points in a game in his first three years. TIP-INS: Look for Righter to have a super recruiting year ... for the first time in a long time, there are a host of talented seniors in the Wyoming Valley Conference ... we hope must of them decide to stay in the ar~a and attend Wilkes, King's or Scranton. Too many of these seniors go away to school and are never heard of again . . . if your a college basketball nut, EASTERN BASKETBALL III . . . the MAC playoffs open this weekend. Albright should win it over Scranton, but we're pulling for King's and crafty veteran mentor Ed Donohue ... our Maryland scout, says looks out for Mt. St. Mary's <Em- ~ ~ mitsburg, Md.) in the NCAA Division II playoffs. The Mounties of Coach Jim Phelan are having a super year and all starters, including two 1,ooo(h career point men, are underclassmen. That's why the folks in E-Burg are looking for national title in 1980-81 ... probable field for Colonel Classic includes King's, Wilkes, Kutztown State and St. Vincent of Latrobe. Eddie White Intramural Basketball "A" Division Chumlies Crazy Horse Benton Boys A.0.A. CAOS PrepH Champagne Jam "B-2" Division 3-4 2-4 2-4 2-4 Bob-Ballers .Barons Buckateers Skywalkers Sophia's Nemo Bedford 4-0 4-1 2-2 2-3 1-4 1-4 "B-3" Division Whippets Chico's Vets Whippets II Scrap Pack Dartans 7-0 4-3 3-3 "B-1" Division SemBoys Harriers ROTC Diaz Monsoon Eat Them '6-0 5-2 5-2 3-2 2-4 1-6 0-6 N.Y. STYLE PIZZA and SUBS·at ANTONIO'S -SUBS You've tried all the rest, Now try the BEST!!! STROMBOLI Located Right Across the Bridge, in the Narrows SICILIAN· "N UMEKO UNO" "Oven Fresh" Phone 288-7663 or 288-7664 for advance orders 4-0 4-0 3-2 2-S 1-4 0-5 �GRAPPLERS-KEEP WIN STREAK 1N"'TACT" 1 The Wilkes College wrestlers captured two victories last week and will be setting their sights at a new school record this Saturday when Coach John Reese leads the forces to Virginia for a quadrangular meet with the host, Virginia Tech and Richmond. If our Colonels can win all three duals, a new school record of 18 victories in a row will be established. The record was set. during 1964 through the 1966 seasons when the Blue and Gold won 18 straight contests. Richmond shouldn't pose any problems to Wilkes, but Virginia and Virginia Tech boast several Fleetwood is in the 158 slot and was . Billig tie4 the school record of 10 Blue and Gold uniform . Behind the falls in a single season when the scenes, sever4) other Wilkes grap- · 1-linlastweek'scompetition. Dan Miner, a junior from New Tripoli Junior decked his F&M piers are one or two points away Chambersburg won two decisions adversary in 3:55 at 134. The Colfrom a varsity slot. last week, with the F&M bout being onel Blue-chipper now has a dual When upperclassmen are mena 9-8 squeaker. Miner appears to be recoi'd of 16-2 which happens to be tioned, Bryan Billig, Dan Miner, back in top form after nursing his the team record also. Next week Bart Cook, Mark Densberger, Rick leg injury. . Eastern Outlook!!! Smith and Bob Matzelle come to Last, but surely not least, Bryan Bob Gaetano mind. But there is one senior wrestler who put dedicated year's WHIIIIIHIIIIIIIIIIIIIIIIIIJIIIIIIIIIIIIIIIIIIIIIIIIIIIIIUllllllllllHHIIHIIIHIIIIIIUIIIIIIJIIIJIIIIIIIIUIIIHIIIIIIIIHII in for Wilkes wrestling. Joe Gray, from Allentown, doesn't have the statistical records, but any wrestler .will admit that "Spike" played an intricate role in the team's success. In fact, "the fighting pencilneck" can play many different roles and If you didn't notice, Marquette-upset Duke 12 days ago in Milwaukee. knows how to-keep the team going If you read your Beacon four days before the game. we told you the with his antics and personality. Warriors would down the Blue Devils. Loo for Hank Raymond's MU Gray, co-captains Densberger squad to upset Notre Dame this weekend. We feel Sam Worthen is one or and Cook, and Matzelle will wrestle the finest guards in the country, if not the best. their last dual meet in a Wilkes Speaking of big-time colelge basketball. NBC a·nd the NCAA is hamuniform this week, Densberger has mering CBS and pro basketball (NBA ) in the TV ratings. College been suffering from a knee injury basketball is taking over America's as its most favorite sport. There is all season but will be back this week so much interest involved and so many unselfish talented players. for the Eastern's. Cook, Neptune Caught Sam Bowie and Kentucky over the weekend against UNLV N.J ., won his match Saturday by~ and Bowie should become the greatest player to ever play in the college quick 1:09 fall to clinch the Wilkes ranks~He went to a basketball school, where they make good players victory at 177. Creamer wrestled great and great players greater. Recently Dwight Anderson of Kenagainst Bucknell and lost a 14-12 tucky left school and transferred to USC because as he said, "Basketdecision at 177 Wednesday. ball wasn't fun at Kentucky. " That's because he had to work and work. Matzelle, Linderhurst, N.Y., The Wildcats don't need Anderson and should reach the Final Four. And garnered a major decision against to think Bowie has three collegiate seasons remaining. WOW! We saw his Bucknell opponent, but lost 14-7 Bowie last year when he played for Lebanon High School against Bishop 1n the F&M encounter. With Hoban. He was then a very thin, seven-footer. With Kentucky's weightDensberger out, George Cherrie, program he has grown into a strong 7-3 center. Wk Mk ◄k If we had to_make a prediction on the "Final Four" we like DePaul, Kentucky, Indiana and St. J ohn's. The winner ? - DePaul of course. 5 There is a good story on Ray Meyer and DePaul in last week's SPORTS 3 ILLUSTRATED. · If you think fights among basketball teams occur only in Division III, get a hold of this ! It may have been the Ivy League, but when Princeton coach Pete. Carril and Columbia head mentor Buddy Mahar squar red off near midcourt during the second half of their ga me on Feb. I, it was no debating-team exchange. The coaches pushed and shoved each other k Mk midway through the second half of the ga me at Princeton after Carril. Bud's, the Aristocrats, and the appa rently angered at Mahar's coaching, reportedly shourted Avengers all seemd to be getting obscenities at the Columbia coach. Blows were exchanged as both ben-· entrenched atop their respective ches emptied and security guards ( are you listening AD?) were needed divisions as the Wilkes College Mixto restore order. Princeton took the win in a "Completed Game" 77-50. ed League approached the halfway Put'em up? point of the second semester last The Middle Atlantic Conference basketball <men 's) playoffs open this Friday night. Bud's (Doug weekend at Scranton University (boo, hiss). At 7:00 tomorrow night. Williams 198-568) 'fended off the King's College takes · on nationally-ranked Albright College while Mother Brothers and took a twoLycoming fights, er plays Scranton at 9 : 00. The winners meet Saturday game lead over the Brothers in the night at 8: 00 for the title and there is no consolation game. We would like Atlantic Division. The 752 Crew also 11 ~ stayed to see King's wtn it all - especially over Scranton in the finals, but a 'lr.l .. .i.. ~~ in contentfon as they swept realistic prediction is Albright over "Duh U" in the final. But don't Poky's 3-0. Rod Wyffel's big 226-595 Nelson, Richland, N.J ., is enjoying ~nderestimate Ed Donohue's "Miracle Monarchs" who have won eight got the Vets Club I two wins. a fine season and is gaining the 1n a row. Tom Maguire's 213-553 and Jim reputation as " Mr. Draw. " Nelson In a recent interview, former major-league baseball .g reat Frank Mazar's 198-514 helped the shows a record of six wins, two Robinson says he'll never manage in the big leagues again because he is Aristocrats take two of three games losses and (three draws ) at the 142 a black. No Frank, it's because you're a terrible manager. The most pound class. Although Nelson is · from Good News (Norm Rickles valuable player to a team and league in all sports? No, not Dave Parker 212-586). Both the Assorted Nuts really a 134 pounder he has been or Reggie what's his face. It's got to be Larry Bird of the Celtics, the an~ tht. Pack (Stan Freeda 179-466) successful against the bigger opgreat white-hope. remained on the heels of the ponents. He may get the chance to How's this for a great quote: Tommy Vardeman, the assistant basketMidwest Division leading wrestle at 134 if Bryan Billig drops ball coach at Centenary on bench warmers. " Every team needs bugAristocrats despite having losing . a weight class for the EIWA's. gers. Those are the guys you sign up so you can hug 'em after you win weeks. It looks like freshman Kris instead of having to hug the guys who play and sweat." · Rowlette, Nashua, New HampWho is that clean-shaven man hanging around the Wilkes Gym? Why, Atlantic Division shire, will be representing Wilkes in it's assistant basketball coach Steve Justice who recently did away with Bud's Compressor this year's EIWA event at 118. this mustache. You look many years younger now, Steve, around 40, &Supply 12-3 Rowlette, a New Hampshire State right? Mother Brothers 10-5 Champ, wasn't expected to see a lot What about those Wilkes wrestler;? Their having a super year· and 8-7 752Crew of varsity action this winter, but should have a very productive EIWA Tourney showing. Get out and supVeterans Club I 7-8 with veteran Eddie Johnson inport them, the EIWA's are at Lehigh, only a short trip from beautiful Poky's 7-8 jured, Rowlette has respectably Midwest Division downtown Wilkes-Barre. won four matches. · Last week Aristocrats 8-7 Wilkes' Roger Davis was edged out by King's Bob Gib.hon as the Rowlette won a decision at Assorted Nuts 7-8 MAC's top official score-keeper. ''Gibby" really does a fine job for the Lewisburg and lost a tough 74> verThe Pack 6-9Monarchs, while Davis has warned he will be back next year. dict against F &M by one riding Good News 5-10 5 · Most under-rated TV sports announcer: ABC's Al Michaels. Most time point. The Force 5-10 over-raJ~d:SChBS's dbi8gt goo!, BilJkRubssell_. ~hat have former King's §= Yearlings Rick Sampson, Pacific Division cagers 1m ea an eve ....ocm ar een domg lately after leaving the Westfield, NJ., and Pete Creamer, Avengers 11-4 5 _= Monarchs - they have taken up boxing and will be featured on a card in Bellmore, NY, have filled in at the Veterans Club II 7-8 Mountaintop in a few weeks. _ 167 and 177 categories respectively. EE's 7-8 5 Yo~ have to like Righter and Justice when it comes to their recruiting 5 Sampson owns a 3-1 varsity slate Whippets 7-8 practices. Nobody works any harder. We wish_ some other Wilkes 5 _ while Creamer is at the 5-3 mark. BS'ers 6-9 coaches would wake up and recruit some more so Colonet-faithful would Both these matmen have wrestled Nukes 4-11 5 not have to suffer through losing seasons. Remember what Dionne Warfor the injured Dan Miner and Bart ► ===>-u-c:=~-1e-==::>1wick sang, "A fool can lose tomorrow looking back on yesterday." 5 Cook and have bright futures in a 1111111111111111111111111111111111111111111111111111111111111mmmmm1111111111111111111111111m111111111mnn1111111111iir Kevin Brown 14-13 vs. F&M. Mark Popple, Wilkes-Barre, was also l>ne of the topnotch freshmen recruits this season and bolsters an 8-3 slate. "Was" is the key word as Popple wilt be sitting out the remainder of the season due to a cracked vertebrae in the neck. Popple had an honest opportunity to place in the Eastern Intercollegiate Athletic Association (EIWA ) tourney this annum but will have to wait until next year. Billy Dodge, Arlington, Va., scored a Fall vs. Bucknell and lost 7-3 against highlyregarded John Mousetis Saturday. Colonel 142 pounder Lenny ! Between The White Lines i I. by Eddie White III I Bowling Results R I.'"'C'K S' 1'"''H,.,.. ...............-.......... / fine matmen. Virginia is led by Rob Ruland 018), Buddy Kerr (142) , Dan Amidon (158) and Jerry Young <167) while Tech strongly supported by Rich Coates (118) , Chris Conkwright (142), Larry Johnson (167), Don White (177), Mark Miller (190) and Bill Pfeffer (Uni) . The Reesemen had an easy time with Bucknell,30-9 last Wednesday, but received . stiff competition against Franklin and Marshall in Saturday's meet. Although Wilkes won 23-14 the score wasn't indicative of the close individual bouts which took place. Five match-ups were decided by two points or less. You might say "Wilkes was lucky," but our Colonels have been winning the close ones all season. Those freshmen are amazing! They never give up! Wrestling authorities close to the scene believe this year's freshmen crop is the best in a long time. Together, they have combined 38 dual victories for Wilkes. Leading the freshmen is Mark Troutman, Toms River, N.J., with a 12-2 record. Last week "Trout" picke<l up two decisions, winning a wild 20-15 match at Bucknell and edging highly-touted !_ I· I I i ! I i �WilJS.ES.l&H-LWII. MEL BROOKS starioi , ADELINE KAHN· CLORIS LEACHMAN· HARVEY KORMA IMIIIIJ"f DICK YAN PATTEN . RON CAREY. HOWARD MORRIS AMEL BROOKS FILM •Produced and Directed by MEL BROOKS ~inen by MEL BROOKS • RON CLARK •RUDY lleLUCA. BARRY LEVINSON Music by JOHN MORRIS eoo by IfLux~ IOI/ Al MHAP£m . IMUSIC FROM "HIGH ANXIID" AVAIWLE ON ELEKTRA/ASYLUM RECOROS &TAPES.I l"!L'!'l~~~-'~~ © 1978 20TH CENTURY-FOX ~ Fe.bruarg 22nd 7&9pm ·Stark101 the◊beacon· Wilkes College Wilkes-Barre, Pa. · Vol. XXXII, No. 19 February 21, 1980 � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 February 21st Date A point or period of time associated with an event in the lifecycle of the resource 1980 February 21 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/006229cc03a1154c685beb2eb1c73198.pdf 56ad07edf90a8291810d67e781f9fed6 PDF Text Text AD Reese Discusses Academic Standards Committee· Passes Recent Accusations New Four Week Class WithdrawalPolicy "This kid's a black eye to the whole school"is what John Reese, Director of Athletics, had to say about the person who wrote the letter in the February 7th issue of the Beacon, claiming that "there are hundreds of minor scandals" on campus. Reese stated that he was very upset with the fact thtt the letter " . . . paints everyone with the same brush." The athletic director said he believed the letter to have been written by a wrestler who did not make the squad, and thus decided to express his anger by taking " . .. a cheap shot at everyone." Reese continued, "I know who wrote the letter and I'm sure it's not an alumni. I could probably prove who did this, but what good would it do?" When asked to comment on the various accusations of athletic abuses pointed out in the message signed "alumni," Reese began to explain each incident, noting that he would call them abuses rather than scandals. He elaborated further on this by stressing that a scandal is an infraction that is condoned by an institution, and not a single incident which is corrected upon detection. The example of the football player who played half a season with out being enrolled at the school was described by Coach Reese as a situation which could happen to anyone, not only an athlete. Apparently, the player registered for the semester, but never picked up his class cards or went to class, although he continued to play football. It was not until two weeks after the term started that the discrepency was discovered, and the player was removed from school. Disreguarding the baseball player episode by claiming, "I didn't even know of the incident until I read it in the letter," Reese proceeded to comment on the athletic work-study program. the director admitted that with 500 people working in the program off and on, it is very hard to be aware of everything that occurs. He co.n firmed that incidents like the ones mentioned in the letter probably do happen, but he exclaimed, "We've caught them and we corrected them.'' Commenting on the wrestler who was allowed to stay in school with a low GPA, the Director of athletics stated that this student was allowed to stay on because he probably showed academic promise, and not because he was a wrestler. He continued that again such circumstances happen to all students, not just athletes, and that it was not fair for it to be stated the way it was in the letter. Reese also interjected that it is up to the academic council whether a student stays or not, and that "I can't get anyone back although I can try to get them some With an 11 to 4 vote, the new course withdrawal policy passed the Academic Standards Committee overwhelmingly at their meeting last week, stated Dr. Owen Faut, committee chairman. The policy states the present 10 week withdrawal period will be decreased to four weeks. During the first week of classes, a student will be able to drop a course with the advisor's permission. From the second to the fourth week, the student will need the permission of the instructor, advisor and the dean. After the fourth week, a student may Withdraw from a course only after consultation with the instructor. There was approximately a halfhour discussion during which students and faculty presented opinions concerning the proposal. The student members of the committee stated that in a four week time span, the instructor may not give an exam, therefore, the student does not know how he or she stands in that course, so a student cannot make a decision concerning withdrawal from a course. The basic philosophy of the faculty is that a "W" is not a grade and should not be substituted for a grade. If too many withdrawals are permitted, the student is penalized because prospective employers and graduate schools view the "W" as a Withdrawal Policy Sparks SG Into Long Discussion "Many faculty members are getting requests from students to explain W's to grad schools and employers," stated Dr Faut. If this posposal passes, Dr. Faut believes that the academic standards of the institution will be reinforced. The benefits of the proposal are far-reaching, he stated. Since the reputation of a college dictates the meaning of a degree, the degree a student receives at the end of four years will mean more. The student with a degree from a school with an outstanding reputa- help." Addressing the issue of the "wall it" method of weighing in for some wrestlers, Coach Reese repeated that even though "some kids may have done it," it is very hard to do it frequently without getting caught. Noting that opposing coaches weigh the wrestlers in for various meets during the year, he went on to say that "You don't get prestige by cheating, most of the kids work hard during the year to keep weight." Academically, Reese maintained that becaui;e of the division one standing, all wrestlers must have a 2.00 average out of high school <Continued on Page 3) Dave Samsel asked whether the committee checked into the course withdrawal policies of other colleges in the area. Both Nunez and Mrs. Doris Barker, SG Advisor, weeks. commented that they did not know.Mrs. Barker told the SG body to CC President Bill Lewis commented, "the trend (among col- "go to your advisor and ask him leges) has been to restrict student about it (the course withdrawal rights recently, and Wilkes was policy). Talk to him. You should see never that liberal to begin with." him not only to protect yourself, but In a lengthy discussion, SG was to protect those kids coming up." Blumfield pointed out that there told that the Academic Standards Committe claims that they are not are three weeks until the proposal really changing anything. When goes before the full faculty for a asked if the faculty realizes that vote. He stated that he and Ana many instructors do not give tests Nunez will prepare a letter explainuntil after the fourth week of ing the student body's opinion, and classes, Ana Nunez, SG's represenreceived a unnimous vote of contative to the Academic Standards fidence from the SG members. Nunez pointed out that the next Committe quoted the faculty commeeting of the Academic Standards mittee by saying that they feel that they have to "lock students into the Committee, they will review the responsibility of the course.'' policy that allows students who get Nunez further explained that the a zero in a course and then change new policy will give the faculty their major to have the zero cropmore control over their classes. ped from their cumulative Before students could just walk into 1 averages. a professor's office and "wave a The disucssion about the campus drop slip under his nose." Now, the party situation continued this week faculty committee feels that the as Diane Seech announced that a group called Parties Unlimited is profs will be able to sit down and interested in forming a subtalk with students, and possibly change their mind. committee under the SG social When asked if once refused by an committee. Their function would be instructor, a student can go over his to hold parties in the Student Center head to the deans for permission to - on days when no one else sponsors a drop a course, Nunez replied, party. Marla Brodsky noted that they (Parties Unlimited) want a "No." SG President Dave Blumbetter student life here, and they do field added that anything under the academic division of the school is not want to do it for a profit. under the control of the faculty. It was further noted that any proNunez also noted that the comfits would be pu.t into an account to be used for subsequent parties. The mittee has the attitude that "If you do not have a good advisor you _SG representatives were anxious to should get one." This would take find out more about Parties care of cases where students comUnlimited, and as a result, voted to plain that they want to drop courses have some- representatives of the that their advisors made them take group attend next week's SG even though they did not want the meeting for a discussion. course or did not need it. Continued on Page 2 failure. SG discussed the new course withdrawal proposal their meeting Monday night. The proposal will change the deadline for course withdrawals from ten to four r - .. tion has more chances, he explained. Second, if the standards are kept high, the endowment fund grows, and tuition increases are not as fast or as costly. Faculty salaries can then rise, therefore better instructors can be hired who will give students a better education. Better students will then apply to the institution. "We will also be opening up faculty-student dialogue through the conferences," Dr. Faut said. Since the pool of college students is declining, the reputation behind the degree received after four years could be the deciding factor when going for a job or applying for graduate school. Dr. Faut stated that indications are that faculty members like the proposal, although he cannot say if there is a majority. The audit policy passed the faculty at their February meeting. As of September 1980, a student will be allowed to sign up for an audit only during the first week of classes. The withdrawal policy will be brought before the faculty at their meeting on March 13. If this passes, it will also be in effect for the fall semester of 1.980. Patti Sparlow •Maggie Says• .. t.~~a~,s 1!a1!p~n~ng ~ ~ The Theater Department will present WAITING FOR GODOT at the Center for the Performing Arts on February 22, 23 and 24. Personnel and students are entitled to two free tickets. For further informaton contact the theater box office. On~bruary 20, Michael Benedikt, poet, will read from his works at the Cenler for the Performing Arts at 8 p.m. Benedikt, a guest of the Poetry Series, is currently editor of the PARIS REVIEW. A reception will follow the reading. n U n U ntingsOn and February 17, Danny House and Greg Maclean will display pain- n U sculpture at the Conyngham Gallery. Both are 1978 graduates. u ~ On February 26, the Music Department will present a performance the Wind Ensemble, under the direction of Jerry Campbell, at the Dorothy Dickson Darte Center for the Performing Arts at 8: 15 p.m ·~ On February 27, Malcolm Forbes will lecture at the Dorothy Dickson Darte Center for the Performing Arts at 8 p.m. He is a guest of t:1e Concert and Lecture Series. ~ On February 28, a piano-cello recital by Herbert Garber and E~zo Liva will be in the Dorothy Dickson Darte Center for the Performmg Arts at 8:30 p.m. i # The REGIONAL SCHOLASTIC ART AWARDS EXHIBITION will be in the Sordoni Art Gallery from February 13 through March 9. The awards presentation will be held in the Schaeffer Lecture Hall on February 16. ► ri .,-r -- NP -- ◄- - • �Page 2, The Beacon, February 14, 1980 Campus Commentary Insane-Part 2 It is difficult (if not impossible) to grow up in this country without being immersed in the stench of racism, sexism, injustice and hatred, which many ignorant Americans proudly call a dream. Our minds are being polluted from the day we are born, to the (lay we die, and very few of us try or are even able to stand up and shout, "I don't believe." "It is far better to open your eyes and say you don't understand, than to close your eyes and say you don't believe." With open eyes, I don't believe that no one here in American, 'the most richest and powerful nation on earth,' dies of malnutrition. I don't believe that the energy crisis happened overnight, and that no one in America knew about it beforehand. I don't believe that our nation is not preparing to go to war in the immediate future. I refuse to swallow the lies, fabrications or half-truths the government, major corporations and America's wealthy force feed us every day of our lives. What can we do you ask? I am only one person, how can I possibly change anything? First, you can start by taking care of your body. How are you possibly going to cure the sickness in your mind when you will not take the time to clean up your body. Dick Gregory said, "I can't understand people who keep on buying cigarettes. Now I don't mind catching cancer, but I'll be damned if I'm going to pay for it, and pay state and federal taxes too." Nicotine is a drug, and its' addiction is no less serious or dangerous than a person's addiction to alcohol or heroin. You have got to purge your body of pollutants before you can begin to cleanse your mind. • For those who claim that nothing can be done. Let me start by asking you; did you vote? I know, there was no one worth voting for, and when that time comes, then you will use your vote. Well, if there was no one worth voting in, then you can be damn sure that there was someone worth voting out. I for one am ashamed that I did not use my vote last year, but you can bet that I'll never let this happen again in the future . When is the last time you wrote your congressperson telling him or her that you were tired of having your rights abused? When is the last time you opened up the paper and read something other than the funnies, sports or Dear Abby? Let me ask my fellow minority students on this campus if they belong to the N.A.A.C.P.? There are a helluva lot of things that can be done. However, the best preparation is by attempting to cleanse your mijd of the brainwashing which we all receive every day of our waking lives. The key Ingredient behind it all is that you have got to start caring about and yourself, but also about what happens in the lives of other people too. The biggest fool is the person who cares only about himself and what happens in his own little world. Unfortunately, this person does not realize that the moral pollution affects everyone and everything, and he too suffers along with the rest of us. In closing, on a brighter note, let me commend all the participants and sponsors of last weekend's Winter Olympics. The real world has a lot to learn from the united example set by Wilkes College. · David A. Clanton Valentine's Party Set For Tomorrow Beacon. ·Kozey, Jim Rash, and Dave Skripkunis: from the class of 1978: MaryAnn (McKitish) Antione, and Christa (Kauffman) Wolak; and from the class of 1977: Gloria Agurkis, JoAnn Grout, Earl Monk, and Bill Nardone. i::ir~(] r.(]IJ;;~ • I\) ~ i1Jr '1 ococ110e:io,,::~::ao:iooi~J"".....-,.o--...coir BROOK'S BARBER I. SHQP : I ~ . . . . .,..~ ~.,. STYLING FORM;N & WOMEN HAIR COLORING & CONDITIONING PERMANENT WAVING HAIR STRAIGHTENING SCALP & FACIAL TREATMENT MANICURING • SHOE SHINE ~L!!QII A_l'l'Q!NTMENT FIIANK • PETE IARTOI\IO - PIIOP. • • • • • (.:~:sE:t~.) 824•2325 . MAIN FLOOR 15 S. ltANWN \ I .. WII Kf 5-8Att£ r Continued from Page 1 Joe Knox requested that SG grant him $75 to attend a conference about financial aid information. He will represent the college and the experience he gets will be useful for his work with COPUS. The request will be voted upon next week. IDC President Mike Stapleton asked SG to donate $100 to the family of Gina Montoro, a student who died earlier this month. IDC had already voted to do the same, and CC was also requested to do so. The motion passed unanimously. The money will help to pay funeral expenses. It was reported that 150 pints of blood were donated during last Thursday's blood drive. Information on which dorms and organizations won prizes for giving the highest percentages of blood was unavailable for this week. The Film Committee announced that the next film will be shown on Friday, Feb. 22 and not Feb. 29 as originally planned. The change was made because the 29th is the last day of classes before the spring break, and as a result dorms would have closed before showtime. The film, "High Anxiety," will be shown In Stark 101 at 7 and9:30p.m. Blumfield announced that ticket sales are slowly picking up for the Steve Forbert Concert, which is scheduled for Sunday, February 24, In the gym. He urged all students to buy their tickets as soon as possible. Louis Czachor Timothy Ryan, President of the welfare of youth to share their time, Big Brothers-Big Sisters Organiza- knowledge, and abilities to help a tion on campus announced at the youngster to a better way of life. InCommuter Council's meeting Mon- . terested students should contact day night that the organization Tim Ryan for any additional inneeds student volunteers. Currently formation. The St. Valentine's Day Party the organization involves a program "which offers a service to will be held tomorrow, Friday, youth who have shown a need for a February 15, at 8 o'clock in the strong relationship with an in- gym. The band "Chance" is expected to perform. The party will terested adult in order to help them to improve their adjustment in be catered by Poly-Care. Tickets life." Big Brothers and Big Sisters are on sale all week long for $1.50 and may be obtained in the Student are well-adjusted individuals who Center or the Cafe. are sufficently intertested in the On March 14, CC and IDC willhold NOTICE the St. Patrick's Day Party, their On Thursday, Feb. 14, the next major joint activity. It will be Cooperative Education Staff will be held in the Sterling Hotel and the in the lobby of the New Men's Dorm top 40's group "Nature's Way" will from 11 :00 to 1:00 to discuss Sumperform. According to Joe Rubbico, mer and Fall Job Placements with c<H:hairperson of the event, interested students. "Nature's Way has been playing to a packed house at the Woodshed for NOTICE Tuesday, February 19, 1980, the the past two weeks. They are a really good band." Cheese, crackers, Housing Office will sponsor the fifth in the series of 10 educational pro- pizza snacks and other goodies make up the menu and mixers will grams. be provided. Tickets are expected At 7:30 p.m. in room 101 of Stark to be approximately $4.00 and will Learning Center, Damon A. Young, Health le Physical Education Direc- . go on sale in a few weeks. Under new business, plans for the tor of the Wilkes-Barre Family YMNew York trip slated for March 1 CA will present a physical fitness are well underway. The trip will be seminar. like the one sponsored last semester. Additional information Due To Space will be available for all interested in a couple of weeks. Also, Problems, Part Two people plans for the Skating Party at Ice- -------------------------· A-Rama are progressing well. It is \ ) Of The Space hoped that the party can be planned ) j the Ice Hockey schedule ) NUMBER 9 ) Utilization Series Will around and is tentatively scheduled for t SHOP t sometime in March. l l Appear In Next There is one sophomore vacancy ) 9 W . Northampton St. \ on the council. Anyone interested in ) Wilkes-Barre, Pa. 18701 j Week's becoming a member of Commuter t 8 . J Cl h t I Council is asked to stop by the CC l outique• ewe ry• ot es 2nd Math-CS Career Party Slate.d The Department of Mathematics ·will bring his camera to take candid and Computer Science will sponsor photos. After the graduates tell , its second annual career party on their career stories, there will be Friday, February 22, at 7:30 p.m. ;time for students to ask questions. for · all students "seriously inSeveral graaiiates have been conterested in a career in math or com- tacted and among those indicating puter science," announced Dr. Bing they will come are: from the class Wong, Department Chairman. Wong explained, "we try to invite our recent graduates to come in, and relate their recent job experiences to students." He continued, "they will give a five to ten minute summary" of their experiences including comments on "how to find a job, what kind of work they are Involved with, and bow their training here relates to their specific job." The party, which will be held in the Annette Evans Alumni and Faculty House next to the Stark Learning Center, will feature re_freshments, and Dr. John Koch Student Government l i Office In Weckesser Hall. Council ~ Layaway Avai_loble J meetings are every Monday night ) We Accept Master Charge & V isa at 4:45 in the board room on the i ) first floor in Weckesser Hall. . Darlene Schaffer __.. ___________ _._._.l L [ ~ ;~J~~:~;~~g~,Ss l ~ Mark Plaza, Edwardsville Relax in the Friendly Atmosphere of 1920 See Joe, Bob, and Danny MON ..-TH URS. 11 A.M.-9 P.M. TUES. , WED., FRI. & SAT. 11 :00 A.M.-5:30 P.M. 288-3751 · Tired of Cafeteria Food? BURGERS & BE'EF SANDWICHES SERVED 21 DIFFERENT WAYS $2 [J(]fll I] (]fl (lflfs ~fl[I SIJSfflfllS · 75 Entrees Starting At Like Exciting Night Life? Have a Jim Dandy Time ti/ 2 a.m. with EXCITING, VIBRANT people BEER BY THE PITCHER Proper I.D. Required Stop-in before or after the movies Mon . -~r.:.!. 11 a.m . to 2 a.m.; Sun. -> ~.m . to 2 a.m. �February 14, 1980, The Beacon, Page 3 Communications Seminar Features TV Weatherman "I have one rule for reporting and journalism, and it can be summed up in two words - ATTRIBUTE EVERYTHING! " stated Hugh Finn, weatherman and reporter at WBRE-TV 28. Finn was the featured speaker at the Communications Seminar held Tuesday, February 5. A native of Wilkes-Barre, Finn has held numerous jobs at various stations, including manager of the Mansfield State College radio station; news director at WLYC in Williamsport; announcer at WARM and WNAK ; and his current position at WBRE. Finn is also the recipient of the Joe Snyder Award for ADlleese Continued from Page I before they can even try out for the team. He asserted that although most kids are recommended to Wilkes by their coaches, if he feels they will not be admitted, he will not even try to recruit them. Viewing the events in the letter as isolated and relatively infrequent incidents blown out of proportion, Reese concluded by saying that he really doesn't see any scandal!! occuring at all! Peter Steve Book and Record Mart 18 S. Main St. WIikes-Barre BOOKS-RECORDS-TAPES 825-4767 Cliff and Monarch Notes the Best Broadcaster in Pennsylvania. Out of all the things that need to be done in broadcast journalism, .Finn said writing is . his favorite part of the job; he likes "trying to pack the story full of meat." Finn feels that TV will become more localized in the next five to ten years, and there will be plenty of jobs in broadcasting because television stations will be wanting younger qualified people. He also went on to say that the size of the market must also be looked at. In a market the size of Wlltes-BarreScranton, it should be easier to get into the media because of the fact that after graduating from high ·school or college, kids leave the area and people in their twenties will be wanted in the future: Finn used himself as an example, commenting, "While I was still at WARM, WBRE called and asked. me to tryout for the weathermanenvironmental reporter position." Although he wanted to be a "street reporter" Finn tried and beat out twelve others, including a meteorologist. His point - TV stations are looking for younger people who have credentials and have established themselves in the area. One transition from radio to TV Finn commented on was that after talking to a michrophone, "the camera looks like Darth Vader." Finn said that he found it hard to look directly at the lends. He feels it's better to first get into television because through it, the fundamentals of radio can be learned. "I love campus stations," remarked Finn. "There are no commercials, and it is more imaginative since you don't have to appeal to a large number of listeners." Finn was supposed to present some video tapes of a series he did last week on poisons. However, a telegram stating that he and the station would be sued if a segment in which qualified people stated that poisonous plants were the number one cause of poison-related deaths among children was shown. He explained that the tapes had been taken to a lawyer. As for recognition, Finn doesn't like it. "I feel like I'm going to a prom every night," he declared. "I have to get dressed up every night, and a man even comes in once a month to cut my hair. I never realized that the people who sit on the set are considered way up there." Lisa Gurka getting used to RED CROSS VARIETY SHOW CHAIRMEN - Dave Samsel and Ann Cardillo are planning Wilkes' efforts for this year's annual variety show to be held April 19, at the lrem Temple. · · Auditions Scheduled For Variety Show In co-operation with four area colleges, the third annual Red Cross Variety Show will be held on April 19th at the Irem Temple Country Club. Working in their first year as cochairmen of the Wilkes chapter for the new show, Dave Samsel and ~ Cardillo are presently seeking patrons, acts, and any volunteered help they can get for the April event. Plans For St. Patrick's Day Party Discussed By JDC Last Sun~ay Plans for the CC-IDC St. Patrick's Day Party to be held March 14 in the Hotel Sterling were discussed at the IDC meeting on Sunday night. It was decided that free beer and wine would be available at the party, rather than a strictly cash bar. Although this will raise the ticket prices somewhat, most IDC members felt that having acash bar with a lower ticket price members that the CC-IDC Valentine's Day Party will be held this Friday in the gym, from 9:30 to 1:30. The band will be "Chance." In other business, the 1980-1981 college calendar was discussed. Stapleton pointed out that a fall break during the middle of October has been included in the calendar. -Also under other business, it was reported that the report on Co-Ed Housing has been completed and will be presented to the Student Life Committee this week. A copy of the report will be available in the library and in the IDC office for anyone who is interested. · would be ·more expensive for most people at the party. IDC President Mike Stapleton announced that Jon Pliskin has been named chairman · of the Maintenance Committee. Pliskin reported on the committee's most recent meeting, held Thursday, Feb. 7, stating that Maintenance is considering weather stripping in Delaware Hall since the heater that was installed earlier this year proved to be defective. Maintenance Committee meetings will be held every other Tuesday at 2 p.m. in the Housing Office or in the cafeteria. Stapleton aJso reminded IDC Mary Kay Pogar --Chuck Robbins ... - - JEAN TOWN NE Designer Jean Outlet SPORTING GOODS COMPANY · featuring: We Accept Master Charge and Visa Faded Glory! Jordache! Wrangler! Calvin Klein! Plush-Bottoms! Who said designe~jeans are out of your budget? NOT AT JEAN TOWNNE! Stop in soon at -Jean Townne . . . SLIP INTO A PAIR OF FAMOUS label jeans ... and step out looking DYNAMITE! Open 10 til 9 Monday, Thursday and Friday Tuesday, Wednesday and Saturday Iii 6 PRICES START AT $1795 360 Kidder St., Wilkes-Barre 39 West Market Street Wilkes-Barre, Pa. 19701 113 S. MAIN ST. Downtown W ilkes-Barre DAil Y 10 a .m. t o 5 :3 0 p .on. Mon . &_Th ur s . ti l 9 p.m . Phone: 822-1333 Free Parking al Hotel Sterling I I - I I I PATRICK BURKE, Owner - I I I Cardillo announced that auditions · for the Wilkes version of the show, which will include acts from King's, Misericordia and Luzerne County Community College as well, will take place on February 20th at the · Center for the Performing Arts. She added that there will be tryouts for the emcee position also, although candidates from all the schools will compete in this particular audition. Mainly in charge of publicity for the show, the responsibilities of the ·two chairmen also include the sale of program patrons and an allocated 200 admissions tickets. Cardillo commented that a patron ticket costs $12.50, with each patron receiving two complimentary admission tickets to the mixedvariety presentation. Last year, out of the 14 to 20 acts entered, College Misericordia won top prize. It is hoped that this year, each school will provide five acts, all cpmpeting for various trophies and the first place award of $100.00. Cardillo mentioned that this year's show will have local television personalities as judges, which will undoubtedly add some excitement to the program. Ticket prices will be $3.00 for the general public, $2:00 for students with senior citizens being admitted free. All proceeds will benefit the Red Cross. Cardillo said that in an effort to boost ticket and patron sales, the possibility of a party after the April event is being discussed, but she pointed out that this is only in the form of a suggestion and must be looked into before becoming finaliz_ed. She stated that anyone wishing to help with the show may do so by contacting her at 826-()427, or by calling Dave Samsel at 1129-9153. The co-chairman concluded by saying, "We need people who just want to be involved!" - - -- Januzzi's Pizza and Hoagies 125 Ac·a demy Street Home Delivery OPEN 7 DAYS 11-1 �Page 4, The Beacon, February 14, 1980 Winter Weekend ONWARD TO RALSTON FIELD. The Olympic torch and Wilkes banner are nearing•their dlstiny for the opening ceremonies of the Olympiad. WITH THE FLICK OF A BIC - The ceremonies rolled smoothly with the help of Andy Janquitto. . THElCLU KLUX KLAN? NO! It's the Luxemburg team, which became the runner-up winners in the First Olympiad. • • • • LET'S GET ROWDY! The Olympiad teams gathered to display their country's dress and their banners. As teams gathered in the parking lot of Kirby Park, it was easy to feel the electricity that clung in the night air. Anticipation had been building for weeks, and now the · time had come. All the plans and preparations were complete with mothing left to do expcept get the show on the road. The First Wilkes College Olypiad was abo_ut to begin and people could not wait to get started. Almost fivehundred people entered_the competition representing twenty-four different "countries". The nations fell into formation and paraded on to Ralston Field where master of ceremonies Marla Brodski introduced the guest speakers. First, John Sheehan, excutive director of the Wilkes-Barre Chambers of Commerce, opened the games with a short speech supporting our efforts. Then, Father Lewis, pastor and superior of St. Josephs Monastery, gave the invocation. With this completed, a torch runner circled the assembly and lit the offical bar-b-que. birds were releas- hills as planned, so, the officals ed and the games began. brought the competition down to the A volleyball .tournament was the pond. The qualifing round saw first offical event and began soon after the opening ceremonies had Canada turning in the fastest time ended. Enthusiam ran high as but, it was Sweden that slid to victeams packed the gymnasium hop- ,tory in the finals. Finland and ing to make it through the first Ireland finished 2nd and 3rd, with round competition. When the dust the Cauadian team finishing a heart cleared Sunday afternoon, it was breaking 4th. the team from Luxemburg that pro- . The Relay Rac;e provided both exved too tough to heat. Saudi Arabia, citement and controversy. Bags of taking its only medal of the games ice were used instead of the planned placed 2nd. Bangledesh and blocks and caused a great deal of trouble for many teams. Strong Australia were the other teams to reach the semi-finals although no showings from Guyana and other teams were disqualified because 3rd place award was given. The Class Feud held in the CPA, the bags could not withstand the which capped off the opening day of rqugh handling. events did not turn out as well as exFinishing in a three way tie for third place were Italy, Ireland, and pected with only a small crowd showing up. The junior class team Africa. Second place went to France while, Luxemburg took its showed its talent by sweeping top honors, with the sophomores second 1st place medal. , In by far the most controversial finishing 2nd. . event of the games, Rhode Island Saturday's full schedule of events squeaked to a victory in the opened up early with the Ice Skating competition. Although Obstacle Course after being disqualified and then being allowed to Guyana set the early pace, it was race over again. Despite the trouFrance who took the gold. Finishing in an extremely close second was ble, this event proved to be one of Canada, With Ireland grabbing the the most exciting with many girls overheard asking, " We don't have bronze. In the Traying event, the format to climb over that wall, do we . . " The team from Ireland placed 2nd bad to he changed just prior to the with Sweden and Luxenburg sharstart of the race. The snowless coning the 3rd place award. ditions made it impossible to use A . The semor class sponsored the game show and the junior class 'family' put their heads together and walked off with the big bucks. �February 14, 1980, The Beacon, Page 5 • • A First Place Finish RUN AS FAST AS YOU CAN! This seemed to be the underlying goal in this particular relay race. r The last event held Saturday was the Tug-Of-War, and this had to be the most exciting event of the games. In the consolation hout for 3rd, Guyana came back after falling behind early to out pull the Canadian team. At first glance, the finals looked to be a mismatch with the Italian team showing a great deal of muscle. But it was Rhode Island who surprised everyone by winning a grueling match that pitted strenght against team work. Sunday afternoon, the American Brewing Company served as sponser of the last event titled, " All Anything Goes". The competition, aside from being part of the Olympiad, served to determine the Wilkes College entry into a divisional play-off between King's, Scranton, and · Villanovia. The winning team of this play-off recieves an all-expense paid week vacation in Atlantic City wJiere they will compete against other divisional winners. At the exciting conclusion, the team from Bangledesh captured its only medal of the weekend by finishing ahead of Rhode Island and France, who placed 2nd and 3rd respectively. As determined by the total ac- . cumulation of points through-out the weekend, the top ten teams . were as follows: 1. Rhode Island 21 points 2. Luxenburg 171-2 ~Fn~e U 4. Ireland 13 13 5.Sweden Ii. Bangledesh 7. Italy 8. Finland 8 5 2-3 5 Saudia Arabia 5: 9.Guyana ·3 10. Africa 2-3 It was quite obvious that everyone was a winner this weekend. The friendly competition served to unite all who participated. Although, there were some trouble spots which were caused by inexperience, a good arguement can be made for continuing the Olympiad in future years. There could not have been a better cure for what President Capin described as the winter doldrums. Saturday night, the Beach Party held in the gym proved to be a great success. The capacity crowd was treated to. good food, good music supplied by the "East Coast Revue," and a good atmosphere in which to enjoy the company of friends Closing the weekend in style was Many Bear who had played here once before. Good wine and cheese were served.as Mr. Bear entertained the crowd with a combination of well liked songs and audience· participation. His closing message was well chosen and truely represented the spirit showed this weekend. He said that we should feel lucky to still have our helath, youth, and freedom. This Winter Weekend proved also that•we should feel lucky to have each other. Many thanks must go out to the numerous people, dorms, classes, and organizations that helped make this past -weekend a memorable one. The success that came about was due to the combined efforts of everyone who participated. Perry Lichtinger KEEP THAT ROPE TAUT! The Rhode Island .team griped the rope and captured the thrill of victory and probaltly sore muscles. WHAT DO YOU HAVE TO SAY FOR YOURSELF? This may have been tile question Dr. Kinney posed of Bobby Rushworth during the "Class Feud." �Page 6, The Beacon, February 14, 1980 Professor Elliot Expresses Opinion; · Letter To Editor Found Disturbing From Ten To Four If the new withdrawal policy passes the facilty in March, students will be allowed to drop a course during the first four weeks of classes, as of September 1980. The reasons for this switch from the present 10 week system are numerous and an optimistic outcome is predicted. The college will benefit in many areas from the adoption of this proposal. Many people argue that this hurts the stude~ts, mainly because after only four weeks, a student does not know how he-she is doing in that pa,rticular course, especially if the professor has not given an examiniation yet. These · peopl_e claim that four weeks just is not enough time. Considering the long-term effects, we can only agree that this policy will benefit the college. Anything which is going to upgrade the academic standards and make our degrees worth more after four years of hard work, has to be worthwhile. As students, we want to come out of college with a good education in preparation for good job opportunities. The reputation of the college reflects on the students, and for a good job, a graduate must have a reputable college behind him or her. With many job markets competitive as they are, a strong academic background, which includes studies and standards, can only be beneficial to the graduate. Because withdrawals are being viewed as failures, students are being penalized in the long run, not benefitting. Although the new policy may seem like a disadvantage now, face it; either we pay now by losing six weeks of withdrawal time, or pay later, possibly by losing a potential job opportunity. ''Be Mine'' The response to our special Valentine's Day insert which appears in this week's Beacon was overwhelming to say the least. We thank each and everyone of you who made our attempt at something different a success. To the Editor: I have been at this college for • many years, and yet this is the first time I have felt compelled to submit a letter to The Beacon. I do so now only because of the two letters which were contained in the issue of February 2, 1980. Perhaps one should not be upset by anonymous letters to the editor, but it seems to me such correseondents take the liberty of engaging in having the courage to Identify themselves. In an era where old ladies are. mugged in parks and when four on one attacks on fellow humans are distressingly common, I suppose it is to be expected that here at Wilkes we will be occasionally exposed to the raunting and drivel of the cowardly. ·I was particularly disturbed by the letter incorrectly signed "Alumni." Having been a proud member of this institution, having been an equally proud supporter of Its athletic program and having known and respected John Reese for many years - I was appalled at the accusations that were made. These charges were comprehensive in that they covered coaches, athletes, the Admissions Office, the Financial Aid Office, the Academic Standing Committee, the Athletic Committee, the deans and individual members of the teaching staff. If "Alumni" will come forward to me personally, I assure him that I will maintain full con- · fidentlality and will attempt to check the validity of the various accusations. Who was the football player? Who was the baseball player? Which athletes have ----tbe<>beacon-----USPS 1132--01141 Editor-In-Chief Jim Edwards BillTurcan NewsEclitor Peter Steve To the Editor: Sports Editor Eddie White III Managing F.ditor Copy Editor Patti Sparlow Op-Ed Editor Perry Lichtinger Asst. Op-Ed Editor Asst. News Editor Margaret Scholl . Louis Czachor Photographer Bob Gaetano Business Manager Sue Freda Advertising Mana.;er Vanessa Martz Circulation Mananger Michele Serafin . REPORTERS : Cindy Ercolani. Lisa Gurka, Mary Kutz. Sue Loveitt. Gary Mack. Bill Miller, Rich Nordheim. Ana Nunez. Mary Kay Pogar. Darlene Schaffer. David Stahl: Advisor George Pawlush Parrish Hall 16 S. River St. Wilkes-Barre, Pa. 111716 _PubUslaed weekly during tbe school year rrom September to May except ,., vaea&ioa periods and semester breaks. Entered as second class postage paid la WUkes-Barre. Send form no. 3579 to The Beacoa. Wilkes College. Willles-Barre, Pa. 18'7'6. Suncrlption rate to noa-stlldents: U per year. Adveniliag rate: SZ.50 per column Inch. Students Urge Sports Scandal Investigation . Phone : 1717l 82-1-1151. Ext. -173 · All views expressed are those of the individual writer and not necessarily el die pnUcatNII of tlle college. We, as students of Wilkes College, were glad to see that someone finally brough to light the minor sports scandals that occur here at Wilkes College. Several weeks ago in the January 24th issue of The Beacon, there was an article about the Middle States Association final report on tile accreditation of this college. We must agree with their evaluation that there Is "an Imbalance of attention given to male and varsity sports, such as wrestling, at the expense of female and intramural sports.'' We hope to see this imbalance corrected. As for the minor scandals, we have in the past heard of such happenings and oftentimes from the athletes themselves. But suddenly all we hear since last week is flat denials. We hope the issue will not die with these denials. We would like to see some sort of investigation either by The Beacon or the administration to insure everyone these things won't continue. If such happenings continue to be condoned or Ignored the school and the students will suffer. In our opinion these scandals are true. We know, we have heard it, straight from the horses' mouths. Sincerely, Some Concerned Students received illegal . financial the former athlete he claims to be, assistance? How many students whatever good-sportsmanship he were admitted to Wilkes despite . may have acquired along the line low academic records? Which would not permit him to continue wrestler was kept at Wilkes in spite "below the belt" tactics. If he is an . of a .50 average? Who are the "good alumnus - a man - he will certainprofessors" from the athletes' point ly attempt to clear up what is now nothing more than character of view? Who are you? assassination. If "Alumni" has the slightest Sincerely yours, . sense of morality or fairness, I George F. Elliot believe he will accept my request for additional information. If he is Wrestler Rick Smith Writes In Defense Of John Reese To the Editor: In reference to an article in last week's Beacon, "Former Athlete Sees Campus Program Suffering From Small, Subtle Scandals." I feel this person is suffering from a failure complex. From the information in the article he is an athlete who coultl not cut the mustard and is now trying to lower the esteem of athletes in general just to raise his own. In his letter he talked of athletes with low grades who were allowed to stay in school. WeIJ at least the athletes had a G.P.A. I know of a case from this past semester a nonathlete student that had a o.oo (ZERO) G.P.A. and was allowed to stay in school. There goes your great theory that athletes are the only ones to receive grace from the Academic Standards Committee. As for athletes receiving money for school I think you have financial aid and athletic scholarships mixed up. Also the student work study program is run well. The work gets done on time and the students are paid according to their respective hours put in. The supervisor signs the time cards and the individual students pick up their checks from the finance office. Under this system it is impossible for an athlete or any other student to get paid under another student's name. It seems as though there have been some big cheating scandals Criticism Of Gries Seen As Unsound And Uncalled For going on around Wilkes this past year. I do not recall hearing any athletes names mentioned in the involvement of the scandals. Some athletes may cheat but don't stereotype all of us, unless you want to stereotype the whole student body as cheaters. The article was full of biasness and slander, as I have pointed out. The concealment of the writer's name is evidence that he was emharrassed by his predjudiceness. Why do so many students have a negative attitude towards John Reese and his wrestlers? .John Reese is a very respected figure in Wilkes-Barre as throughout the nation. He would never condone nor tolerate cheating. John Reese works very hard to produce a successful team. It is a great achieve-ment for a school of our size to have a sports team ranked in the top of the NCAA Division I. We wrestlers feel we promote our school's name in good standing. We are proud to wrestle for Wilkes and we win for Wilkes. Rick Smith Brodsky, Seech Offer Thanks For Assistance To the Editor: The enourmous student participation in Wilkes' First Olympiad made the weekend a success. The fun and spirit · of competition were enjoyed by everyone involved. We would like to extend our special thanks to the following people who made this weetend possible: To the Editor: Corinna Bender, Tom Rooney, As another CONCERNED stu- Tim Palmer, Keith Kolanda, Peggy dent who is involved in a few ac- Bartletta, Carol Cigarski, Chris tivities on campus, I feel the per- Fellin, Joanne Rice, Sue Suchanic, sonal attack ori Colleen Gries and Art Hoover, The SG Social CommitThe Beacon was unsound and un- tee, Joe Gray, Don Patrick, Dave called for. ,,. Arrigoni, Perry Lichtinger, Marcia These concerned students are Proskowski, Lisa Miller, Maribeth probably the glory seekers on cam- Kofira, Jimmy Murtha, Joe Galli, pus. They are just jealous and Andy Janquitto, All the Teams, All aren't considered . saints in their the Coaches, Lynn Arlauskas, Ruth own right. McDermott, Barb Sha,ffer, Megan Colleen Gries is no' saint (Thank Ward, All the "Beach Party" People from Barre, Sullivan, Miner, God), but she is by far one of the hardest working class pre.,idents in and Delaware, The Majorettes, and the past few years. Strutters, and the Indispensible I hope other concerned students · Maintenance Crew. Thank you, would stop acting like little children crying over spilt milk. I wish they DianeSeech would screw their heads on straight Marla Br~sky and worry ,about their own ac. tivities without putting other people down for doing their own thing. "Face the Fire" More Letters . ...Page 7 �Happy Valentine's Day to the Panic's (Rich, Carl, Joe, Larry and Huey.) Delaware's Panics Sally &Nellie &Carol Happy Valentine's Day Baby Bartanella, Baby Bird and all the babes of Colonels House. Love, 1be Baby Bio Girls -ToJobnS. How can I only be a friend, when just yesterday, I was more than your friend. I guess i~ll have to do for now. Happy Valentine's Day. - Signed: _How to pick up Girls Happy Valentine's Day Sweetheart, LoveMOM ToM.S. (Eng.) MY pride has been hurt and my pride was scarred "But next time" I vowed, I won't fall so bard. Kahluce &Cream Tolmbo: Love and Paisley Sneakers. Fritz&Hans Trooper Brown, "You" are really something!!! I'll hold you in mt heart ... Happy Valentine's Day! Lots of Love, Brown Eyes Sue Harris, Happy Valentine's Day. From, Dung Duong KennyH., They say good things come in small packages, so where were you on my birthday. I'm still waiting. Carol's Other Half To Naji, "I Want to Rock With You" at Alice A's. Happy Valentine's Day ! To S.S. The Student's Body From E.S. &S.C.C. Toe.I. Hope your Valentine's Day is not "Boring" Patrick, Happy Valentine's Day! Your Secret Admirers L.T. Paul Alan, I love you You know it's true But you're so bard to understand You say you don't want to hurt me · But can't you see, I'm hurting now Not knowing where I stand Love always, Kathy LeigbM. Happy Valentine's Day. Love, YourRoomie Babetta, I really don't know how else to say it, but in its slmplesfform. It somehow sounds the best; I love you! I'll love you always, Vinny ToPaulA., You're the most cooperative person we know. Hope you enjoy future parties. The Super Duper · Scoopers ToMarkS., Happy Valentine's Day to my NUMBER ONE MAN!!! Hope to keep seeing you in the Student Center in the mornings. Keep writing those letters, I love them. Happy Valentine's Day, The Foxless Broad To "Z" I did it for you.Happy Valentine's Day! Love always, Jack Donna SummerCome to me, I am the hook! Mark "tremendous" Joslyn, You're some box of chocolates. Love you, Tom ToMaggie, For someone who does good work in the dark, and gets turned on by bigbbeams. Love, The Smut Brains Mark, Iloveyou! Pamxo To all the engineers, · Happy Valentine's Day. Camille and Sue Sir Lancelot, Thanks for being around. Have a great day.Love and happiness always. Your Twit George, Art and the rest: Have a good Valentine's Day and thanks for everything! ! · EJWIII Happy Valentine's Day, Petie! ! I want your bod, you little devil! ! xoxo Your Secret(?) Admirer S.Crogban, wheelbarrow How's the business? The Mighty Penguin To George, the automatic pilot. Happy Valentine's Day To the Wicked Snadger, Hugs and kisses for my favorite valentine. Eternally yours, WiggyBits Anj, Better than ever. This time forever. Lou MOE: You do a great job, stay in any time to visit. THE BEACON "Needle"How's everything in Scranton. Happy Valentine's Day, "Horn" G.B., Happy Valentine's Day. Gay Ray Lambchop, I love you very much! Happy Valentine's Day. Love always and more, YourH ... To the Junior Class President: We love you Colleen, Ob yes we do, We love you, Colleen, And will be true. When you're not with usWe're blue. Ob Colleen WE LOVE YOU! ! ! · 1be Junior Class Dan, I think you're wonderful! Happy Valentine's Day. Love always, Yourbal9e Pat, So many times when the city seems to be witheut a friendly face, a lonely place, It's nice to know that you'll be there if I need you. Happy Valentine's Day. Love, Laura To the Married Man I sleep withYou're the best!! All My Love, YourwifeWOOSIE MikeB., Doreen, If a Valentine could only talk I'd say you are my favorite jock! Happy St.Valentine's Day Love, Peggy 'i'oJohn, Our favorite psychiatrist with bidden intelligence, Happy Valentine's Day! To our favorite Martian, Happy Valentine's and good luck with you know who! MandJ Wayne, Hi Cutie! Day! Happy Valentine's Love, L.T. Karin, "We'll find a special place in the sun, Let love turn two hearts to one ... " Lena,, Hi Beautiful! Happy Valentine's Day and Happy Birthday! Love, Tony No.22 - I Love You ... Dear ZOOZUN, You see my daily, but do you care? I stand in silence, watching you there. My adoration is endless; my love divine Dear, dear Valentine will you be · mine? Love You, ZIGGY ToPoge, From the shotes of Ichor, Come the lilting flutopbones of Kermie. OH the fun of a surgeon who bitingly lets the patient bleed. For the irony and the fun, Have a happy Valentine's Day, oh surly one! Love ya, Monty Python Sue: To a great V-ball player and supersec-m May we keep cooking up the good times. Have a great Valentine's Day. Love ya, AN Dear Mike, How'd you like the carnation? Happy Valentine's Day. Love, TAK To the co-pilot, George's roommate, Happy Valentine's Day. Two Admirers To Much More Ana and M(B)KPHappy Valentine's Day. The Pink Panther You called it love I called it greed You say yo11 take what you want I say you get what you need. ToTB, Cause when I'm with you - I'm superman. From Your Pal TB Querido Nick, Selices Dia De Los Enamorados. Con Amor Y Besos Sandy "Old Lady". Good luck student teaching and don't start any fires in Pittston. See you for your birthday right? "Bopper" Someone to talk with, to eat with, to laugh with, to cry with, to think with, to understand with. Someone to be our friend. Happy Valentine's Day. Annette, Sally, Carol J. "Needle": Good Luck in the bush or you can "love it" - . E. "Needle" To Chico, Rocco &Tony, HappyValentine'~Day! Gene Marquette: Good Luck out there at MU - the Cubs stink. How's Thelma? Duke got ripped and Hank is as good as Chet, right? THE BULL To the one for whom I would see my parachute, As we eye the blue horizon's To the Girl with the Heart of Gold, Sometimes we wish that we could stop you from talking, When we hear the silly things that you say, We think that someone ougbta put out that big light 'Cuz we can't stand to see you this way. The people who love you most INTRAMURAL BASKETBALLTEAMS: WE WILL BE BACK! THE BARONS ALL From, A Friend bend, Earth and sky appear to meet at an end, But it's merely an illusion , . Like your heart and mine There is no sweet conclusion. I'm aware my heart is a sad affair, 1bere's much disillusion there But I can dream, can't I? Wheeling, West Virginia R.S.V.P. Dear little boy with muscles, You win some, you lose some, but I never stop laughing! I'm CRAZY ... and I know it. Have a very Happy Valentine's Day. "The Winner" �DearT.T.B., I bope you "Carry on" and have a HappyV.D.! "Your Quad" ToMom, · Look Ma, I'm gonna graduate. Maybe. "Have You Boyfriend Kissed Your Today?????" HiMomIloveyou- Jack To the second Door closet, What magical quality is it that you possess that drives people to do such strange things. First Jim became enchanted by you and he often escaped to your dark recesses. Next, Pete and Maggie found your inner space exciting. Now, everyone tells me I'm next. Be that as it may, I will not fight your magnetism and I look forward to many good times in your presence. Ten More Guesses To Margaret Scholl Despite our disputes, I think you are a beautiful person. Happy St. Valentine's Day. Signed, - You!'Boss K, How shall I love thee - I shall believe in thee, How shall I believe in thee - I shall love thee .. . ~ To The Camel Jockey: You're Looking Great! Happy Valentine's Day! Kim, I know how much you like to swim. You are really good at the Dy. Your broad shoulders must be why. I know this may sound stupid, but since it is the semester for cupid. I would really Dy high, if you would be my Valentine. Another,Dolphin Kim, I think "Disco Flipper" wrote the above message. Jim ToP. Remember all the fun we had in the elevator with that table. I never realized you had it in you to do anything so silly. Happy Valentine'sDay. You Know Who To C.Z., L.E., and K.H. . Happy Valentine's ' Day to three members of the Eddie White III fan club. Keep hanging out in your usual place and one of these days something nice might walk by. · Watch out for 4-color. AnotherTwo To the future Alice A's. Love, that guy with the moustache Alias "fish face" of To "The Winner". You're a woman and we've heard you roar, Hang in there, cuz we've all been there before. Happy Valentine's Day. Delaware No. 496 Happy Valentine's Day to the sexiest baby bird I know. Baby Cricket Carol, You've been romanced, dined and danced, crazy nights, wild times. Your life has lost its mystery. Love may be blinf but someday It will find you. La Petite Personne Mayor Pete, Happy Valentine's Day from the basketball community. VinceP., Friends are like shadows, they stay only while the sun shines. The sun Is still shining. Carol Dear "Big Sis" (Kathy) Don't bother to knock, you know ~ door is always open to you when you need a friend, so don't bother to knock. You little Sisters (S. & A.) Coach Righter, Happy Valentine's Day and may you have no turnovers on this day. Verna s. Let's meet again with I go hunting and we can together mount an attack. To Ned from Panama, Happy Valentine's Day! Love, Waltty and Preppy ToJoy: Happy Valentine's Day! Three Men and a Bird. w. Coach Justice, We love you, All girls at Wilkes Jim, Happy Valentine's Day! ILY Danelle DearD.N. Happy Valentine's Day, P.S. I.L.Y. Love, S.M. K, r.r. r .... .M Hey baby's! Happy Valentine's Day. The Guess Who To "S.P." "Love knows no limit to its endurance no end to its trust, ·no. fading of its hope: it can out last anything. Love; TheN.P." Linda, You are another one of the prettiest girls in my Accounting class and if your· friend is going to the Valentine of S.D. I want you to be my Valentine. Love, A Secret Admirer To the Pigmy; · Keep fun-takting it! Valentine's Day, Twit! Happy Love, X-Roomie Hey,Ana, Is that you singing? I've been told it's a catchy tune ... Don't stand in the corner too long. · Love and Biology forever, P.F. ToTurkey, I just want to take this moment to tell you that you are really special to me. I hope we can always settle our problems like we did in the past, and may I spend the rest of my life with you. A never ending love, Your Twit Tybalt, Roses are small Violets are Oat You're my favorite Kitty Cat. To "Bob" Newhart, Happy Valentine's Day · from your favorite secret admirers Marybeth K., JobnW., The pictures A.A., devel~. memories. Thanks have been for the Lisa DearTom, The most wonderful thing is that you and I are always walking together, hand in hand, in a strangely beautiful•world, unknown to other people. We both stretch one hand to receive from life - and life is generous indeed. (K. Gibran) I Love You, Mary Ann I think you're real cute. Have a Happy Valentine's Day. To a real sweetie. Happy Valentine's Day. Thanx for being near and understanding. I love you. Guy Val, Happy Valentine's Day to a great friend. K;eep smiling. Sue To the Holy Hook: Best wishes to you and your crew on Valentine's Day. Har! Your Pal, Spike February 14, 3 Months and 4 days . . -M"To love is .to place one's happiness in the happiness of another' ' Happy Valentine's Day. Love Always, -KTo Sue, A Christmas party punch pusher who always delivers on time, did you get your LCB card yet? Love, From: Jim, ll Room27 Dot, Have a good hearts day, G.L. Dearest Chuck, Happy Valentine's Day from me and the rest of the ten thousand. Love, G.W. No horny animal jokes, please, it's Valentine's Day! Chris, Everything in life turns out for the best. Happy Valentine's Day! Love, Kim HeyP! HeyT! Ready? Set? No more horses, or cows, or roosters, or chickens, or hamsters, or DUCKS!! Happy Valentine's · DayP! ' Your secret admirer, T! .To Jean, Maureen, and Peggy, · The three of you are something else. I'm glad I've had the chance to get to know each of you. P .L. To Lynn Arlauskus, I would have asked you to be my Valentine but, you got engaged. What's a guy supposed to do? Lots of Love and have a happy St. Valentine's Day. · To the Sullivan Sisters, Never in my c;lay have I seen a more zany and wacked out group of girls. But you won't catch me complaining. As Bob Hope put it so nicely, "Thanks for the memories." Happy Valentine's Day, Bun! Happy Anniversary, Too! Someday: You and Me Forever Love, Kitten xoxo Hi Guy, Jet'alme. ... Pete, Patti, Pera· . ' Margaret, Vaness Your secret admirer To Sullivan Hall, Have a wild and crazy St. Valentine's Day. Love, Peggy ' 'Mi~ ii ToB. You have nice teeth, beautiful eyes, a great mind, and one hell of a "smak" ! I care deeply for a kookynut ! Have a good day! Love, Me To Charlotte, Roses are white, . Carnations are red, Sooner or later I'll meet you in bed! ! ! Happy Valentine's Day, Sweetie Love, ???? To Geraldine Annabell Knopic, · If you won't be my Valentine this year ... Happy Valentine's Day. Love, Peggy Sal, Just keep smiling and reaching for the stars. Good Liick. Happy Valentine's Day. The ex . · To Ann Cardillo, How you ever convinced me to run in the mornings I'll never know but, I guess I'll need to after all those cookies. Thank you for being so nice even though l'in so "mean." To The One And Only No. 1 Happy Valentine's Day and love always. Your Little Sister To Valerie, A smile can give a brand new start, Mickey, I love your basketballs, But a Valentine will steal your Roz Waz, heart. Happy Valentine at the Mount, S.F.D.P.M.S.R. Koz, Waz, Bird, Mark, Mike. Happy Valentine's Day t,hanks for the shirts. . Is yours taken? Happy Valentine's Day. Love, Peggy w.. .:. . and Joy Best Wishes for a lethal Valentine's Day. Youknowwhatlmean? P. �• To Bob Eubank, Happy Valentine's Day and we'll seeyouontheN.W.G. Your favorite contestants GIUSEPPI, Sorry I couldn't make it last weekend. D.S. Paul, May people say I should let you go It may be so But how can I let you go When I love you so. Love, Katy (Babel ·To Lou Ann, I love your sparkling blue eyes, Which sparkle like the stars in the night slr.:c:s, ' And the way you wear your hair. I only wish we could make a pair, It would be fine, If you would be my Valentine. W.W. Dear Mr. Abate, When you 're hot you 're hot, But our water's not. Happy Valentine's Day. The Women of Delaware To a "sexy" car-Lot owner, Boy ...would I love to start your motor. Happy Valentine's Day. ??? ,.,, JoeG. Happy PORKIN ! Love, DF To fellow dormies, commuters, faculty and administration, Have a Happy St. Valentine's Day. Mcclintock Hall To Yamaha, Stay away from crowds and Happy Valentine's Day! Love, Arctic Cat APGM: "I wanna be your lover." . -ill, Eddie , I met you on a winter's night, The moon was full, the starts were bright, We talked, we laughed, it seemed so right, I can still remember that special night... Happy Valentine's Day Artie, Love, Barb , louie, Peggy, '- DearTAK, "Thank-you" -Happy tine's Day. ValenLove, M&K I like your Ankles, they are just fine. I wish you would be mine, If even just for A short time. Please Be My Valentine. A Friend in the Pool. , 1,'- Blossom, Words cannot express the happiness you brought into my life. I will always love you and care for you the rest of my life. · All of my life, Muffin !1'9. D- Good luck with peaches' roommate. Happy Valentine's Day. To Jello, Happy Valentine's Day. Love, Whitty and Preppy Mark, Out until 5, okay? Happy Valen- , tine's Day. Guess who? F.D.&F.D. When are you going to JOG our way??? L.P. &J.O. Tommy, Thanks for all the help with the class. We would have been lost without you. You are such a·sweetie Happy Valentine's Day. S.M.T. Jill w., Happy Valentine's to a great friend. Thanks for all the help and good luck with Hershey. Will .miss you next year. Guess Who To Housing Office, Bookstore, Psyc. Dept., and Soc. Dept. Happy St. Valentine's Day. Peggy SharenM. Give me some time to be your Valentine. Doug Hey Polar Bear! Roses are Red Violets are Blue You may be far away But I still love you. Happy Valentine's Day! · Your Torpedo To Joyce Vodzak, 1be wizard of Oz gave the tip man a heart because he didn't have one of his own. You my friend, only need a repair kit. Happy Valentine's Day! · Happy Valentine's Day to You, M.K. You have been a great deal of belp and a fabulous listener. '!bank you so much. Happy Valentine's Day. S.Sec. CMG: Way to go, Keep up the great Kathy, To a very special person in my life. Thanks for mating me a very happy guy. Even though I may be far away my love for you ls very strong because sweetheart I love you - very much. Bruce work. Michele, You are one of the prettiest girls in my Accounting Class and I wonder if you would be my Valentine. Love, A Secret Admirer Icky, You flick my bic and I'm not lyin' all I want is you to be my-en With all my love, Tybalt To Huey, Lar., Mean Joe, Mike, Richie and Uncle Wally: You are the bestest friends a girl could have. I LOVE YOU GUYS! Ter. P.S. Have a coke and a smile and a Happy Valentine's Day! TO Gerry of Doane: ntine's Day I ~ele PatV.P., Artie I Love YOU ... I have tried to show I care, but have gotten nowhere. Be My Valentine. . Unknown ToJ.B.E. We all love you. Happy Valentine'sDay! To my MuffinHappy Valentine's Day! I do trust you. All of my love alwaysYour Blossom BarbieS. If only dreams could come true!!! AMG. Happy Valentine's Day "Ju" from your G.P. Nancy, Happy Valentine's Day to the most wonderful girl in my life. I love you babe. Love, Tom To, Terry, Sandy, Karin, Patty, Fran, Deboucbe, Deb U., Cindy, Diane, Cary, Martha, Linda G., Carol, Vanessa, Robin, Lauri F., Lori Co., Victoria, Rose, Judy, Linda Wasilu. To 21 of the best yet everyone can be a pest. (And this I don't say in jest.) Without your comments'and remarks everyday would be so dak and yet I feel compelled to say, Have a wonderful ana. Happy St. Valentine's Day. With love, Margaret Mary To, _ Grand Old Arse, Young Kate, Siad (TYS), Jogalli, Judith M., Frank Dennis, Gayle, Blumer, Frisball Sue Isaacs, Marla, Diane, Judy, Ruth, Marybeth, Joan Pinsin, Perry, Mary Jane, Sandy T., Drena,Etc. Have a Happy St. Valentine's Day. Love, Peggy "Your little one" To Joseph, Your love, understanding, and friendship have brought me more happiness than you'll ever know. Happy Valentine's Day. Love, Joy Dear Barb Schaffer, Happy Valentine's Day. Have a wonderful day, I appreciate your favor. Peggy Dave, To a kid who's great -in everything, even basketball. Happy Valentine's Day. Love, Anonymous Larry and IZOD. Sorry that I missed the Baptism. Happy Valentine's Day. Sue . Pepe: . Keep UP the good work! Your partner loves it! "Kopf, . Love you always and forever! Stacy" Mike, · It's not the meaning of this day that causes me to feel this way. i hope that you will always find a love that brings'you peace of mind. So would you please be my Valentine. Love, Peg ToSueR.A., Our friendship's been 'Paradise' But who's to say we've seen the 'light'? There's one, there's two, there's 69, We hope this Valentine's Day's mighty fine. Love, Peace and Jackson Browne, Your Weird Agents Carol and Lynnle, What a great pair of neighbors we have. Keep smiling and Happy Valentine's Day. To'Ship': While talking once with Dr. S&S "Take some Cs plus H2O And mic with chemical giee, 'lben.toss upstairs And hear the blast, It'll knock those birds, Right off their sneakers." Have a ducky Valentine's Day! IR-UV-NMR-M-0-U-S-E Tom, To the most , sensitive and understanding person that I've gotten to know and love these past sixteen months. I love you babe. Have a Happy Valentine's Day. Love, Nancy Bones, His voice was clear to me, AV alentine's Day Message, Though we are working on our fourth, Quite an accomplishment some say, I've found no troubles between us To our TOR alky, From the glasses that go tinkle in thenigbt, And the clicks that make the yet, big time . Mating it all the easier to say, That this message ls for you my love, For on this fourteenth day, It seems my heart ls with yours DOW, As one in every way. This message I should end right bere, But this can't be done you see, . For my heart will not be left here, But with you Theresa Marie. Love, Tom To Irene Cocco, Happy Valentine's Day to the best Wilkes secretary from all your friends and associates on the fourth floor of Stark. typers scream, May Eddie's poster of you hit the And become dream. the campus's Have a lovely, lovely Valentine's Day. Love, Your Fans MlkeP., Meet me at Mars for Valentine's Day. Roz Mart "Hook" S. We love you, you're tremendous! Everybody! A very Happy Valentine's Day to Ann Marie, Mary, Joanie, Eileen, and most of all, Cathy. Love as always, Ron ToJoy, Happy Valentine's Day! I love you. Joe Cub, Happy Valentine's Day from all the gang, take us to a movie, hanna ! REG-GIE, See you in Maryland"Willis" �Dave, l's been a the best 81h months of my life. May you have a Happy Valentine's Day. Love, Kathy Dear Pat, Terri, Vicci, Sue, Lisa, Amy and even Janet (and all the other ladles who frequent the Writing Lab): May your commas never slice and your paragraphs never sag. Love, Frank DearCarol, We've only been friends for· a short time, But you've always been there to lend a hand, So take care of yourself and don't get down, because you have the greatest personality all around. Happy Valentine'sDay. Sally & Nettie K.A.Wbere willingness Is great, the dlfflculties cannot be .great. (MachiaveW). ~ · Happy Valentine's Day! Love, Joy Blossom, Wbenever ram away from you I reach out my love to touch you. And I know I can feel your love reaching back, I love you, Muffin ToS.E. andC.G. Happy Valentine's Day. The Magistrate ToJim, Valentines were a wonderful idea, we will never forget you. The Staff To Lisa, Did you and M.A. find any new racquetball positions the other night? Hope you find what you each are looking for. Pete · Happy Valentine's Day, Flash and Rooney! Let's play Spin the Bottle on Valentine's Day, it's much more fun that Colonels Quarters! ! Love, Mother Tucker I Devaney, I like your smike from ear to ear I wish you were staying another year. Smiles To "B.K.S." Happy Valentine's Day, Sweetheart. To the best kC Tennis player from his favorite space cadet. Dear Greg H., To the best l)j on WCLH, Happy Valentine's Day!! The "Who's That" Girl To the Tuesday and Thursday Sex and Smut Lunch Gang: I've never had so much fun at lunch time! Between the 16 inch fork and the big unit it's a wonder we ever get any lllDCh eaten! One of the Gang! Danny, I Love You today, tomorrow, always ... Happy Valentine's . Day, sweetie! !! !! Ma To our every growing, Crazy Lunch Table, We hope your Valentine's Day in the S.U.B. is great. Stay Sober (or atleast try) ! · C. andC.T. To M.D. and C.P .A. Happy Valentine's Day. From W. and P. Lou, Happy Valentine's Day! Love Drew Mother Superior, Hey honey, open your eyes and you'll see bow lovely you are. Why do you always put yourself down? You must know what a great person you are. Don't hide yourself in liquor or under a smiling face. Just be the beautiful person you are. Mother Inferior P.S. Why do you think you're Superior and I'm only Inferior? Think about it. Oh, Ob, Is it true? It's Valentine's Day!! To my man with the sexiest legs, ILOVEYOU Your Baby To our "Hero", Happy Valentine's Day! Love, T., S., and K To our one and only checkerboard square boy. From both of us. Happy Valentine's Day. ToOurFour: We hope you know, We would not go swimmin', With any other women. We have enjoyed this season, You four are certainly the reason. We hope you have more in store. We certainly do for sure. Will you four, Be Our Valentines. The Male Swimmers Stuff: How would you like to be my Valentine? Love Wans To all the fine ladles at the Registrar's Office: May you have a happy Valentine's Day and every day! I didn't forget you and I promise I will be in to visit. Don't work too hard Mrs. B., J~ and Molly!! Your former slave, Patti TO four I like: Ellen: "We don't talk anymore." Lisa: "Why can't we be friends?" Babs: "Where do I go from here?" Amy: "I'd really love to see you tonight." I'm wisbin', Frank To Bruce, Where do you get your supply of Ch~ck? May you never run out. What's your favorite Oavor???? Happy Valentine's Day Suzy Chapstick To all the guys at WCLH, Happy Valentine's Day to the best group of guys on campus. Belated Happy Birthday. Keep spinning those discs. Th cake was delicious, Fred! . Your best fan P.S. When are we going out for dlnner,Chrls? To Dave, Betty, Mark, Stew, Karen, Lisa and Mark A., Stop messing up the basement of the New Student Center so much, you bunch of animals! Love, A Big Turkey Happy Valenli9e's Day to Bill, Jim, Dave, and Bird Brain; · Three men and a bird who have made this year one of the most enjoyable by the gift of their friendship! Love, J.L.0 . Happy Valentine's Day to all my To "That Kid With The Red Hair" friends in Cbesapeak Hall. Good How can I ever say thank you for luck this semester.. all the times you've been there · Jennie when I needed a true friend . Stay the way you are! You're going to be To the drinkers of Cuuty Sark and a great president and P.R. ex- - Genesee on tap: ecutive! Happy Valentine's Day. Love, Think Blue Sky, "The Greatest Hair The Pack Stylist In The World" To Bobby, The "Great Spirit" may like a-' To the Asst. Station Manager, bearded Italian, but I think beards Is It true you really get more with are a sign of a weak chin. . Les??? Happy Valentine's Day. Happy Valentine's Day, Love, Anonymous Your Linguistics Lovers My ~rest KAKETA, To My Best Friend. May we always be friends, and share everything like we have in the past. Hopefully we will always be able to laugh at the crazy things we got involved in. Happy Valentine's Day, Sis. Love, me To the Spaniard and the Muppet Groupie!!!!! "Yous guys" are just great ! I can't wait to work with ya' next year! ! ! May you join me in a Mountain Dew - Gin Party soon!!! All I can say Is that you're a pair!! Love ya', TheTDRAlky To Bobby and Eddie in p .R.: A Happy Valentine's Day goes out to the sexiest Italian and the most dynamic redhead in Wecll:esser Hall!!! Keep up the fantastic work you do! ! ! Love, A Colleague from P.R. Happy Valentine's - Day to the Class of 1981 ! Dearest Edward White III, Best wishes and loads of kisses on Valentine's Day!! The ladles of the basketball statcrew. (keeping in line!!) Carol, Please don't be down. You are a beautiful person inside and out so don't let anyone tell yeu any different. Someday they'll aH see what I know, The Beautiful Person That You are. Kathy Te my oriental neighbor, CuteTo Larry and Rick Have a Happy Valentine's Day (Full of Valentine's). ASpecial Valentine to Dr. Ayres: I love your classes. Thanks. Love, Sab Happy Valentine's Day to the prettiest girl working in the Commerce and Finance Deparment MEG! Keep smiling 'little one'! ASecret Admirer. All my love to the ladles who inhabit Waller, Doane and Sullivan Halls. (Not necessarily in that order.) Shep Willner To Flipper and Orea, You are a splashing dive within our freestyle hearts. From, W.A. andJ.K. Cheap Trix make better lovers! Happy Valentine's Day .. To a great time in Accounting Lab That ls what we always have With 4 problems to do, he only getsldone This could be because we have so muchfua. 'Ibis guy ls in our law class too His appearances are very "few , We think this COllld be An 8 o'clock class ls a bit early. We wrote this poem so you would be thought of today And also to say "Happy Valen. tine's Day"! Dearest Shu-Shu Bear, I love you truly, I love you do, AndinMay I'll marry you. Love, Mary .ToD.M., 3-1 CWJ ToBillN. Happy Belated Birthday! Your Friends To Brad, Even though we're miles apart, my love is always with you. Happy Valentine's Day. Love always, Janice To the "Petite" Italian in P.R.: What can I say but - you're the very best friend I've ever had!!! You're the best Cin' ! Love, 'Margo' To Sharon and Charlene, Happy Valentine's Day to two great and crazy friends. Nancy To a good friend named Lou We think the world of you We're all very close, let's stay that way Hope you have a "Happy Valentine's Day!" Forever frtends, MandL Dearest Danelle, On lover's day I wanted to let you know that: ILYVM Mark To Doc, Button Nose, Chapped Lips and Ignorant, You are the biggest J.C. fans I know. May we all get together again soon and bring home an even ltigger one!!! Hopefully, we'll never see Mr. Charisma, Harry Handsome and Patches again. But lt'sa big YES fer Wes! Happy Valentine's Day Acid Tongue P .S. Enjoy those full moons, Doc! Colleen, Norm, Margaret and Bill DearG.W.: Will you be my Valentine? If not, I'm up for grabs, and You can imagine bow grabby 10,000 can be! Love,Cbucll: G.G. Will You Be My Valentine? Wailing for an indication, L.T · Happy Valentine's Day to the best darn group - Norm, Dr. Kinney, Darlene, Davida, Darrell, Jon, Patti, Karen, Michele, Betty, Greg, and Fred! Let's get them at States! CMG Hey Babes, Your Animal Loves Ya! Met ToEdH.Jr. Happy Valentine's Day, Punkin. I love you. Forever and always, Your Little One. Honey: I pay Wilkes five thou a year and, All I do Is drink the beer I drank so much I've ruined my health Because of Wilkes I'll kill myself And when I'm gone it won't be funny Because I'm dead they'll lose my money Need you badly. Love, Chuck To Big and Bashful, I think ·you're cute I think you're sweet The two of us should really meet. Love, Small and Basbfull To Pete and Louis: May your smut-brains and trenci.;mlnds stay forever crazy!! It was fun in the closet, Pete! Louis you're next!!!! Ten Guesses! To Danny Gh1nk, That love of all Is on this day. I wish It might forever stay. Happy Valentine's Day. Hey Cowboy! I love ya, Honey. Happy Valentine's Day! Love Always, To Carol, · Just remember all you need are black roses, white rhythm and blues and someone who cares when you lose. Wecare: · Nettie, Sally & Kathy Puddln'Cheeks Peggy �February 14, 1980, The Beacon, Pag~ 7 Basketball Game Violence Upsetting To Cheerleader To the Editor: . As a Wilkes College Cheerleader I was extremely upset about the outcome of the Scranton-Wilkes basketball game. I realize there · was alot that influenced this fight, but I don't feel violence should be thrown into sports as a means of relieving tension, or to get your point across. The fans, for one, were very obnoxious. Many Scranton fans were behind the Wilkes Cheerleaders and they were nasty to us right from the start. I am not saying Wilkes fans were angels but being nasty and disrespectful to the cheerleaders is uncalled for. I only hope our fans do not engage in this, and will lead in spirit - not violence. Free Tutoring Now Available . At Writing Lab To the Editors: We realize the difficulties you face in publishing a weekly newspaper as well as keeping up with your responsibilities as students. However, we cannot overlook the gross incompetence of· your editorial staff. A college newspaper should serve as a reflection of literacy on campus. We are appalled at the quality of writing in this newspaper and are ashamed as students that this newspaper represents the journalistic capabilities of our school. Therefore, we urge you to seek tutoring. A free student service is provided in room 257 of the Stark Learning Center. We will be more than willing to help. Sincerely, Dan Patronick Writing Lab Staff P.S. We never knew Weiss' window could walk. I feel the players on both sides got out of hand also. Can't people get their aggressions out without curs- , ing arid fighting? It puts a damper on the game, and it really isn't necessary. I believe the coaches should be able to control their teams but this did not seem to be the case. Most of the blame I would put on the referrees. You had to be blind not to realize this. They seemed to prom.9te this violence. In closing I would like to say whether a team losses the players and fans should go home satisfied that there is school spirit. The fans actually clapped when we did a cheer! It only makes us feel bad to realize this occurred due to Scranton clapping for their girls. Can't this school get some spirit up? Support your school. Be proud of it. It's great to fill the stands up, to yell, get rowdy, stamp feet, and clap hands. Go to the games and have fun. With the outcome of this game, I'd say both teams were losers, and that's sad. Let's try to be winners from now on, and influence the other teams to show respect and spirit also. Sincerely, · Bobbi Lou, Hamilton Reader Gives Support To Colleen Gries To the Editor: To Still Another Concerned Student: Last week you commented that Colleen Gries, Junior Class President didn't deserve all the recognition she received. First, I believe that the article and letter were not intended·to make her a saint, just to give credit where credit is due. Second, if you had known the whole story, Concerned Student, you wouldn't have wrote that letter. I know for a fact that Ms. Gries did, in fact, check for the film, but not with the right people, as her mistake was to trust Student Government. I believe, that it was the responsibility of SG's Film Committee to make sure the film arrived on time. I think the college is lucky to h~ve people like Colleen Gries who are willing to go out on a limb to make sure an event does not fall through. You stated that this mishap is no different than any others associated with various activities. Well, Concerned Student, I think it is quite different. Driving to New York to get a film is hardly comparable to going to Deckour's because the party is out of beer. Furthermore, you try to second- GriesAUack Unwarranted; . Reader Decries Criticism . To the Editor: I usually enjoy reading Letters to the Editor in The Beacon but was very distraught over the individuals who bitterly and viciously attacked Colleen Gries. Also, as a concerned student who is mildly involved in Wilkes College; I realize how much effort is put into events, such as the Junior Surprise, and how they provide an outlet from strenuous routine studies. It seems that this unwarranted criticism of.the Junior Class President is not constructive. I suggest that when an individual talks like sour grapes, without constructive criticism, he or she should keep it to themselves. Don't be jealous over a go-getter and talented president like Colleen, just be happy you have . one. One with a progressive outlook MANAGEMENT OPPORTUNITIES OPENINGS IN SCIENTIFIC/TECHNICAL/MEDICAL AND GENERAL MANAGEMENT Uniformed Mllltary Dlvlsl_o ns of the Department of the Navy have some openings avaHable. They Include: SCIENTIFIC/TECHNICAL MEDICAL Aviation (Pilot training and RN / MD/ DO/ DD/ DDS/ Systems Maintenance) Allied Fields Computer Programming/ GENERAL Technology Accounting/ Finance Engineering (Civil / Marine/ Administration / Personnel Mechanical / Electrical / Electronic) Transportation Nuclear Power Operation/ Operations Instruction · BENEFITS: Personnel can expect an Ocean Systems/ Divi ng and Salvage excellent benefits package which Oceanography/ Meteorology includes 30 days annual vacation, QUALIFICATIONS: Minimum generous medical / dental / life BS/ BA degree (college juniors and ·insurance coverage and -other taxseniors may inquire). Federal free incentives. Dependents benefits regulations require that applicants be are also available. Extensive training no more than 27 years old (adjustable program is provided. A planned up to 3 years for Veterans and are · promotion prQgram is included with a requirements vary for Medical commission in the Naval Reserve. Program). to ensure full opportunity PROCEDURE: The Naval Officer for career advancement. Relocation Information Team will be on campus overseas or domestically required . in the near future. Sign up today for a Applicants must pass rigorous mental personal interview at the placement and physical examinations and office or call 717 / 826-6292. Equal qualify for security clearance. Opportunity Employers, U.S. Citizensh ip Required. guess Colleen Gries' motives, imdon't get the publicity that Ms. plying that she did it for the glory. Gries received. Well, Concerned Spending an entire Friday afterStudent, if the quality of your innoon on the telephone with --... volvement in campus activities is everybody and their brother, and anything like the quality of your letrunning to New York in inclement ter, I can see why you get no weather is hardly glorious. publicity. Finally, your letter smacks of Sincerely, . jealousy because, perhaps, you Concerned Student Ill Winter Olympiad Praised By Se'ueralParticipants To the Editor: We, the undersigned, would like to express our sincere thanks to many of the people who made the First Wilkes Winter Olympiad possible and an overwhelming success. To Student Government and the Social Committee, a job well done. The entire weekend was one that many of us will long remember. This act will be a hard one to follow. To the majority of the judges who rendered fair decisions, our appreciation. To the others; oh well, we all have our values! To all the teams that competed fairly and in the spirit of good sportsmanship our thanks for providing excellent competition and above all, fun. To the victorious First Place ·team, we acknowledge your excellent play, sportsmanship, and competitive agression. You have taught us all a lesson. You should be proud of your accomplishment; winning is not easy, in most cases. We all hope you enjoy your award because we know you justly deserve it; our congratulations! Signed, Luxembourg Italy Canada Bangledesh Guyana Austrailia Saudi Arabia Sweden . United Republic of XLAX Iceland Finland France NOTICE On Thursday, Feb. 21, the Cooperative Education Staff will be in the lobby of Stark Learning Center from 11 :00 to 1:00 to discuss Summer and Fall job placements with interested students. NOTICE The deadline for application for graduate assistantships is tomorrow, February 15. For more information contact Mr. John Meyers at the Office of Continuing Education and Graduate Studies on thesecond floor of Parrish Hall. KIRBY HEALTH CENTER ANNEX 63 N. FRANKLIN ST. WILKES-BARRE 824-8921 MON.-FRI. 8:30 a.m. to 5:30 p.m. Evenings by Appointment Conf idential services available· regardless of, age, sex, marital status, or ability to pay. �Page 8, The Beacon, February 14, 19841 Business Educ. Focuses On Mastering Skills "The Business Education Program offers extremely useful preparation for careers, which the students sometimes don't appreciate while they are students." Linda Glordano, an assistant professor in the program, stated that the courses are open to all majors, ·not just business students. · The foundation of the program is set up in order to prepare students for careers as secondary business education teachers, although students are not locked into receiving teaching certHicatfon. This program places emphasis on mastering the operation of an office in the skills area, rather than on theory, as does the Commerce and Finance Department. In other words, they get dowri to the nitty gritty. For years, the Business Education Program was a part of the Commerce and Finance Department, located in Parrish Jlall. Two years ago, they were moved to Butler Hall and are now found in the Educaiion Department. Miss Giordano stated that she has worked hard with this program, and in the past two years it has undergone numerous changes. The prograrµ can now boast of between 25 and 30 · majors. They are also hoping to offer a minor in Business Education. Dr. Eugene.Hammer, Chairman . of the Education Department feels that a general, well-rounded; basic education prepares the student better than a highly specialized one. "The more specialized the program is, the less valuable it is,'' he stated. Thus, the program sets up the student for job-seeking in numerous areas of business such as executive secretary, office manager, legal secretary, and teaching. This program offers very versatile career programs and Miss Giordano stated, "The versatility of the program is its best feature." Indeed, the program offers courses ranging from basic typewriting and shorthand to Business Correspondance and Reports to Cobol ·and Business IEIIVE campus. This organization is the college rendition of high schools' FBLA (Future Business Leaders of America.) and gives students the opportunity to learn about the business community as they prepare to become part of it. It helps students to lead and par' ticlpate in group discussions; preside at meetings and conferences; and work effectively in committees. This year, the Business Educa- Check our complete stock of Cliffs Notes for the help you need in understanding difficult" novels, plays and poems. Millions of students use -them to earn better grades in literature. Law, along with the usual core requirements. There are also in the process curriculum changes to be submitted to the Curriculum Committee in February. Some of their facilities include a model office (Butler, Rm. 16) used for word processing activities, and typewriting, shorthand, and 6ffice procedures classrooms. Miss Giordano would like to star.t a Phi Beta Lambda Organization on Kingston, Perm. Lisa Gurka . RETURNING TO · WILKES COLLEGE BY POPULAR DEMAND Spring 1980 COIl Cert & LeC t Ure COfflffll · •t' t ee ·p1 R_DS · Cultural Events The Wilkes College Concert and Series Committee is a group formed to foster "diversity in cultural events," according to student chairman John Andrake. Another function of the committee is to serve the· community and thank the people of the commlDlity for their-support of the college. The committee, which is composed of students, faculty -and administration, organizes each event in order to maximum exposure of their guests. These events may be academically oriented, Like a lec ture, or may be culturally oriented in the areas of music; theatre, or dance. The next event the committee is sponsoring is a lecture by Malcolm Forbes, Jr., on February 'l:l at 8 P.M. intheC.P.A. - Lecture 0 CalJ Days Evenings & Weekends (215) 435-2171 1524 LINDEN ST. Allentown , Pa. 18102 Educational Center TEST PREPARATION SPEClALISTS SINCE 1938 CLASSES START Sunday, Feb. 17th REGISTER NOW TO RESERVE A PLACE IN CLASS ATTENTION SCIENCE AND ENGINEERING MAJORS! The Air Force has openings for young men and.women majoring in selected science and engineering fields . Like Aeronautital. Aerospace. General and Electrical Engineering. Mathematics. Physic and Com- puter Technology. To help prepare for one of these. Air Force ROTC offers two and four-year programs of study which will defray some of your college costs. After completion of the AFROTC requirement. and upon your gniduation. you'll be commissioned an officer in the Air Force. Then comes . responsibility. experience in your specialty with some of the best people and facilities in the world. and a mission with -a purpose. You'll get excellent starting salary. medical and dental care. 30 days of paid vacation beginning your first year. and more. Look into the Air Force ROTC program right away. See what's in it for you. See how you can seive your country in return. Youll be glad you put your major to work on a job that really counts. Sophomores!!! Ask atM.ut our "Hip Pocket" schelarship. Call Captain Johnson at extension 371 or 372. GET CLIFFS NOTES HERE : The Tudor Bo.>k Shop 651 Wyomin!) Ave. scientific method of teaching and will speak on it. Jack Heller, a second speaker, is a teacher, author and inventor. He ls also the recipient of the 1979 Eastern Business Education Association's teacher of the year award. Mr. Heller has been successful in teaching typewriting to the handicapped and in developing programs for the physically and neurologically impaired. Linda Giordano CLIFFS IITES. tion Program in conjunction with the Greg McGraw Hill Book Co. is sponsoring their second annual conference which will take place on Saturday, March 29 in SLC 101. The conference includes a continental breakfast and two speakers. One of the speakers, Cortex Peters, is an author, lecturer, and teacher. Over the past three years, Mr. Peters has taught 100 students to type 100 words per minute, with no errors. He has a book out on his BOTC Gateway to a great way of life. ' . �February 14, 1980, The Beacon, Page 9 rough games put together and was w ran w e raw ro e ou , leveled Capin with a punch in the not1reboundign as well as he should spit on Capin and a few other Colface. Then all hell broke loose. Inand with Wilkes losing three in a onels thoughout the contest but the cluded in the brawl was Royal Bob row, Righter decided to make officials were intimidated by the Gehm getting smacked in the head another lineup change and that is All-American and nothing was calland Scranton's trainer attacking why Capin started. ed. Johnson might be a fine basketKendall McNeil. Officials Jack Bessior and Capin was put in to ball player, but he is a total zero Sberna and Bill Hartshorn ruled the start a fight, but the fact remains when it comes to being a person. the first punch was thrown by a Johnson, like the rest of the ScranScranton Royal (Crockett) and he ton organization, has no class. was in the game a total of :30 when This is not the first time Wilkes he hit Capin. "rm really upset over and Scranton have become involvthe remarks of Coach Bessior say- ed in controversies. A few years ing we purposely put our players in back, former Wilkes baseball coach the game to start something," said Gene Domzalski had problems with Righter. 'The first punch came the Royals when a Scranton from one of his players who was in baseball player tried to stall a the game exactly :30 seconds. Now game (it was getting dark), and just who is starting what? Is : 30 went to the plate with a flashilght long enough to make someone taped to his helmet. It was a bush angry enough to hit another person. move, but what can you expect I don't think so. from a bush school. Capin suffered a broken nose and AD John Reese has sent a letter will miss the rest of the season. to Scranton AD Gary Wodder, who Gehm, who was hit in the head and incidently was seen at the Wilkessuffered a mild concussion, spent Scranton game at Scranton weartwo nights in the hospital. A few ing yellow shoes and an earing. Lot other Royals had scratches, but of class, right? Anyway, Reese's Capin and Gehm were the only two letter told Wodder how the only hurt. time Reese must order security for "It was a cold-blooded _punch " a game is when Scranton comes --· ,; __ ,__ here for basketball. Never, at any other basketball games or wrestling matches, does trouble occur. It only happens when Scranton comes to town. we· can remember a few years ago when Royal fans came to the Wilkes gym and smuggled beer bottles into the gym and smashed the bottles under the bleachers while the game was in progress. Scranton is getting a reputaton around the Wilkes-Barre area as a "bandit school" and they're not doing that much to stop it. So there you have it. It was ugly, it was a brawl and both teams are to blame. But is was mostly the - said - - Righter - - - - of- Crcokett's - - - - -delivery. - - - - fault of the two officials who let the "He hit him and ran. It was a game get out of hand. Incidently, sucker-punch." Another terrible the one official, Hartshorn, is the sight in the brawl was Scranton's same one who refereed the Wilkestrainer John Robertson coming off Bridgeport game this year. And the bench to attack McNeil. He why should we bring that up now? jumped on McNeil's back before There was also a fight in that game. the Colonel could throw him off. Officials, .who can't control a game, Robertson, who behaves like a should be thrown out of the league. . You can count on one hand the mamac at games, has a history of number of good officials in the MAC acting up at Royal games. He was this year. the same guy who threw a full water bottle at the scorer's table at We must commend WBRE-TV's halftime at a King's-Scranton game Kevin Lynn for his coverage of the two weeks ago. He also threw a ball fight. Lynn interviews both coaches which hit a Wilkes cheerleader, at the day after it happened and Scranton earlier this year after a presented both coaches opinion on call went agiinst Scranton. Robertthe issue without offering a person is typical of the Scranton famisonal note. Lynn did a great job. -ly. He has come under fire from In our opinion, Bessior has no · Scranton officials for his behavior. control over his players. He lets A few days after the event hapthem do what they want. He says he pened, Scranton and Wilkes-Barre didn't even see Crockett punch papers explained that the Wilkes _ Capin. He's the only one among the _players forced th~ fight with their l,500 that didn't. He says his 704 S. Main Street rough play. It is a fact that BOTH players act like men. Yeah, spitting Cor. S. M.tin & Pwish St. •· t~ms played rough, BOTH teams at the other team is like a man Bob. 824-4907 threw elbows and BOTH berated But how can you trust somebody each other, and it is also true that that wears beads and madallions . .COLD BEER BOTH teams were partially to Ron Righter does not want to play Barrels-½'s-¼'s blame. But is was the spitting•of the Scranton anymore in basketball With Taps Scranton players, namely Irv and we dont' blame him. They're Johnson, that was the lowest part of bad news up there. -DRIVE-IN SERVICEthe berating of each team. Johnson, bttwttntht llnts Ron Righter , , CITY BEVERAGE CO. SUN FEB.2 7:00,P.M SOFTBALL TICKETS: $6 .00 PAPERBACK ROOKSMITH (IN THE VIEWMON'r MA I.I.I SPRUCE RECORDS (SCRANTON) JOI:: NAROONE'S GA LI. ERV Of SOUN D (WYOMING VA I.U.:Y ,.IALL, OOWNTOWN WILKES.BARRE , EUWARDSVILLI::) AND ALL @nOIEfflON OUTLETS SOFTBALL MEETING Coach Nancy Roberts has announced that there will be a meeting for all 1980 softball candidates on Tuesday, Feb. 19 at 11:15 a.m. at the Weckesser Annex. If you plan on playing and cannot attend, see coaches Roberts or Meyers. SOFTBALL '"' �Page It, The Beacon, February 14, 1980 Colonels J.:ISdO Penn State The final two weeks of the 1979-80 Temple, Hofstra ·and Rhode Island dual wrestling season is already follow respectively. Third is the here and the Colonels of Coach John highest ever for Wilkes. G. Reese appear to be peaking at After knocking off Penn State, the the proper time. Colonels should appear in the "Top Last week the Wilkes matmen 20" of AWN or NMN, but don't hold turned back Eastern rival Penn your breath. There were two other State University 20-18 at aemptimes that our Colonels were left steak, Long Island, N. Y. These vicout and should have been rated. If tories raised the Blue and Gold's the Blue and Gold is overlooked record to 14-2 and extended their again, it will get a "Golden Opwinning streak to a "lucky 13." portunity" to gain respect by makMore importantly, our Colonels ing strong showings in the Eastern showed an honest effort at gaining a Intercollegiate Wrestling AssociaNational ranking. In the most retion and the National Collegiate cent edition of Amateur Wrestling Athletic Association tournaments. and National Mat Views, Wilkes · The EIWA event is slated for was unranked (again). But the Blue February 29 to March 1 at Lehigh and Gold received recognition from University while Nationals will be the Eastern poll which was releas-. held March 13-15 at Oregon St. Wilkes will be shooting for a top ed last week. Lehigh University (of course) place finish as the Colonels took seleads the field with 90 points while cond to Lehigh last winter. Clarion St. (Rose Bowl winners) The freshmen grapplers qave are in the runner-up spot.with 80. been coming through with big vicWilkes is in a modest third place tories for Coach John Reese and with 64 points and the Bloomsburg rnust be considered an important .fluskies are fourth with 59 tallies. link to the recent success. They inPenn State, Nayy, Slippery Rock, clude K!fs Rowlette. Mark Popple, · Lenny Nelson, Mark Troutman, Rick Sampson and Pete Creamer. Leading the Colonels over Penn State were Popple, Nelson and Troutman. Senior Bob Matzelle, Lindenhurst, N.Y., was the real hero, defeating his opponent 5-2 in the unlimited tilt to clinch the Colonel victory. Bart Cook, senior cocaptain from Neptune, N,J., also turned in an important decision when he handed Lion's Andy Bingaman an 11-8 setback. The State College crew took the lead early with a 5-2 decision over Kris Rowlette, but freshman Mark Popple, Wilkes-Barre, got the ball rolling with an impressive 12-2 major decision over Steve Bass at 126. Popple recorded the opening takedown and immediately started working for the fall. Our fans were excited and after Popple's display, the pace was set. Bryan Billig, a junior from New Tripoli won a hard-fought 7-5 decision over three-time N.Y. State Champion Bob Bury in the 134 class. Billig scored the initial takedown and rode Bury out for the first period. In second gefiod action, Billig scored a reversal and Bury manged to escape making the score 4-1. Midway through the second, Bury took Billig down to narrow the score to 4-3, Billig. The Lion then took the lfiad with a reversal 5-. blame as they et the game get out It's wait until next year for the 4 but Billig retaliated with an of hand. Wilkes men's basketball team. escape with just :17 seconds re"We don't consider the Scranton When FDU Madison nipped the Colmaining and was awarded one point game a loss," says head mentor onels 54-53 this past Saturday in for riding time. Ron Righter. "It might appear as a Madison, N.J., it. ended all playoff Freshman Lenny Nelson, loss on paper, but in our heads it's hopes the Blue and Gold had of getRichland, N.J., matched talents an uncompleted game. We won't ting into the Middie Atlantic Conwith Bernie Fritz, in a 3-3 draw at . know for a while what will happen ference tournament. 142 to make the score 9-5 favor with the game, but I doubt the ofThe Colonels took a 9-11 overall Wilkes. Mark Troutman, Toms ficials will change it." mark and a 5-7 league slate into River, N.J., won his 142 fray when The Colonels, still hot from Monday's non-conference game he escaped with :15 seconds reWednesday's controversial with Lock Haven State at the maining for a 12-11 decision over meeting with the Royals and missWilkes gym. This Saturday, Wilkes Bernie Fritz. Senior co-captain ing the services of Capin, who is out will host Juniata C-ollege in its final Mark Densberger, Danville, suffor the year with tlie injury suffered MAC game of the season before fered an 8-6 verdict to Geoff by the blow from Crockett, went to meeting Bloomsburg State on MonBroadhead at 158 and freshman day at home to close the year. FDU Saturday. Rick Sampson, Westfield, N.J. Telling it like it is, the Colonels Wilkes, after Saturday's loss to dropped a 4-0 decision at 167 and the FDU, was on a five-game losing were "homed"all the way home. spectators watched Penn State skein and had won only five of its FDU outshot Wilkes at the foul line fight back to a 12-11 deficit. After 3I-9 and had had five fouls called last 11 outings. Cook won, junior Rick Smith, against them in the first four Since the last Beacon, Wilkes met Walden, Vt., lost a 10-9 heartminutes of play. Wilkes outshot Scranton in a war on Wednesday breaker to Dan Pfautz at 190 by one FDU Madison from the field of 24- point riding time. before traveling to meet FDU on 18, but FDU converted 18 of their Saturday. In the Scranton game, Leading by a slim 15-14, Matzelle free-throw attempts to take the win. put the icing on the cake. which was called early because of a FDU's James Jackson hit two brawl, Wilkes had four men reach Two pins turned out to be the key double-figures: Mike McCarrie 16 free-throws in the final :04 of play to victory over Hofstra, as each to earn the one-point win 54-53. Only points, Pat Mccue and Tony Madteam won five of the ten contests. :20 before, Wilkes had taken a oneden with 14 apiece and Kendall They were recorded by Billig at 134 point lead on a basket by freshman McNeil chipped in ten. and Troutman at 150. Billig's pin Greg Marshall, who had a super was over highly-touted Lou Dionisio The Scranton game was called by referres Jack Sberna and Bill Hart- game off the bench. With :06 reand it marked his ninth fall of the maining, FDU forced a shot and season and lifted his record to 14-2. shorn with :48 left to play when a missed. Officials incorrectly ruled · Troutman decked his foe to raise bench-clearing brawl broke out the ball went off a Wilkes player when Royal Errol Crockett decked his dual log to the 10-2 spot. and awarded the Jersey Devils the Colonel Dave Capin to start the The highlighted bout of the evenball under their own backboard. ing took place at 190 when Smith fight. If the game had been continued, Wilkes probably would have Jackson was fouled on a field goal battled to an 8-8 deadlock with attempt before moving to the line to Hofstra's Aurel Balianau. The Dutbeen granted four free-throws via hit the game-winning free throw chman took advantage of a hightwo technical fouls because of the tosses. Marshall's last second off. scoring third period to knot the punch and possession of the ball. glass jumper missed as time ran score. Balianau was a runner-up in This is important because the Colout. onels were behind six points when the Wilkes Open Tourney. Smith Three Colonels fouled out in the has a record of 12-2-2 at the 190 the game was stopped. game (McCarrie, Walker and Mad- pound category and is aiming at an At any rate, Coach Ron Righter den ) as the Blue and Gold had 26 EIWA trophy. and AD John Reese have contacted fouls called against them while officials at the ECAC and MAC and After Rowlette lost the opener to FDU was whistled only 15 times. Al Destefanis 12-6, Popple started no one knows for sure -what will McNeil led all scorers with 16 the ball rolling for the Wilkesmen happen. tallies while Walker, playing · '1is with a lo-4 decision at 126. Popple Since "fight-night" many people home state, chipped in 12 and 1- :·llel, has been enjoying a fine season at have come out and given their down 13 rebounds. Madden adctt:0 . 126 and boasts a 7-3-1 slate, but he views of just what happened. Check nine points and 11 rebounds and Mc- may wrestle at 134 in the EIWA's "Between the White Lines" to see Carrie was held to only four points. since Billig is cutting to 126. how the Beacon saw things. It seems to us, the officials were to Con't. on page 15 Another freshman, Lenny Nelson ait UntilNext Year ------- met stiff compeition and dropped -an 8-3 decision to Hofstra's Mike Hogan at 142. Nelson, with a 5-2-1 record is also bidding for a varsity position for the Eastern's and has the capabilities of placing. Dan Miner, a junior from Chambersburg, Pa., returned to his varsity post at 167 but dropped an 11-6 decision to Hofstra's tough Billy Keck in his rehabilitation ,bout. Miner watched his dual log drop to 5-5-2 on the year. At this point in the meet, Hofstra appeared to be makign a comeback as the score was 15-12, favor Wilkes. Cook turned the momentum to •the Colonels with his 14-10 come-from-behind decision over Marty Schlacker at 177. It was the ninth win registered by Cook and this record stands at 9-2. Matzelle suffered a 15-6 major decis . . . slate is 12-2. The Reesemen were expected to defeat Bucknell University last night in Lewisburg and raise their record to 15-2. Saturday with be the last chance to see the Colonels in action at home. Wilks will be entertaining the Diplomats of Franklin and Marshall College at 2 p.m. at our Gym in an effort to extend the series advantage to 7-1. In last year's fray, the Blue and Gold triumphed 37-7. · Top matmen for the Diplomats are Dave Mailes (118), John Mousetis (126), Brian Brown (134), Kevin Brown (142-50), Bill Meyers (190) and Craig Blackman (190Unl.). Looking ahead, Wilkes takes the road to Virginia to wrap up the dual season with a quadrangular contest with Virginia Tech, Richmond and Old Dominion. Gaetano Prepare . For · April ExQms ! LSAT • MCAT • GRE GRE PSYCH • GRE BIO GMAT • DAT• OCAT • PCAT VAT• MAT • SAT NAT'L MED BOS ECFMG • FLEX • VOE NOB • NPB I • NLE ~-+t IUIPIAN EDUCATIONAL CENTER le~t Prl'p.irat,on Sµcr,.111\t~ Sine e 19 38 · Please Call Collect for Information - (215) 435-2171 Masonic Temple Bldg. 152-t Linden St. Allen-town, Pa. 18102 Classes Formin Now! �February 14, 1980, The Beacon, Page II Having A Good Year, Swimmers Dunk Elizabethtown The Colonels' swim team picked up a win and a loss in action last week, bringing its record for the season to 3-4-1. By a score of 64-40, Wilkes lost to cross town rivals King's College at King's last Wednesday. On Saturday, the Wilkes squad overpowered - Elizabethtown by ·a score of 63-42 at Elizabethtown. Despite the loss to King's, freshmen Dave Gergen and Reed Bello turned in good performances for the day. Taking two second place finishes in the 200 and 500 yard freestyle events, Gergen also broke his own team records in those events. His time in the 200 was 1:57.5 while clocking a 5:24.6 in the 500. Gergen is looking good for the MAC championships which are next weekend at Ursinus College. Reed Bello was again the master on the diving board taking two firsts in the required and optional events. He tallied an impressive 210.50 points in the optional diving event. Scoring other points for the Colonels' effort was Enrico Ratti who took second in the 50 yard freestyle and third in the 100 yard freestyle. Jim Edwards finished second in the 100 yard freestyle. While both swimmng and diving, Perry Lichtinger earned thirds in the 50 yard freestyle and optional diving events. Michelle Maguire captured second and third place finishes in the 200 yard butterfly and 500 yard freestyle events respectively. Kim Bl,ISh finished third twice, once in the 200 individual medly and the other in the 200 yard butterfly. Swimming on their back as always, John Moffatt and Pat Slowey finished 2-3 in the 200 yard backstroke. Rob Doty took a second in the 200 yard breaststroke as did Peggy Butchkavitz in the 200 yard freestyle. Frank Gardner took a third in the required diving event. Versus Elizabethtown The team's first " big" win came last Saturday as the group traveled to Elizabethtown to win wiUi a score of 63-42. Jumping into the lead after the first event, Wilkes won the 400 medley relay with Moffatt, Doty, Bush and Ratti. It was the first time all season that Wilkes did not lose that race. Taking individual first place finishes were Gergen in _!he 100 N. Y. STYLE PIZZA and SUBS' at ANTONIO'S "Oven Fresh" You've tried all the rest, Now try the BEST!!! Located Right Across the Bridge, in the Narrows "NUMERO UNO" Phone 288-7663 or 288-7664 for advance orders -STROMBOLI-SUBS-SICILIAN -REGULAR maxell · @T'Dt< r-· -- ----' 1 , SONY AMPEX ; AUDIO and VIDEO LON EVERYD\Y PRICES! 'tOU DON'T HAVE 10 JOIN A"CWB"OR At\Y US FOR lHE PRIVILEGE OF BUYING FROMUSBUYONEORONEH~DRED.COMR\RE! WIDEST SELECTION OF 10P BRAND NAMES AT lHE ARE,6;S LONEST PRICES. 111■11'1 ELECTRONICS CENTERS SCAANT0N t Aau,..&, ~ ~ ~ ~ - -,. / Mo,,. t:a Fro. '10-B . S.t:. 't0· !5 K l ~ / a07W_.;ng - ., K ....&onec.,-._. / -...,&T...-..10-a · Tue• ~ - •&...,.i. 1ID~ !5:30 - - . 10- & yard freestyle, Edwards in the 500 yard freestyle, Doty in the 200 yard breaststroke and Bello in the required and optional diving. Gergen and Edwards also finished second in the 200 yard and 50 yard freestyle events respectively. Butchkavitz took a second in the 200 yard individual medly as well as in the 500 yard freestyle. Peggy is another one to look for at MAC's this year. When she finally competes solely against women, she should place very high. Slowely . took a third in the 200 yard freestyle as Ratti finished the same in the 100 yard freestyle . Taking a second and third in the 200 yard butterfly were Bush and Megan Caverly. Diving optionals for the first time, Frank Gardner did fairly well few steps on the van. .What an inferno! . . . Frank Gardner finishing second. He also took a sedemonstrated an unbelieva ble efcond in the required diving as well. fort in the 400 freestyle relay Swimming his personal best this year, Alan Shaw took a second in · against E lizabethtown. If everyone on the team gave as much·as Frank the 200 yard breaststroke while John Moffatt took third in the 200 did we might see more improved times. Right John? . . . Megan backstroke. Swimming SUNY Binghamton Caverly can't wait to get her t-shirt yesterday evening, the Colonels back from the imprinters. Hey will face Susquehanna University Megan, tell us what "buoys"-means this Saturday at King's pool and . .. Butch Kavitz is afraid that someone will put " ankles" on hers. East Stroudsburg next Tuesday, which is also at home. That will be Hey Peg, be thankful we noticed ... the final meet of the season for the Dave Gergen is still trying to figure team. MAC Championships will be out if he is home ' or away this the weekend of February 22-23 at weekend ... The team looked great at the Beach Party last Saturday. UrsinusCollege. Added Extras: To the beat of Way to go people, a team that par" Bum Baby Burn," Alan " Disco ties together drowns together. Flipper" Shaw taught the tea m a LADIES BREA-K RECORD "We hurt ourselves last week by cold-shooting in the first half. If we could have played aggressively against Bloomsburg State and Scranton early, it may have been a little different." Those were the words of firstyear Wilkes College women's basketball coach Nancy Roberts after her team suffered losses last week'to Bloom and "Duh U." "We dug our own grave in those two games," added Roberts. The lady Colonels s_uffered through a 1-2 week before earning a win over L.C.C.C. to break the school record for most victories In one season - 13. In the Bloom tilt, the Division II lady Huskies pulled away early and were never really challenged the rest of the way. At halftime, Bloom held a 46-24 lead in a game played on their owri home court. · The Colonelettes did pull within five with an effective full court press, ala Ron Righter and the men, but ran out of steam. The final score was Bloom 79, Wilkes 63. For Wilkes junior Diane Kendig tallied a game-high 35 points while senior Mary Jo Frail added 12 and senior Lynn Yedlock pulled down 16 rebounds in the loss. It was basically the same story against " Duh U" otherwise known as Scranton University. The lady Royals, guided by first+ year coach Mike Strong (he was asst. men's coach year ago), jumped out all over Wilkes and did not stop to look· back as they coasted to a 73·38 victory. Wilkes also lost its captain Diane Kendig for most of the game when the All-American candidate went down with an injury with 12 minutes left in the game. The injury was diagnosed as a bruised hip and it was thought Kendig would miss a few games and maybe the rest of the season. She did, however, play on Saturday against the Minutemaids of L.C.C. Kendig finished the Scranton game with eight points. Frail led Wilkes in scoring with ten tallies. Freshman Stacey Keeley and Lynn Yedlock combined for 19 rebounds. On Saturday afternoon, the Colonelettes traveled to Nanticoke and defeated an always-tough L.C.C. team 47-46. The win was Wilkes' 13th on the year which gives them the most wins ever by a girl's B-ball team at Wilkes. It was the first win for the ladies over LCCC in 12 years. Wilkes again did not play well. "We have to get scoring from more people," says Roberts. "In the last few games we've played only four people per game have scored." The rookie coach's words held true again last LCC as Diane Kendig pumped in 20 and Yedlock canned 12. They only other players in the scoring column were frosh Diane Hall with eight and Joanne Bowling The two early season frontrunners, the Avengers and Bud's, were both embarrassed last Friday in .the Wilkes College Mixed . League. Poky's (John Yudichak 189-504 and Kathy Kulp 166-459), though sweeping the Avengers, were not able to keep them from retaining a two-game lead in the Pacific Division over the EE's (J oe Rauschmayer 184-490) and the BS'ers (Jim E dwards 180-486 and Colleen Darrell 129-361) who both stand at 6-6. Bud's was not so lucky, their 1-2 loss to the Assorted Nuts <Dave Samsel 180-468 and Martha Lasco 151-436) dropped them out of first place in the Atlantic Division for the first time this season, because Guy · Zehner's 195-546 helped the Mother Brothers sweep the Pack and rise to the top of the division. The Midwest Division continues to confound the experts. No one has figured out if the competition is tough or if the five teams really aren't that good ; however, the Aristocrats (1~2 vs. the Vets Club I, Rod Wyffels 234-593) and the previously mentioned Nuts lead the division at .500, 6-6. STANDINGS Atlantic Division Mothers Brothers Bud's Compressor 4tSupply Poky's Veterans Club I 752Crew Midwest Division Aristocrats Assorted Nuts The Pack Good News The Force · Pacific Division Avengers EE's BS'ers Whippets Veterans Club II Nukes 10-2 9-3 7-5 5-7 5-7 6-6 6-6 5-7 4-8 3-9 8-4 6-6 6-6 5-7 4-8 4-8 Grismondi with seven. "I have been pleased with the improving play of our freshmen. They are learning, which is a good sign for the next season. " She added, " I also cannot say enough about the all around play of Diane (Kendig). She has done everything we have asked and more." Kendig's statistics show ltoberts knows what she is talking about as in 18 games this season she has scored 450 points for a 25.? game average. She was leading the nation in scoring last glance and needs only 79 more points for the 1500 career point plateau. She also leads the te~ in steals and is second in assists. - Yesterday the lady Colonels hosted the girls -from Moravian. Tonight at 6:15, Elizabethtown invades Colonel-land and then Saturday night the Wilkes girls play host to a super Juniata College team in a 6:00start. Gary Mack Con't. from page 14 McCue and Marshall each passed out five assists and Mccue had four steals. With Wilkes' loss to FDU Madison, King's College is assured of a MAC playoff position and has an outside shot at first place and the right to host the MAC playoffs. Scranton currently leads that section and must lose its last two league games for King's to finish number one. If not, both teams will enter the playoffs with Scranton as the top team and King's number two. Albright, number one In the other divlsionL would meet King's while either Lycoming or Elizabethtown would meet King's. TIP-INS ... after ZO games, Madden is the best field goal shooter with a .575 pct. and leads the team in rebounds with 147 •• • averaging in double figures are: McNeil UU), McCarrie 0 4.8) and Madden (IU) •• • Madden is the "MVP" of this year's team in our opinion ... Mccue leads Jn assists (107) and steals ( 47 ) ••• Walker's 25 blocked shots is also a team-leading stat . . . lZ years ago Wilkes and Scranton also engaged in a fight - this one at , the John Long Center which also caused an early end to the game with the Royals winning .. . it's no WODder Scranton is known as a "bandit school" .. . none of their sports teams have any discipline they play like ex-cons. Eddie White �the◊beacon Wilkes College Wilkes-Barre, Pa. au f/?1/Hldf},U ~<F.4e ~~ ~II ~"ir---__ u • 0 , ~-~~- _,r. -oeooo-"'-' • O u ____,.....-jj 00 = - ~,Q7/~J9~¥~~ -~ ~ - ~ ~ e n n a. 'tt.c/L ---BY--- e.-cr-<::,> II 75/JAl'IL (25:./, THE CLASS or 1'181 1/®r.>_g j Class Of 1981 T-Shirts " . $5. 0() Price On Sale In The Student Center 11-1 and The Cafeteria At 4:30-6:00 Tuesdays And Thursdays t:' . Vol. XXXII, No.18 February 14, 1980 � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 February 14th Date A point or period of time associated with an event in the lifecycle of the resource 1980 February 14 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/bf9a063825b12ade1fa82b80d1d853d7.pdf 7a10f0c20ddc65ce5755b6a93cf2fcb2 PDF Text Text Production Studio To Be Established; Result Of Communications Program ., profit making facility. According to Dr. Gerald Hart- to accommodate a studio, and Hartdagen concluded by saying dagen, Dean of Academic Affairs, a --would be at a central point on camthat many local television personproduction studio will definitely be pus. The other alternative under nel have offered their assistance in established on campus for the consideration is Church Hall, which beginning of the 1980 fall semester. · if us¢, would be a temporary site · consultation areas, but a final decision on a consultant is still undecidContributing the communications at best. When asked why it has taken the ed. program as one of the . driving Peter Steve forces behind the studio's formula- college so long to acquire a production, Hartdagen noted two places tion studio, Dean Hartdagen presently being discussed for the pointed out that such a facility was not really .a part of the school's curfacilities possible location. ! riculum in the past. He continued The ideal setting for the studio .. . . ,.,.... ·•····•·•·····'· ··········•·•·•··'•"'•·••A.•-··•••·-•······''"·.,., .... '··'·''"······"·•·•··•···•·•··D>"•····•·AA•<·•« LULLABYE AND GOODNIGHT - Approximately 25 sophomore girls 1 would be a room presently being us- that now since the classroom value ed as a service area in the base- of a studio has been proven, the inparticipated in the first annual Mother Tucker Day during which they tuckment of Stark Learning Center. stitution decided it must move ed over 80 men into bed. Shown here is John Andrake being taken care of by This room was originally designed ahead in this field of study. his Mother Tuckers. . I Stating that although the college already has a great amount of the equipment needed for the staticn, Hartdagen said that an amount in the neighborhood of 30 to 50 thousand dollars will have to be spent for additional instruments and materials. The Dean of Academic The decade of the SO's already ap- and financial resources to their best tions is the reviewing of proposals Affairs also added that it is hopeful pears to be full of changes. We all advantage. involving changes at Wilkes in a grant will be attained next year probably have a good idea of what In the beginning, the committee order to establish priority o_f im- which will aid in.cutting the costs of will be in store for us in U1e upcom- will probably meet once a month in the facility, but at present, funding plementation. ing year. But what about the next order to establish a data base. The The faculty has already elected for the studio is .coming from the five or six years, what will be our goals of the college, self-analysis; their members, and Capin expects operating budget. Dr. Thomas Kaska, Language course of action? For the college, a and a space utilization survey must the committee to be in session in a newly formed committee will be all be combined in one data book week or two. "We should not look and Literature Department Chairtaking care of these matters. That and projections will be made from for instant results, as the commit- man, stated that although there is a committee is the Long Range Plan- it, such as the number of students, tee will be looking at the entire in- possibility 2{_ an inner-ca,;npus ning Committee. dormitories, classroom facilities, stitution," stated President Capin. television network in the future, at According to President Robert S. physical education facilities, "They will be very active and, present he is extremely happy just Capin, "Projections for the SO's faculty- to- student ratio, financial although we may not instantly see to have a studio. make it necessary for higher educa- aid, and fund-raising. In other Stressing that the studio " ...must A junior nursing m..jor died last the results, the committee and the tion institutions to know what their words, the committee will come up results will be very important to the be a clearly controlled situation," Friday night in a serious one car acgoals and objectives will be for with a blueprint for Wilkes College. Dean Hartdagen said that it has not cident in Hanover Township. future of Wilkes College." longer than one year." There is Lisa Gurka really been determined as of yet · Gina Montoro, . tlaughter of President Capin . stated that already a committee which annual- another of the committee's funcwho .will be Nicholas and Aileen Montoro of - able to use the - nonly plans for the institution's objec.Wilkes-BarN, graduated from tives and unit objectives by reviewBishop Hoban High School in 1978: ing the objectives of the different Among survivors are her imits of the college, such as student parents, her brother Nicholas, and affairs and alumni. In addition, sisters Meg Erin and Donna. President Capin stated that he feels Funeral services were held MonIt behooves the institution to go day morning at St. Boniface beyond one year, and that five to Church. She was buried in St. arrangements, big name acts are Plans for the February 24th coneight years is a reasonable time to Mary's Cemetary in Hanover. not financially feasible for the plan these objectives, some of cert featuring Steve Forbert, singer Blood Donor Day Chairman, school. He added that with the prewhich include dorms, class size, of the top 40 hit "Romeo's Tune," sent seating situation, tickets for a Steve Demko set a goal of 225 pints etc. "It is !n the .9.est interest of the are running smooth according to for the blood drive, which will be Winter Weekend popular act would cost about 10 to college to form a longer range plan- Dave Blumfield, Student Governtaking place from 10:00 to 4:00 in 12 dollars a seat! ment President. ning committee." the gym. Discussing the possibility .of Starts Tomorrow Blumfield noted that the Forbert President Capin stated that he Demko explained that this time holding a concert at ·another locaasked the faculty to elect five concert, which is in cooperation last year· about 225 pints were tion such as the armory, Blumfield members to serve on this commit- with local promoter Richard Cohen, Night At donated and last fall about 200 pints said that most places are booked in tee, he will appoint five ad- was agreed upon weeks ago and were donated. Demko added that advance which makes scheduling ministrators, and two students will everything is on schedule. 6:30 In Kirby Park. the winter blood drive is usually the very difficult. He also mentioned When asked to comment on be appointed, bringing the total biggest of the three held each year. that the cost of another arena is number of members to twelve. future concerts, the SG president A prize will be awarded to the Team Sc~edules very expensive, adding more finanPresident Capin will chair the-com- stated there is nothing definite in dorm giving the highest percentage cial problems to concert producmittee. The committee will be ad- the making, but it is hopeful that of blood. tion. visory and serve in a recommen- another concert will occur "To· save one life," commented The SG president finished by say- . ding position to the faculty and ad- sometime in April. He continued Demko, "It is worth the time." He ing that the success of this concert that concerts are very important to ministration as a whole. noted that giving blood is a very will determine whether or not other When asked what he hopes the the college simply because they are simple process which takes about concerts will be held. Aiding Blumcommittee will accomplish, Presi- one of the few events which are for 20minutes. field -in this production are Tommy dent Capin s~ated, "I hope it will the entire student body. The blood drive is sponsored by Commenting on the type of con- . Heller and Jim Murtha, Concert provide the needs for the education the Human Services Committee. Committee Chairmen, and P_eggy program and be able to provide and certs the college is attempting to Assisting Demko with the drive are Bartletta, who is in charge of ticket improve resources for use by those acquire, Blumfield attributed co-chairmen Rich Cassidy and Debsales. who attend the institution in the economics as the ruling factor in all Peter Steve bie Prater. future." President Capin also instances. He pointed out that Louis Czachor stated he ··•ants to use the human because of the gym's small seating Nursing Major DiesJn·Crash LastFriday ' Long Range Planning Committee To Decide Future College Policy Plans For Forbert Concert Running Smooth Says SG Blood · Dria,e Taking Place Today In Gym �Page z, The Beacon, February 7, 1980 . Series On Space Utilization Study Begins; Part One o ·i scusses Report's Findings Because of a long-range redevelopment program initiated by the school, a Space Utilization. S t udy an~ Planning Aid was completed this past November by Pyros and Sanderson, architects/planners, to help the college " .. . reduce the operating budget while maintaining flexibility to meet future needs." The 97 page utilization study is broken down into five sections labeled intent and purpose, planner's overview, findings, responses - recommendations and appendix utilization studies. Working with the recommendations made in the "Physical Facilities Committee Report" by the Wilkes goals committee, the study adopted three primacy and three secondary objectives. The primary objectives of the study are to: develop a plan .for maximum space utilization, meet projected dorm needs, and devise a plan for acquisition/disposition. The secondary objectives are listed as the creation of a green links plan, the provision for additional parking, and the preparation of an historic preservation plan. An important point which is discussed in the planner's overview of the study is that because space is .becoming expensive, deteriorated or unavailable, computerized scheduling will become necessary on campus " . . . if space is eliminated and utilization of remaining space ls.increase<!, or, if a utilization · goal is adopted for economy of use. With current utilization for classrooms at about 41 per cent and laboratories at 34 per cent, much space can be recovered by adopting a modest goal of 60 per cent." Such a goal would require many changes in the present scheduling process. Under the topic of findings, eight categories including community relationships, campus coherence, physical plant, ·parking, building efficiency, room use, dormitories and historic preservation are discussed with the aid of various maps and charts. A map o f the campus with the surrounding community clearly shows that the college is " .. . interlocked with its to be adequate, but in poor locations with vital pedestrian links missing. The section went on to state that beca~se of property lines which persist between college-owned lands, a strong plan for campus coherence is inhibited. The physical plant of the planning aid determined that due to the large proportion of laboratories, academic uses are generally overallocated in comparison with simliar colleges. The study states, "Laboratory space assignments at Wilkes are nearly twice as high per student than the average among all private colleges in Pennsylvania." Office space assignments were found to be about equal with the other schools, but lounge and storage space were determined to be in excess. fices which are located in former houses. In examining the topic of room use, the planning aid noted that in many technical courses, obsolete equipment may be taking up useful space, with the poorest utilized rooms being the large lecture halls and large class labs. The aid goes on that "classrooms are utilized about 50 per cent, and laboratories 34 per cent of available time. Available seats are occupied about 29 per cent of the time. Reasonable utilization goals could set these at 75 per cent, 60 per cent and 75 per cent respectively." One final point this section makes is that with over 300 square feet allocated per administrator, ''statistically, there are more offices than employees.' ' With the demand for dormitories State 180.0 17.8 38.5 3.9 21.2 190.7 20.2 19.0 1.0 17.3 OVERALL <Excluding ·norms) CLASSROOMS LABORATORIES INDIVIDUAL LABS LIBRARY ::J 824-2325 -~~Ce;;;;;:~;~;;u~;1 .............................. I . I§ I1- SEaVICE Plll.'S 11• • · I ~ I§ I . II 531-39 S. Main St. Wilkes-Barre, Pa. I I STARIN 829-9209 . Inspection Station ..........,........................... ~ i I i I ~ , t t i§ depicting love among the clouds or with satin doves and satin hearts, and § rainbows of every s~ape and size. Let your gift become . a treasured . pOSSeSS1On. 823 - 8600 ~w ~ ' Cupid _ 263 42 34 34 Miner 323.24 25 123 So. Mam St. . W'lk B p ~ · a. hsted among the most h1stor1c buildings in the Northeastern Pennsylvania Corridor and " . . . are also of national significance.'' Because "students show a strong preference for 'old' and 'historic' buildings," wfth the aid of various forms of grants and benefits available for historic building preservation, it is hoped many of the aging structures can be saved. Part two of the Space utilization Study and Planmng Aid dealin g with the responses and recommendations of the report will appear in next week's Beacon. Peter Steve NOTICE Offidal Olympic T-shirts will be on sale starting next week. Regularly the shirts are $8.00, but they will be sold to Wilkes College students for only $4.00. ACCOUNTING AND BUSINESS CLUB TODAY AT 11:00 IN PARRISH---RM 56 EmerSOn"s Features: Pat Godu,ln on Friday night l.ynn Harri• on Saturday e"enlng E"ery Saturday night at Emer•on '• i• JAZZ nightl JEANTOWNNE Designer Jeans Outlet featuring: Jordache! Calvin Klein! · . . t . ::J Printv.:orks P_ lus :l/ 231.52 250.74 282.35 316.88 I · I Pickering Slocum Sullivan Barre 'Yeiss, Catlin and McClintoc~, a~e According to the study, campus increasing, "There is no doubt that parking "facilites can be described dormitory construction/rehabilitaas minimal, scatter-eel and poorly tion is the single largest commitlocated." It was mentioned that ment facing the college for the next "the relationship between key decade." Even though " .. . attrac· facilities and the lots is not clear, " tive dormitories are generally conwith parking for special events dur- sidered to be a marketing tool for admissions," the study definitely ing normal hours not available. indicated that "utilization cannot The study points out that be improved in existing dorms.'' although any number of additional Although older buildings are less spaces could be put to use immediately, long-term parking efficient in space utilization and cost more to operate than newer needs will be harder to predict. It goes on to suggest alternative ac-- structures, "interest in historic · buildings has become a significant tions such as the encouragement of influence in the community." car pooling, acquisition of addi"Three College dormitories tional lots, the leasing of blocks of parking from the public facilities, .rCICO!BO!R00.0001 · 000K0'0S0000Co'.fj~.;000Clf and the avoidance of random demolition for parking. Listing dormitory buildings BARBER ~~-~ among thehighest cost structures, SHOP "" the study states the · "average building efficiency at Wilkes is 58.4 • srvuNG FOR M;N & woMEN per cent compared to 69 per cent for i : :~~;~~~~1~~~1~gNoinoNING all Pennsylvania colleges. It should ~ ..: ~~~RLi~R:!~~;~~~~frMENT be noted though that many of the • MAN1cuR1NG. sHoE sH1NE neighbors.'' buildings efficiency rates are low cA u FOR APPOINTMENT S due to the fact that they are being FRANK. PETE SARTOA,IO. PROP 81 "Parking, recreation, transpor( ,:g~~sE:[;;G, ) tation, spiritual and job op- used in ways for which they were MAIN FLOOR portunities are a few of the many not constructed. An example of this 15 s r1ANWN ~r . w11 K£s BAm • services . .. " listed, which the is the numerous administrative of- &,.-..,.00--.....-~....c,c:ir_.,-.,~..-0 . locality provides for the school. Concerning campus coherence, the study states that while Bedford 1. Hall's core location might be put to . your VALENTINE how much you better scholastic use, the academic i core of the college is "divided into CARE with soft sculptures of hearts § two distinct areas - Parrish Hall and Stark Hall." Parking was seen m· BEDS 0 30 327.30 Dennison 17 396.53 Dana 45 402.02 Chesapeake 20 402.10 Waller 39 415.62 Sturdevant 23 423.22 Gore 21 445.43 Sterling 18 447.78 Hollenback 30 461.70 Bedford 22 473.55 Mcclintock 10 500.84 Weiss 21 530.71 Susquehannok 12 539.25 Doane 20 557.45 Catlin 18 673.61 Chapman * Cost includes utilities, heat, custodial, HVAC maintenance, security, and other directly attributed expenses. General maintenance is not included because figures would have to be pro-rated making differences from building to building unnoticeable. Depreciation is not included to simplify the comparisons. (Area allocations per student in square feet.) Wilkes s T C NAME COMPAR ISON : STATE WIDE PRIVATE COLLEGES Category ... DORMITORIES: OPERATING COST PER BED * Wrangler! Plush-bottoms! 9 Monctay, Who sa,'ddes,gner · ·1eans · OpenlO'tit Tlusday.ond Friday . . . ·'til 6 t,e out of your budget? Tuesday, Wednesday and NOT AT JEANTOWNNEI Saturday. Prices start atStop in soon at Jean Townne ... SUP · INTO~PAIROFFAMOUS 360 KIDDER ST label 1eans ... and step _out_1oo1<_ing _ _o_v_NAM_1T_E1_W_I_L_K_E_S_-_B_A_R_R_E_ __ s19.95 .... �February 7, 1980, The Beacon, Page3 Campus arty ituation Discussed At SG Meeting Student Government spent a considerable amount of time discussing the party situation .in the Student Center at Monday night's meeting. SG president Dave Blumfield noted that after last week's meeting it seemed as though the cause of the lack of Student Center parties has been the fact that any club or organization can make a maximum profit of $30. He further noted that last Thursday the Student Center board decided to raise the maximum profit level to $50. As the discussion progressed, nearly every SG representative and officer present voiced his opinion in one of the most exciting and interesting idea exchanging sessions in a very long time. Diane Seech statea that a lot of people were not interested in putting a lot of effort into a party when the most they could make was $30. IDC president Mike Stapleton add· ed that most of the parties are sponsored by dormitories, and more clubs and organizations should look into sponsoring parties. Marla Brodsky, SG vicepresident, commented that last year a lot of people would say that SUB parties stink, but now they want the old SUB back. Bob Doty explained that people do not like the size or shape of the Student Center. He commented that the basement is really ·nice, but parties held there need themes. Shep Wilner said that the mood of parties could be improved by using different themes, different kinds of music, and a different atmosphere. SG secretary, Theresa Gabana add· ed that she has heard ~omplaints that only freshmen are going to SG parties while the upperclassmen are going to their own parties. Stapleton stated that a party held in the Student Center, ''is not going to be a SUB party. People have to realize its not going to be that way anymore." He continued by saying that the sooner people accept the Student Center for what it is, the better it is going to be. In other business, SG granted $140 to the Bowling Club by a vote of 22-2-0. The Bowling Club will use the money to send its 6 highest average members to a tournament in Lancaster. The club is hoping that the tournament will be the beginning of the college's participa; tion in intercollegiate bowling. The bowling club has 64 members. It was announced that the used bookstore which had been operated by SG is now closed. Students are asked to stop by the SG office to pick up their unsold books and their cash. It was noted that the bookstore brought in less money than last semester, but it did better than the second semester of last year. Blumfield made a suggestion that the possibility of collecting books at the end of the semester be considered. In this way the used bookstore could be set up by the beginning of the following semester. Stapleton announced that IDC is planning to sponsor a pajama party in the SCB sometime in March. Joe Galli stated that a list of people still owing money on the Forida trip is being prepared and it will be posted in the SG office. Blumfield closed the meeting by reminding everyone that faculty committee reports will be given at the SG meeting on Monday, February 25. Louis Czachor Roller Skating Party Deemed Successful Bill Lewis, President of Commuter Council announced Monday that the Admisison's Phonathon and the Roller Skating Party at L & S Skate-A-Rama were both very successful. "Over 300 potential students were contacted by the phonathon and in all it was very successful. Everyone's help was deeply appreicated.'' Lewis also commented about the Skating Party by saying, "It had a great turn out and the people at L&S Skate-A-Rama want to see us again." between 125-150 students attended the event and future plans for another skating party at L&S are being considered. It was also announced · during CC's meeting that plans for a Karate demonstration are underway. Last week Commuter Council passed a motion to donate a third of the $250 needed for the demonstration. SG and IDC each are to conntribute a third of the money, with the Concert and Lecture Series to pick up the remaining $250. John Moffatt, representative of the Student Center Board, reported that the profit limit on SC parties has increased from $30 to $50. He also reported that the Star Trek machine is broken and that all the coin operated machines in the basement of the Student Center have been taken out. There will also be a Student Center Board Party in the Student Center some time in March. Up dates were also given at the meeting on the Valentines Party and the St. Patricks Party. Tickets for the Valentines Party go on sale this coming Monday and can be obtained at the Student Center and/or cafe. An estimated 500 tickets will be sold for this event scheduled for next Friday. The band "Chance" will perform and Poly-Care will cater the party. Joe Rubbico, cochairperson of the St. Patricks Party announced that there will be no dent Mike Stapleton's announcestay on campus for either academic ' green beer for the St. Patricks Parment that the limit on profits made or athletic · reasons may stay in ty and that all plans are progresson Student Center parties has been either Ct)esapeake or Pickering ing well. raised from $30 to $50. This had also Hall. Commuter Council is also looking been discussed at recent IDC Other announcements made by into the possibility of sponsoring an meetings, where many of the Stapleton concerned committees. It Ice Skating Party at Coal Street. representatives expressed the opiwas mentioned that a Maintenance Suggestions were made to have the nion that a higher limit on profits Committee chairman is still needed party before a hockey game at Coal would provide greater. incentive to to meet with the Housing Directors . Street. A bus trip to New York is have a party. Stapleton stressed, and the head of maintenance to deal also tentatively planned. The bus however, that organizations should with important maintenance protrip will be very much like the one not think of parties only as a way to blems in the dorms. It was also anthe Council catered earlier last make money, but also as a way to nounced that the Food Committee semester. A tentative date for the provide more campus activities. meeting would be held on Monday, excursion is set for Saturday, Housing Director Paul Adams February 4. Food Committee March 8. outlined the regulations for dorm meetings will be held every other The meeting concluded with a students concerning spring break. Monday afternoon at 2:00 p.m. in . reminder for all students that on He noted that the dorms close at the East Wing of the cafeteria. The · . · Thursday, February 7, the 5:30 p.m. on Friday, February 29, next meeting will probably be held American Red Cross will be conand do not re-open until Sunday,· February 18. .ducting a Blood Donor Day over in the gym. Students are urged to March 9 at noon. Those who must Mary Kay Pogar donate as there is a blood shortage. The COPUS letter campaign is also underway and all students are aski ed to give their support by writing a letter. Information can be obtained from the COPUS Office in Keep Warm Weckesser Hall. Darlene Schaffer ·1»c Representatives Vote On Proposal To Hold Pajama Party In S-tudent Center At IDC's Sunday night meeting, representatives voted to hold a pajama party in the Student Center sometime after the spring break. For the past two weeks, IDC has been discussing ideas for a party and decided on the pajama party aner considering such ideas as; a Western party, a Golden Oldies party, a Futuristic party, a come-asyour-favorite dictator party and a pimps-and-prostitutes party. Another matter concerning Student ~n!_e_! parties was I.J)C ~!_~i- Januzzi's Pizza and Hoagies 125 Academy Street . . 111111ffliffffffUttH!ffflJ . Home Delivery OPEN 7 DAYS 11-1 f J•. : In Your Dorm • with 1· 'f i1Jr [Jllflll]llrlflrliS riJrl[I SIJSiflfTIS .d -IS: lowntown Wilus-Barrt Sweate DAILY lOAI · 5:30PII by Thone, ! Byford and Alon Paine froms27 50 · Mon. -Sot. 10Mon. & Thurs . 'til 9 . Bevan's See Joe, Bob, and Danny MON.-THURS. 11 A.M. -9 P.M. TUES., WED., FRI. & SAT. 11 :00 A.M.-5:30 P .M. 288-37 51 f Crew and V-Neck I\) .......J [>,_, iijij ENIM . CORDUROY -PLUS- MEN'S WEAR 1 12 W. Northampton St. ~ Wilkes-Barre ifflfittmmmHl~tff:a::=u:. 1 -:. ARMYPANTS . PAINTER PANTS FARMER JEANS IWEATSHlffl FLANN£l'SHIRTS ....... ~, �Page 4, The Beacon, February 7, 1980 WCLH-TV?? Former Athlete Sees Campus Program Suffering From Small, Subtle Scandals Dear Editor, with great interest the artiWith the probable establishment of a production studio cleI read two weeks ago ht the Beacon on campus next year, we extend our thanks to those respon- , concerning sports scandals at such notable schools as Arizona State sible for its soon to be reality. the University of New Being avid fans of the Communication Studies program, University, Mexico, and the University of any steps taken to further develop the curriculum of the Oregon. The article states that the major is a wise move by the administration in our eyes. Federal Bureau of Investigation in with the National ColThey have recognized the value of the year old major and cooperation legiate Athletic Association is plan- . see its future as very bright and exciting to the campus. ning on a nation-wide inquiry. An FBI agent ;s quoted as saying that It will take time for the program to fully mature. With "the problem is not limited to a few continued support from the administration and facuity we schools. The problem runs wide and see the Communication Studies major follow in the steps of deep." It also ·raises the possibility Wilkes College could be questhe Nursing program as being a very fast growing major that tioned. The article concludes that wit!t attractive characteristics to new students. No one said Wilkes College could be questioned. ii- would be easy but in our opinion the end results will be The article concludes that Wilkes is "ready and willing for any type of more valuable to the college than some may realize. investigation the FBI and-or NCAA may initiate," and that the uncovering of wrong doings is "totally unexpected." I must agree that there are no major scandals involving athletes and credit manipulations. But this is not to infer that there are not any When a nation realizes that its present economic growth and overpopula- scandals involving athletes on the tion will cause a visible decline in the quality of air and water, and a series Wilkes College campus. There are. of man-made disasters of ecological imbalance, and then does little to pre- There are hundreds of minor scandals. Perhaps the only barrier vent this environmental collapse, that nation is insane. When a nation become more upset over capturing a purse snatcher than preventing Wilkes from one of these a narcotics dealer, that nation is insane. When a nation becomes more con- major scandals is the fact that cerned with its problems of crime in tne streets, than with its involvement Wilkes is not a major sports school. The sports scandals that exist at in crime all over the world, that nation is insane. When we wipe out the crime syndicate, we will go a long way toward eliminating crime in the Wilkes are small ones, subtle ones, hidden ones, masked by students, streets. When a nation becomes more concerned with putting a man on the moon ignoPed but soom•ngly condoned by than putting food in hungry chµdren's mouths, that nation is insane. When the athletic director and some ada nation l's more worried abouHhe sprelfd;of communism than the rampant ministrators. spread of famine,.poverty; Qver-population; and disease, that nation is inOne could cite the football player sane. When a nation-becomes mo,e trolllt>led over a meager and inadequate . who several seasons ago played welfare program for the poor, than the fact that the nation's richest people half the season without being and corporations pay no taxes at all, that nation is insane. When a nation is enrolled at school. This, however, is less tolerable of a man who steals food to feed his children, than the cor- not a good example. It was a unique porations which steal billions lo feed their own self interest, that nation is case in which no one but the athlete insane. himself can be blamed. A better exWhen a nation of overconsumers blames other nations for t!:te energy ample is the baseball player who crisis, that nation is insane. When the majority of a nation's people speak several seasons ago went the first only one language, and fault other nations when they are not understood, seven weeks of the spring semester that nation is insane. When a nation takes me captive in its armies to kill, with only eleven credits but then or be killed, by my fellow black, white, brown, and yellow brothers, that na- found out that he needed to carry at tion is insane. When a nation's young people isolate themselves from other least twelve credits. He was able to nations through apathy, ignorance, and ethnocentrism, that nation is in- add a course in that sevenUi week sane. That nation is America, and America is a nation that has lost its and become eligible. He, of course, dropped the course almost immind. We have been responsible for c, eating a nation in which the air is not safe mediately but had satisfied the reto breath, the water is not safe to drink, the food is not safe to eat, and the quirements by carrying etc least streets are not safe to walk. Yet, the pollution which is corrupting and kill- twelve credits. But perhaps this is ing off more and more Americans, doesn't come from the air, water, or nit-picking. land. The pollution which affects the lives of each and every American livBetter examples yet would be ing today, comes from within our own minds, and is called moral pollution those athletes who receive pay for ... (to be continued next week). work they never do for the athletic David A. Clanton department, otllers who are given credit for working many more hours than they actually do, still others who work and receive pa!' under another athlete's name. There are those athletes who through pressure from the athletic office receive either jobs or financial aid that they do not qualify for. To the Editor: definitely coming. The play-by-play There are those athletes who are As a concerned student who is description given about Colleen and admitted despite below standard mildly involved in Wilkes College Jon's journey to New York, beat the academic records. Worse yet, there activities, I take this time out to ex- corniness of mid-afternoon soap are those athletes who are allowed press my feelings about the unjust operas. Many problems occur dur- to remain in school despite below academic records, praise given to the Junior Class ing every event held, why should standard athletes who should be put out of President. The articles written this mishap get such publicity? about Colh..-en Gries made her out to There are many other students on school for a semester, or a year but be a saint. After reading the arthis campus who have expended are allowed to remain just one ticles, I felt the Beacon was asking much time and energy trying to bet- more semester, just one more year, every student at Wilkes to bow ter student life at Wilkes, BUT they just one more season, who are down, kiss her feet, while the band do it for the students, NOT for allowed to compete in just one more plays and the sun rises. First of all, themselves, the title or the publici- match, just one more game, one the Junior Class Surprise, alias Col- · ty! more meet. To ~ sure there are leen Gries, was almost cancelled Respectfully yours, many athletes who are put out of because Ms. Gries never bothered And still another school for academic reasons; there to check beforehand to see if concerned student are also many who should be, but "Rocky Horror Picture Show" was are not. Campus c~mmentary Insane Praise Tou"'rdMs. Gries Viewed As Unjustified I personally know of one wrestler who had been in school for Wilkes for three semesters, had · accumulated no more than fifteen credits because he dropped most oL the courses, and had a GPA of less than, LESS THAN mind you, 0.50. In this case, the administration determined that he should be put out of school for a year. He was not. The,wrestling coach was able to get him back in school and back on the mats, not only for his fourth semester but also for his fifth and sixth semesters. And I suspect that he would have been allowed back for his seventh and eighth if he had not decided to join the army and end his illustrious college career. There are those athletes who never take an exam on time, waiting instead for a make-up after they have been briefed on the exam's contents by those cooperative students who took it on time. There are those athletes who have never written a term paper, who have begged, borrowed, stolen, payed for papers. There are those athletes who are about to fail a course but are able to bring their grades up to thP. 2.0 level by giving the professor some newspaper clippings of their sports feats, a hard luck story, and one of those begged- borrowedstolen- payed- for papers. Of course not all professors will prostitute their standards in such a manner but there are some. In fact, there is · even an un-official rating of professors; th~ , are "good"- pro·tessors ·wb show favoritism -toward a.thle . nd are safe to take• for an easy-" :o and "bad" professors who show no favoritism towards athletes and are best avoided. And these scandals are not con- fined solely to the work area or the classroom. How about all those wrestlers who do not make weight but are able to either fix the scales or take advantage of its location by leaning against the wall with their hand and, by doing so, make weight. Some of the wrestlers it seems have never made weight for the dual meets finding it easier to "wall it." Has this practice gone unnoticed by John Reese, the wrestling coach and athletic director? Have all these minor scandals gone unnoticed by Mr. Reese and the administrators? Or are they condoned? I fear the latter. Let us be glad that not all athletes follow these corrupt paths. Let us be glad that most are good, hard working students who contribute athletically and non-athletically tu the college. Let us be glad Wilkes is not a major sports power and hence has no major scandals. _ I know, I have seen it, I'liave been a part of it. Alumni NOTICE Anyone interested in doing photography work for the "Beacon" next year, contact Bob Gaetano at Gore Hall. NOTICE On Thursday, February 7, the Cooperative Education Staff will be in Student Center to discuss Summer & Fall job placements with in-· terested students, from 11 : 00 to 1:00. -----tbe<>beaeon-....-.. USPSll32..ffll41 Editor-In-Chief Jim Edwards Sports Editor Managing F.di&or Eddie White III BillTurcan NewsE41itor Peter Steve Copy Editor Patti Sparlow Op-Ed Editor Perry Lichtinger Asst. Op-Ed Editor Margaret Scholl Asst. News Edilor Louis Czachor Photographer Bob Gaetano Business Manager Sue Freda Advertising Mani:.;er Vanessa Martz Circulation Mananger Michele Serafin , REPORTERS: Cindy Ercolani. Lisa Gurka, Mary Kutz. Sue Loveitt. Gary-Mack, Bill Miller, Rich Nord~eim. Ana Nunez. Mary Kay Pogar. Darlene Schaffer, David Stahl. Advisor George Pawlush Parrish llall 16 S. River St. Wilkes-Barre, Pa. 1Hil4i Pllblislled weekly during the school year from September to May except f• vaeadoD periods and semester breaks. Entered as second class postage paid la Wilkes-Barre. Send form no. 3579 to The Beacon. Wilkes College, Wilkes-Barre, Pa. 18111. Subscription rate to noa-stlldents: $-1 per year. Advertisillg rate: sue per column Inch. · Phone: nm 82-4-1151 , Ext. -473 · All views expressed are tbose of the individual writer and not necessarily el Ille pnUcatiN of Ille college. �r o. •MaggieSay,r .. · What,s Happening -NM ◄H ►► ~ •1 MaryJoFrailBelievesln WorkingHard; Febraary 7, 1980, The Beacon, Page 5 Looks TowardA Career In Counseling Mk The Theta Delta Rho Sorority will hold its annual dinner-dance at the Woodlands an Inn (formerly the Treadway) on Friday, Feb. 8th. A cocktail h?ur will be held at 7 p.m. with dinner following at 8 p.m. Music will be provided by Phoenix with dancing from 9:30 until 12:30. It is open bar and the ticket price is $25 per couple. The dinner dance is open to the entire campus: students, faculty and administration. Tickets are on saie in the Student Center daily at lunchtime. --------- The REGIONAL SCHOLASTIC ART AWARDS EXHIBITION will be in the Sordoni Art Gallery from February 13th through March 9th. The actual awards presentation will be held in the Schaeffer Lecture Hall on February 16th. • The Theater Department will present Samuel Beckett's masterpiece~ WAITING FOR GODOT at the Center for the Performing Arts on February 22, 23, and 24. Information concerning tickets may be obtained by calling the theater box offi:e. . . I learned from playing sports since I was a kid that taking the offensive approach works. It is the only approach I know and it has always worked for me" says Mary Jo Frail, senior psychology major from Wilkes-Barre. In fact when talking with Mary Jo, one gets the impression she has always, through hard work and determination, accomplished her goals. Concerning grades and schoolwork, she says, " I started out with just an average semester, as all freshmen do. So I said to myself, well this is a starting place and I've got to improve, I couldn't go below that." Mary Jo may have started with just an average semester, but this fall semester, just completed, she attained a perfect 4.0 average. " If you work hard, whether it be study or practice, you've got to improve. If you don't, you are not working hard enough." With ideals like that, it is no wonder that Mary Jo .has been a school leader, primarily in the area of sports. "Coming from a family of four brothers, all of whom were sports crazy, I, of c~u~,_ join~ n M Wk HM Mk Wk Mk M February 22, 23, and 24 -----~----------------------- Powlick To Direct ''Waiting For Godot" The setting will be very bare, a tree and a rock, and it's about two tramps waiting. It doesn't seem like very much but it will be when the theatre department's third production of the year hits the stage. Dr. Leonard Powlick is directing Samuel Beckett's Waiting for Godot, and feels that the play is " the greatest and l!as revolutionized the theater since it was first produced in 1952.' • Dr. Powlick would rather not read a theme into the play and said, " Godot is one of the most moving and fun plays that I know of." Most people think that Godot is about nothing, but as Dr. Powlick explained, nothing is important and it is very real. Delaware Hall Upset With Cold Water To the Editor: Dear President Ca pin. Our patience has at last frozen as a result of our cold showers. We have been told that things are being done, but unfortunately, we have not seen - or should we say "felt" - the results. Hot showers (if any) are few and far between and we feel that it is not our privilege but our right to have hot water. This problem has existed since September, but has been especially bad this semester. It is not that the hot water runs out-there never was any to be had. We feel that we have been more than patient concerning this matter. Thank you for taking the time to read this . . . our dishes thank you, our clothes thank you, and above all, we thank you. The Women of . Delaware Hall NOTICE There will be a Junior Class meeting today at 12 o'clock in Stark Learning Center 166. Wrap-up of the Surprise and the Junior-Senior Dinner Dance will be discussed. All class members are encouraged to attend. "The play paradoxis life in many ways : everybody is always waiting for something and when what we're waiting for comes along, it won't be what we expect." Another point that Powlick explained is that everyone always complains about life being too short, yet we wish the time would pass quickly. Powlick added, "All human relationships come out in the play." Powlick has seen about five or six different productions of Godot and has taken to quoting it because the lines relate to everyday life. He went on to explain a certain production done in San Quentin prison, "The prisoners there have adopted the dialogue into prison language. Who knows better than prisoners about waiting?" The cast for the production in- elude: Paul Kerrigan as Vladimir; Chris Lonstrup as Estragon ; Larry Barrett as Potso; John Chervak as Lucky and Tara Buckingham plays a boy. The cast · according to Powlick, " is very excited and is getting more and more into the · thing as rehearsals progress. Powlick's last words of advice are, "Not to think about it too hard." He stressed not to over intellectualize the play. Chances are students will have to read Waiting for Godot some time or another. • It'll be easier to understand it after seeing it first or vice-versa." The show will open February 21 at 7:30 p.m. with high-school night. The February 22nd and 23rd performances will begin at 8:00 p.m. and the final performance will be Sunday afternoon at 2 p.m. Margaret Scholl Greetings Everyone! All I can say is BRRRRRRRll, it's freezing outside ! The Great Spirit's tail is about to be frostbitten any minute now! Those trips around this campus are wicked ; especiaUy when you have to track up the street to P:irrish from Stark. AAAHHH - Winter is finally here ! Thanks to our old pal the groundhog (Puxitany Phil to his close friends ) seeing his shadow last Saturday, we will be having six more weeks of glorious winter weather. (So what else is new?) Just keep bundling up and snuggling with that special someone! As you know the much anticipated Winter Weekend starts tomorrow. I just hope that there's enough white stuff to sustain those mad trayers. Wouldn't want to cancel a few of the events for the very first Olympiad. We'll just have to put wheels on our skis or borrow some snow-making machines from Jack Frost or Elk Mountain! Just be glad this isn't Lake Placid! Or we'd really be in big trouble. . Speaking of Lake Placid, the ever-anticipated 1980 Winter Olympics has fmally (almost) arrived. The Great Spirit wants all of you to join Jim McKay in watching this great event every night and cheer on our athletes who worked so hard. Remember this only comes around once every four years! Don't miss it! Red Letter Day will soon be here. The Great Spirit wishes all of you a Happy Valentine's Day! give the one you're sweet on a kiss from me! . Special message going out to Bobby Gaetano: The great Spirit really loves your beard! There's NOTHING like a bearded Italian! · By the way, the Great Spirit is in search of the Wilkes College Gigolo. I want to see if he will rival the "American Gigolo." Early scouting results show that the Pickin's are SLIM! The Great Spirit will return before you know it! , Watch for me! P.S. Hey Flash Gordon, I know what your H.B. means . My sources tell me.t hat a certain population ain't gonna like it! Mary Jo Frail in." And ever since then Mary Jo has been playing sports and loving every minute of it. When coming to Wilkes, Mary Jo, who played four sports in her senior year of high school, had decided not to play sports at Wilkes. ''One letter from Mrs. Meyers asking me to play hockey changied my mind," Mary Jo muses. At Wilkes, Mary Jo has been on the field hockey team, serving as co-captain, the basketball team and softball team. When asked if she has won many awards, Mary states, "I've been honored a few times but it is more of an honor for me to play than to receive awards." A few honors is a humble understatement. As a freshmen, Mary Jo was honored as The Beacon "Female Athlete of the Year," and as a sophomore was the Wilkes female athlete of the y~ar It's Time To Play ..• The"CLASS FEUD" ·February 8th 10:00 p.m. at the CPA Admission 50e Sponsored By: and was this year honored by being selected to the MAC All-Star Field Hockey Squad's second team. Mary obviously plays sports not just for trophies or not just to please her parents, but in her own words "sports makes you feel like you can do something. It is also a great release for me and besides it is good physical exercise." Mary Jo has never regretted the path she has taken in life, but that does not mean it has not been without problems. "Sure I get stereotyped all the time, as the female jock and in high school, when the other girls were dressing up and looking pretty, they couldn't understand me. I had more guy friends than girlfriends." Mary Jo, however, didn't always quite fit the type .that ~ost people held of her. "Everybody was amazed in · high school," Mary notes with a laugh, "when I stood up and sang in our school musical, The Sound of Music. Maybe if I had been dribbling a basketball all the time, they would have accepted it a little more." Attitudes such as these may be changed as more women become more involved in sports. As Mary Jo notes, "When I was a girl, I had to be a warm-up catcher for the boy's little league team. Now there are a lot of leagues just for girls. " Mary Jo had to wait until she was in ninth grade before she could get involved in school sports but now most girls are starting younger. "Girls athletics are just growing and growing and here at Wilkes, the women's sports just keep getting bigger and better. They have every year since I have been here.'' With Mary Jo as one of their key players, it is no wonder. Mary Jo, who is also getting her teaching certificate this May, hopes to continue her study in psychology at graduate school. "I would like to get into School Psychology, for high school students where I may be able to talk with kids about their problems. As for sports, she hopes to pick up tennis, a sport which she can play for the rest of her life. So Mary Jo has set more goals for herself which with her determination and drive she will accomplish. Bill Miller Copus The Coalition of Independent Col- . en lege and University Studepts is an "our organization which attempts,. • i through numerous lobbying efforts, to get more financial aid for Valentine students. But lobbying for further aid Is only half the battle. For Messa11e C.O.P.U.S. to succeed, students · must take advantage of the aid proTo Tlae Beacon need grams that alteady exist. With this in mind, the C.O.P.U.S. il.ore Be'ol • relJrU · a.., J 0t1a· ,C 7 chapter of Wilkes .College has created · the Peer Counseling Organization, made up of students. 1 -• In addition to distributing aid forms, this new organization will ~ attempt to answer any question you . __ l_z. ".· . . .~_ · . might have about financial aid. Our goal is to help take some of the burden of Mr. Raspen's office and - just as important - to encourage as many students as possible to ap.___ _ _ _ _ _ _ _ _ _ __. ply for financial aid. (? �Page 6, The Beacon, February 7, 1980 Education Department Offers New Program • I Last summer, Wilkes College's Department of Education and Temple University's, Department of Psychology . of Reading joined forces in order to offer a Reading Specialist Certification Program on the campus of Wilkes College. The emphasis of the certification program is to teach teachers how to help pupils develop their reading abilities to match their maximum capacity to leam. The courses offered also provide insight into the complicated psychological factors involved in the reading process. The necessity for programs such as this stems from a nation-wide decline in student reading ability. Recent studies have placed the average reading level of college freshmen at the eighth grade level. Although similar programs exist at Bloomsburg, Stroudsburg, and Scranton, the rising cost of transportation traveling to these places too costly for residents of this area; hence, the growing need for this program in the Wyoming Valley. In the first stages of planning, Wilkes sought out other institutions for assistance because it's own faculty lacked the expertise needed in order to be approved by the state. Finally, an agreemeqt with Tern- · pie University was made in which members of the Temple staff would come to Wilkes to teach the required courses. Under this agreement Wilkes is responsible for Album Review courses covering Elementary School Reading Instruction and Reading Disabilities while Temple supplies instructors who teach . practicum courses in Diagnosis, Developmental, and Corrective teaching techniques. In addition, . Temple also covers two other Psychology of Reading electives. Temple University has traditionally been a leader in the field of Reading Instruction and their staff contains several nationally- acclaimed experts in the field. Those scheduled to teach at Wilkes include: Department Chairman Stanley L. Rosner, Professor S. Elizabeth Davis, and Professor Marjorie S. Johnson. Dr. Thomas Scappaticci, who received his doctorate in Reading from Lehigh University, will be teaching the two Wilkes courses. In conjunction with the certification program, Wilkes College's Department of Education is offering a Master's degree in Education requiring only 9 additional graduate credits beyond those required for ttie Reading Specialist Certification. Students wishing to complete the master's degree must take two foundations of education courses taught by Dr. Eugene Hammer and Dr. Frank Darte, plus the course in Elementary School Curriculum. According to Dr. Joseph Bellucci, Associate Professor at Wilkes, these programs offer area teachers great professional flexibility. Some of the students presently enrolled in the program already have their masters and want to be certified. Others are in the certification program to get their masters, while some just want to be certified. In any case, the job market is reported to be good for reading specialists outside of this area, which gives teachers an added option within the professional field. Presently, the enrollment in the Reading Specialists Program is at thirty. The program will be offered .each year as long as the interest keeps up. If enough interest is noted in the graduating Reading Specialists group then a Reading Supervisor Program might be started. . This summer a reading clinic will be offered on the Wilkes campus open to area students with reading difficulties. The clinic will be staffed by the students presently in the reading specialist program. In this way, these students can gain practical experience in dealing with problem readers. Anyone interested in either of these programs should contact either the Wilkes Education Department, ext. 384, or the Wilkes Graduate Office, ext. 303. Dan Fogelburg - "Phoenix" Already a top ten album, this has to be considered one of the best efforts this year. Although Fogelburg is relatively unknown, this album is certainly his "break through". Fogelburg's unique fashion of country and rock is quite different from most bands that attempt this style. Fogelburg's music will appeal to both the country and rock listener. Cuts like the title and "Face the Fire" are classic rock numbers that blaze with intensity. Other cuts like "Gypsy Win" and the single "Longer" are well done, smooth ballads that will keep you humming all day. Fogelburg has long been recognized by his peers as one of the top instrumentalists of the day. This album proves the point to the rest of us. Fogelburg plays everything from guitar to ankle bells, all with the same smoothness he is known for. Before people ask you "Dan who?"; they should give this album a good listening. You will be more than pleased with the results. · - · 38 Special - "Rockin into the Night" If you don't like the new wave; if you're not into punk; you will like 38 Special. Stressing fundamental hard rock with a southern twist, 38 Special tells us that rock and roll is hardly "dead". Lead singer Donnie Van Zant, brother of the late Ronnie Van Zant, is excellent. His vocals are straight forward rock and roll with no "blues strings" attached. Cuts like the title and "You are the Captain" are good old fashioned rockers that will keep you smiling. The ballad "Take me through the Night" is also very good. Featuring right instrumentals and some well done production, it is reminiscent of some of Skynard's finest. A good instrumental is "Robin Hood". The imagery is great. If you like good timin' rock and roll, 38 Special is the group ycu've waited for. Although they lack the complex sound of many of today's groups, 38 Special's music is refreshing in this age of new wave and "message" rock and roll. George Saba SUN . FEB.24 7:00P.M · TICKETS: $6.00 PAPERBACK BOOKSMITH (IN THE VIEW MONT MA I.I .I SPRUCE RECORDS (SCRANTON) JOE NA RDONE"S GALLERY OF SOUND (WYOMING VALl. t:Y ~IALL, DOWNTOWN W IL K ES-BARRE, EOWAROSV1LL I::) AND ALL (i') T!Olrn\ON OUTLETS Prem iumBran ds 185 S. River Street Plains, Pa._ 823-3105· �February 7, 1980, The Beacon, Page 7 WCLH - FM Celebrates Eighth Birthday To-dRy "This is the stereo voice of Wilkes College, WCLH-FM, 90.7 on your stereo dial,'' still in operation today on its eighth birthday. In celebration of this monumental occasion, the staff and management of the station planned a special album Saturday to be aired on February 23 beginning at 11 a.m. This special program will feature one of the top albums of each year the station has been broadcasting. The records include "Machinehead" by Deep Purple representing 1972, Grand Funk's "American Band" from 1973, "Bad Co." by Bad Co. relesaed in 1974, 1975 featuring Led Zepplin's "Physical Graffity," "Toys in the Attic" by Aerosmith from 1976, Boston's first album from 1977, 1978's "This Year's Model'' by Elvis Costello, and "Sparks" by Graham Parker from 1979. C~lebrating today as their eighth birthday, Rockin' Rich will have a record special beginning at 2 p.m. featuring the top• twenty records since the beginning of the Wilkes College Listening Habit in 1972. In 1972 WCLH had 10 members broadcasted only 6 hours a day at a power of 175 watts to an audience of approximately 100 to 200, and provided only educational programming. As of this year, this same station has 60 active members, broadcasts from 8 a.m. to 2 a.m. on weekdays and 24 hours on weekends, at a strength of 2000 watts, to an audience of between 4000 and 5000. The station also provides public affairs broadcasts: In addition, the station presents music formats including classical, jazz, oldies, contemporary, easy listening, polka, rock, soul/disco, THE STEREO VOICE OF THE COLLEGE - The staff and management are of WCLH-FM celebr.ating country-western, and folk in designated time slots. WCLH provides public service announcements, news reports from the Mutual Broadcasting System, the Associated Press, and their award-winning newsroom, sports reports, news about community events, and special promotion for college activities. WCLH_also produces feature and news reports and rock reports. According to Fred Pierantoni, station manager, "The people make the station. Our equipment is horrible, but we keep trying to stay on the air." The equipment now us- their eighth birthday. May they have many more! ed in the station was purchased used in 1976. He explained that the life expectancy of equipment is not that long, especially since it is used so heavily. "That is why we would really like new equipment,'' he continued, "especially a new control board." There has been a steady interest in the station from students during its existence. Program Director Rich Nordheim be~ieves that with dwindling college enrollments, WCLH could be a valuable public relations tool and therefore attract many students to the school. Pit:rantoni has been station RETURNING TO WILKES COLLEGE , BY POPULAR DEMAND Spring 1980 Call Days Evenings & Weekends (215) 435-2171 1524 LINDEN ST . Allentown, Pa. 18102 Educational Center TEST PREPARATION SPECIALISTS SINCE 1938 · CLASSES START Sunday, Feb. 17th REGISTER NOW TO RESERVE A PLACE IN CLASS manager for a year, and during that time, membership has increased by approximately 20. Every new member who wishes to go on the air must take the written test given by the Federal Communications Commission. Most of these students travel to Philadelphia on their own to take the test, since the FCC only travels to Wilkes-Barre twice a year. "We're not given a travel item in our budget and students are not compensated Ior doing shows or taking these tests. They require a lot of time,' ' stated Peirantoni. The station gets invited to broadcast live from various locations. Last year they broadcast_Uve form the Wyoming Valley Mall, several bazaars and dances. The highest rated shows are rock and polkas. "It's the different styles of the deejays and shows which make it interesting for all kinds of people. No station in this area has such a variety of programming," said Pierantoni. He continued that everyone has improved during the years on the staff and as a result everyone is always learning something new. " We aren't pros," he explained "those people who make fun of the station should take a look at themselves because at least we are putting forth an effort." The "man behind the scenes," according to Pierantoni is Dr. Bradford Kinney, Director of Broad~ casting Services and advisor for the station. "He does so much for us," stated Fred Pierant~ni, " and the only compensation he receives is abuse and headaches." Dr. Kinney has a unique style of advising, the staff believes. They all say, "He is here when we need him but yet he also gives us free rein." Through adversity and prosperity, "The Stereo Voice of Wilkes College" will persevere and continue to function, stated Station Manager Pierantoni, hopefully for at least another eight years. Executive members of the station are: Fred Pierantoni, Station Manager; Rich Nordheim, Program Director; Gary Mack, Sports Director; Les Nicholas. Asst. Manager; Chris Kosakowski, Public Affairs Director; Jim McCabe, Music Director; Rob Wallace, Station Engineer; Bob Rushworth, Asst. Music Director; and Mark Thomas, News Director. Patti Sparlow Dual Honors Awarded Public Speaking Unit For the first time in the history of Wilkes College the Debate Union has brought dual honors to the institution. This past weekend saw two teams enter into intercollegiate competition more than 200 miles apart. The Public Speaking Unit of the Debate Union traveled to Monmouth College, West Long Branch, N.J. to enter competition in the most respected forensic tournament in the East - the Woodrow ·Wilson Invitational Contest. Winning a "Woodrow Wilson" trophy is considered to be at the top of the forensic ladder. Wilkes along with 23 other institutions gathered at the famous "shadow lawn" estate of Monmouth College, the former summer White House of President Wilson. Wilkes came home with two "Wilson" awards. Colleen Gries and Davida Roberts captured one of the impressive awards. Norm Witko and John Pliskin also participated at this contest. Twct hundred miles away and at the same time - the debate team was locked in competition at the James O'Toole Memorial Debate Tournament. More than fifteen institutions of higher learning gathered for the competition on the campus of Bloomsburg State College. Wilkes, with only a week of indepth training locked horns with some of the top teams in the East, including Clarion College, University of Maryland, Syracuse University and West Point. When the two day tournament ended; Wilkes College had won a fourth place, plus four individual awards. Wilkes won eight rounds of debate competition. The victorious squad consisted of: Patti Sparlow, who accumulated the highest speaker points; Karen Orlando; Darlene Schaffer; and Michele Fidrych. More than 38 institutions of higher learning watched the combined Wilkes Debate,rs and Public Speakers bring honors to the college. No forensic team in the history of the school can lay claim to the honor the members of "Kinney's Kids" accomplished this past week. The seven trophies won raised the number of awards won by the' Union to 21 this year and continues the winning record established at the beginning of the academic school year. The debaters and the public speakers are coached and directed by Dr. Bradford L. Kinney of the college's Speech Division. �Page 8, The ~aeon, Febna•ry 7, 1980 · Alplla Drive Close To Goal; AngoffToPresentLecture 1980 Camp~ign To Begin On Role Of Testing In Ed. After the first two years of its three year drive, the "Alpha" . Capital Campaign has achieved 2.2 of the projected 2.4 million dollar goal, with the 1980 Annual Campaign scheduled to get under-way shortly. "With any good fortune, we'll probably come out on top here," James Aikman, Director of Development, commented on the expected out-come of campaign "Alpha." Aikman added that because the drive ls so close to its goal, more people will be inclined to donate money, with some people even donating twice. He continued, "The closer the gap is, the better the chance people wilil)itcb-in.'' The 1980 Annual Campaign, which is concentrating on raising funds for college scholarships, will get started on February 27 with a projected goal of $200,000. This year's campaign will send out brochures to about 2000 prospects, with about 1000 other people being contacted by solicitors. Aikman noted that the school has over 155 volunteers from the Wilkes-Barre area presently working on the campaign . The organization of the 1980 annual drive consists of 7 divisions, each with a division leader. In turn, each division leader has 4 captains who are put in charge of 4 workers. Aikman also pointed out a special eighth division referred to as the "silver colonels," which consists of 6 or 7 expert solicitors who are given the key donation assignments of the drive. Director Aikman mentioned that due to a constant change in the public's attitude about Wilkes, prospects are assessed each year before being contacted. Factors such as previous financial commitment to the college, the prospects present financial situation and inflation are all taken into account when this decision is made. If con_dltlons are unfavorable at the time, a prospect is passed up for the campaign until a future date or drive. After the February 27th starting da~, there will be 4 report meetings held on the 5th, 12th, 19th, and the 26th of March at which progress statements will be announced. Rewards including mugs with the Wilkes logo on them will be given out at these meetings to those solicitors who have had the highest success in their work. Aikman stated that rewards, such as the mugs, are very important to the people who work on the campaign staff because it gives them something to show for their efforts. It is also the best way for the college to give thanks to all the volunteers involved with the drive. Although the mugs are given to those people with the highest amount of donations, Aikman mentioned that it gives everyone a goal. Commenting on the future of Wilkes' College .drives, Aikman stated that the goals will get higher each year. He concluded, "The money will be there, it's just more effort will have to be made to get it." Peter Steve Can The Broken Doors On Stark Be Fixed? For about one year now at least one set of doors in front of the Stark Learning Center have been broken, and during the year most of the other doors on the front entrances of SLC have also been broken. The problem with the doors is that they will not close by themselves. Business Manager, Charles Abate stated, "One of the major problems is the draft that is created. The arcade acts as a wind tunnel and the force of the wind causes damage to the door checks.•• He continued that the college has been working on fixing the doors for a long time. He explained that the problem is with the style of door which ls manuf_actured by the Ellison Bronze Door Company of Falconer, New York. The Ellison door has a concealed door-check system. Abate remarked, "the door-checks are not strong enough to take the use they are subjected to." Abate noted that the college has been exploring more than one avenue, and has come up with three possible solutions. The first solution would be to replace door-checks, but that would only be a temporary solution since they would probably break again. The second solution would be to "disengage the equipment if the pivot of the door can continue to be used and replace the door-check.'' The third solution would be to replace the doors entirely and since that would be the most expensive solution, the college is trying to avoid it. Last week Abate received word from the Ellisou Bronze Door Company that they no longer make the type of door-check used in the doors in SLC but they agreed that the door-checks could probably be disengaged, allowing the doors to swing open and shut. Abate concluded that this is what the college will try and hopefully the doors will be in working order soon. If it does not work, however, the college will have to try something else. Dr. William Angoff, executive director for technical development at the Educational Testing Center, Princeton, N.J., will present a lecture entitled "The Role of Testing in American Education," Thursday, February 14 at 8 p.m. at Wilkes College's Dorothy Dickson Darte Center for the Performing Arts. The program is sponsored by the Wilkes College Offices of Place111ent, Testing, and Admissions, and the Departments of ·Psychology, Education, and Mathematics. Dr. Angoff has served many educational and governmental agencies involved in testing and has conducted extensive research in this field which has come under increasing publ!c scrutiny. At his lecture, Dr. Angoff will review such topics as SAT's, "truth in testing," legislation, test bias, interpretation of test results, and will responnd to questions from the public. The program is offered free of admission to the public. During his two-day visit to the campus, Dr. Angoff will meet with faculty and students, Friday, 10 a.m. February 15, in room 41 of Gies Hall to discuss topics which will include psychometric theory, morality issues in testing, error of measurement, and validity. Dr. Angoff holds an A.B. from Harvard and a Ph.D. from Purdue University. He has authored numerous articles which have appeared in the leading scientific and research journals. Prepare For April Exams! Louis Czachor MANAGEMENT OPPORTUNITIES OPENINGS IN SCIENTIFIC/TECHNICAL/MEDICAL AND GENERAL MANAGEMENT Uniformed Military Divisions of the Department of the Navy have some openings available. They include: SCIENTIFIC/TECHNICAL MEDICAL Aviation (Pilot training and RN / MD/ DO/ DD/ DDS/ Systems Maintenance) Allied Fields Computer Programming/ GENERAL Technology Accounting/ Finance Engineering (Civil/Marine/ Administration / Personnel Mechanical/Electrical/Electronic) Transportation Nuclear Power Operation/ Operations Instruction BENEFITS: Personnel can expect an Ocean Systems/ Diving and Salvage excellent benefits package which Oceanography/ Meteorology includes 30 days annual vacation, QUALIFICATIONS: 'Minimum generous medical/dental / life BS/ BA degree (college juniors and insurance coverage and other taxseniors may inquire). Federal free incentives. Dependents benefits regulations require that applicants be are also available. Extensive training no more than 27 years old (adjustable program is provided. A planned up to 3 years for Veterans and are promotion program is included with a requirements vary for Medical commission in the Naval Reserve. · Program), to ensure full opportunity PROCEDURE: The Naval Officer for career advancement. Relocation Information Team will be on campus overseas or domestically required. in the near future. Sign up today for a Applicants must pass rigorous mental personal interview at the placement and physical examinations and office or call 717 / 826-6292. Equal qualify for security clearance. Opportunity Employers, U.S. Citizenship Required. LSAT • MCAT • GRE GRE PSYCH • GRE BIO GMAT • DAT • OCAT • -PCAl VAT• MAT • SAT NAT'·L MED BOS ECFMG • FLEX • VOE NOB • NPB I • NLE ~-+lMPIAN EDUCATIONAL CENTER le~t Prep.,rat,on Spc r,.111\t~ s,nce 1938 Please Call Collect for Information · ( 215) 435-2171 Masonic Temple Bldg. 152-t Linden St. Allentown, Pa. 18102 Classes Formin Now! �February 7, 1988, The Beacon, Page 9 Grapplers Add Three Victories To List The Colonel wrestlers added three victories to their record in last week's action to raise their slate to 12-2 and keep an 11-match winning streak alive. Last weekend the Wilkes grapplers dominated an NCAA t riangular wrestling meet with a 347 triumph over Southern Connecticut and a 39-9 victory over Connecticut at New Haven, Ct. Trian_gular and Quadrangular meets are popular during the second half of the season because they serve as a tune-up for tournmanets. A wrestler can compete in two matches in a tri-meet-and wrestle up to three bouts in a quad-meet. The Blue and Gold will participate in a quadrangular six days before their tourney in an effort to buld endurance for the event. A tri-meet also gives the coach an opportunity to give the reserves some action and at Wilkes, many of the jayvees are only one point away from varsity. Freshman Kris Rowlette, Nashaua, New Hampshire wrestled in top form and paced the Colonels with two victories. Rowlette defeated Jim Miller of Southern 9-5 and decisioned Connecticut's Tom Comkowyz 13-0. Kris has filled the vacancy left by junior Eddie Johnson and shows a 3-2 varsity slate. Johnson will be trying to overcome his unfortunate leg injury for the EIWA since this is his last year of eligibility, but it is improbable. Wilkes stalwart 126 pounders Mark Popple, Wilkes-Barre, and Billy Dodge, Arlington, Va., both met some tough competition in New Haven. Popple, enjoying a good feshmean season battled to a 5-5 deadlock with Southern's Paul Bulzomi, while junior Billy Dodge dropped a 6-4 decision to see his undefeaated record go to 4-1. Junior Bryan "the pinner" Billig, New Tripoli, outscored his two adversaries 33-5 with several near falls, but just couldn't hold them on their backs. Bryan leads the squad in team points with 64, including eight pins, one major decision and a superior. His varsity slate stands at a well-respected 12-2. Mark Troutman, Toms River, N.J., is another successful freshman and boasts an 8-2 record after winning three bouts last week. Mark scored nine team points in the tri-meet with an 11-5 decision and a forfeit. Lenny Nelson a yearling from Richland, N.J., . is wrestling Bob Matzelle Knocking Heads With Opponent tough at 142 and bolsters a 5-1-i record after his draw with Southern Connecticut's Rick Babbitts. Junior Pat O'Callaghan, Verona, N.J., was called upon for varsity duties but dropped a 9-8 heartbreaker vs. Connecticut. Junior c<H:aptain Mark Densberger, Danville, saw his record fall to 10-2 when he lost a slim 7-6 decision to Southern's strong Cliff Verron in the 158 pound tilt. Sophomore George Cherrie, Fleetwood, wrestled 158 against Connecticut but suffered an 8-2 setback. Rick Sampson, a freshman from Westfield, N.J., filled the gap at 167 left by the injured Dan Miner and wrestled with authority. Sampson garnered three wins for the Reesemen and may be depended upon in the future. Miner was supposed to be back for the Penn State match but may not return for a few more days. At 171, senior c<H:aptain Bart Cook, Neptune, N.J. raised his record to 7-2 with a pin, while freshman Pete Creamer, Bellmore, N.Y., ls5-2viaforfeit. Rick Smith added six team points to the Colonel total with a fall against Southern and gained six more with a forfeit in the 190 category. The junior from Walden Vt., Is second in team scoring with 54 tallies and sports a 12-1 record. lntramurals " A" Division Chumlies Benton Boys Crazy Horse A.O.A. PrepH CAOS Champagne Jam " B-1" Division SemmyBoys Harriers ROTC Diaz Eat Them Monsoon "B-2" Division Bob-Ballers 3-1 Buckateers 3-2 Barons 3-3 Skywalkers 1-3 ,Molo's 1-4 Sophia's 0-3 . Sleazy Bedford 5-0 4-0 " B-3" Division 4-1 , Chico's 2-2 Whippets 2-3 Vets 1-4 Whipplets II 1-4 Scrap Pack Dartans Senior Bob Matzelle, Lindenhurst, N.Y., registered an 11-2 major decision over Charles Valols of Southern and took a forfeit in his unlimited class. Matzelle currently holds a 11-1 record. Wilkes clobbered Binghamton St. earlier last week with a 43-3 victory at S.U.N.Y. Colonel freshman Rowlette lost his 118 pound bout to the Colonials tough i>at Miller 10-5. But that was the last time Binghamton led as our Colonels won the next nine duals. Popple put manners on wellrespected veteran Joe Benenati in the 126 category and Billig followed with his eighth pin of the season at · 134. Nelson followed the example when he decked Greg Locke in 2:36 at 142. Densberger, Cook and Matzelle also turned the trick at 158, 171 and unlimited. Troutman earned a 13-7 decision in the 150 tilt, while Sampson turned in a 12-8 decision at 167. Also victorious was Colonel Rick Smith with a decision at 190. The "Bit Event" was expected to take place Tuesday evening at our Gymnasium with the Nittany Lions of Penn State University. If the Blue and Gold managed to pull a victory we can count on a National ranking. If not, Wilkes will have to prove themselves in the Eastern In- tercollegiate Wrestling Association tournament which is slated for February 29 to March 1 at Lehigh University's Stabler Athletic Complex. Last year the Colonels placed second in the team race and seven individuals garnered placefinishes. The Wilkesmen will travel to Long Island to meet Hofstra University Saturday and remain on the road with Bucknell University Wednesday. Last year the Blue and Gold dumped the "Flying Dutchmen" 23-15 and our Colonels lead the 24-year series, 19-4-1. Tough bouts are expected at every weight class since the New Yorkers boast a well-balanced team. At 126, Popple will tangle with Jay Beiter or Joe Petrucci, while Billig will hook heels with Lou Dionisio or Mike Hogan. If Dionisio is at 134 then Hogan will probably go at 142 and Tony Damiani will face George Cherrie or Mark Troutman at 150. Densberger will ·meet John Sauerland in the 158 tilt and Danny Miner or Sampson will wrestle Bill Keck at 167. Several faces have been seen at 171, but one of Hofstra's top matmen will go at 190 ,,, or unlimited in the person of Aurel Balaianu. He was a runner-up at 190 in the Wilkes Open. The Dutchmen placed 4th in the Rose Bowl. The Bisons of Bucknell are taking their lumps this season and will have a tough time staying with our Colonels. The Lewisburg team does have a few good matmen with Rich Salamone, 118; Doug Mayes, 126; Greg Morris, 134; Doug Young, 150 • and Bob Greenly, 171. The Wilkesmen hold a 3-o All-Time series edge and defeated Bucknell 32-13 last annum. Bob Gaetano •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• l Women Seek Winning Record ! "We're just now beginning to pull it all together as a team," said rookie coach Nancy Roberts. "With a couple of breaks we'll be in the playoffs." Her Wilkes College women's basketball team is in the midst of a three-game winning streak while raising its overall mark to 12-5. In the first game of the week, the Colonelettes took on MAC rival Susquehanna University in Selinsgrove. Junior captain and AllAmerican candidate Dinae Kendig put on a dazzling display as she led the Wilkes ladies to a 62-50 victory. Kendig, a former Wyoming Valley West standout, accounted for 22 points, nine steals and eight assists. Also, hitting in double figures for Wilkes were senior Mary Jo Frail with 12 and fershman Arnette Uguccioni with 11 tallies. Bishop Hoban grad Lynn Yedlock and Stacey Keely controlled the boards for the visiting Colonelettes. "We just ran them into the ground in the second half. Our fast break opened up the game for us. It gave everyone a chance to play, " stated Roberts. On Friday evening the Wilkes girls then traveled to Allentown to face Muhlenberg. Again, Kendig's all-around performance led the Blue and Gold a 69-56 conquest over the Allentown school. She pumped in 25 points, seven steals and handed out five asists. Yedlock to and Keely again combined to lead ·all rebounders while adding 14 and 12 points respectively. Arnette also contributed five assists. "The officials at Muhlenberg let the game get away from them, and it became a rough-house atmosphere. We were lucky enough to have what it takes to bring home a win," said Roberts. · The NCAA statistics will be released late in the week, but at last look Diane Kendig led the country, the good old U.S. of A., in scoring with a 26.0 average. Lynn Yedlock . and Mary Jo Frail follow Kendig in team scoring stats with both hitting just under ten tallies a game. Frail and Kendig top the team in assists with 49 and 42. The rebounding department is led by Yedlock with 163 and freshman Stacey Keely with 130. Kendig and Frail are the defensive specialists accounting for 124 steals between them. Teamwise Wilkes is shooting 36 per cent from the field and 61 from the foul line. Wilkes is averaging 64.7 points a game with 1100 on the year - and give up 1007 for a 59.2 average for opponents. . The 12 wins this season ties the all-time Wilkes record for one season. The women traveled to TOP Bloomsburg State on Monday Wilkes women's cage team's before hosting arch rival Scranton leading rebounder Lynn University yesterday. On Saturday, Yedlock pulls down another the ladies will travel to Nanticoke against ' the lady Monarchs of to take on LCCC at 2p.m. King's College. Gary Mack �Page 10, The Beacon, February 7, 1980 !'ext Home Meet Sat. os. EHzabetlatou,n at 4 p.m. • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Swim Team Wins In Rematch Over Lyco ming The Colonels swim team won the results, Lycoming took 8 firstover Lycoming this past Saturday place finishes to Wilkes' 4. The difat the King's College pool by a score ference, however, lies in the depth of 54-50. This was a rematch of an between the two teams. Out of earlier encounter between the two twelve events Coach Bob Greenteams that ended in a 52-52 tie. wald's swimmers took IO secondThe win came down to the last place finishes. two events of the meet but Wilkes Lycoming went for an early lead came through this time.Looking at by winning the first two events; the ............... • • • • • • • • • • • ............................. it it * . it it it lt metween The : Whl.te L1·nes by Ed.die White : lt it * Right now, the word on everybody's lips is "boycott." Like in boycotting it it the Olympics. Just about everybody has given their own opinion on thelt it issue and now it's time for Tbe Beacon to speak. We feel , the United States! lt SHOULD boycott the Olympics in Moscow. We go along with all the talk* that government should not become involved with the Olympics, but when* * hasn't it. No Olympic Ga mes have been politics-free since 1936 when Hitler* it used the games as a promotion for the Nazi party. . it * Howard Cosell, wh11 knows everything about everything, even says thelt it U.S.A. should boycott. With many nations joining the U.S. in the boycott,! : the Olympics will become a farce with hardly any competition. The U.S.A.; it could then join up with the other nations and maybe set up world games. it it We have to laugh at those TV sportscasters who say how unimportant* * Russia taking over a small country is ; the games must go on. We're forit it sports like everybody else, but freedom is a major issue here and thelt * games can wait. The best quote we've come across in this mess is from it : Dick Quax, from New Zealand, who is a veteran of two previous Olym·p ics: it and a candidate for the 10,000 and the- marathon in Moscow; "It seems* it crazy to me that New Zealand's sending a rugby team to South Africa caus-i+* ed an African boycott of the Montreal Olympics and that Russia's sendingi+it anarmyintoAfghanistandoesn'tseemtodisturbsomepeople." it it The people that think we should go to the games are just like the TV an-! lt nouncers. All they want to do is see us on TV and enjoy the games. We must; : realize that you can't trust the Russians. This whole issue could blow up in-* it to something similar to what happened at the Munich games and could beit ·* very ugly. Let's stay home and have our own games. At least this way, welt 'it can be sure of honest officials and good competition. lt '+- Speaking of honest officials, we took in the Scranton University - King•s: " t- College basketball game last Sunday at the "big gym on· North Main* Street." Here was the situation, time was running out in the first half,J++ King's holding a three-point lead and stalling for the final shot. With :02J+♦ left, Monarch George Aldrich fires up a jumper, he misses and freshmanit Rich Dooley gets the rebound, pump fakes and is fouled . This all happenedlt lt with 0:00 showing on the clock. It seems King's regular clock on the ceilinglt : was not in order, so they brought In one and put it on the baseline at the end: t I I• i i I I t * : it it it lt : it it it it : it it * it it : * it of ~i::::~hand, felt that Dooley was fouled after time had expired, but no: bu~zer had sounded. So the officials granted Dooley two free tosses and heit hit them both to give King's a five-point'lead. The refs then gave Scranton* the ball out - thinking there was a half-tick on the board left. Well the! Royals took the ball out and dribbled, but no buzzer. Royal mentor Bob~ Bessoir was livid and deservedly so. The officials had no explanation and it: looked as though the King's clock crew had pulled one over on the Royals. it Despite All-American Irv Johnson having a horrible game, the Royals it hung tough only to lose by ONE POINT. Take away the freebie points by it Dooley and Royals would have come out on top. Things had been going bad lt at King's early in the year, but it seems they've straightened them out. : Hmmmmm ! * As of this writing, DePaul remains undefeated in first place in the UPI it and AP rankings. Some are wondering if Ray Meyer's team will lose at all it this year. And to think the team is mostly made up of underclassmen. it Speaking of big-time college basketball, you had to love LeSalle's over* Notre Dame last week at the Palestra. It was a big win for the Explorers: and for All-American Michael Brooks, who is in the top five among the best* players today. It was also a big win for the BIG FIVE, making a comeback it 'it as one of the top leagues in the country. Last year, Penn went to the "final it . it four," and this season, Vill;mova lost on a last second, 30-foot desperation! lt shot by Tracey Jacson to Notre Dame by one-point and then LaSalle~ lt knocks off Digger's team. Digger's job is on the line at ND. Don't be sur- : : prised to see Al McGuire come out' of retirement and coach the Irish next it it season. Then on Saturday, St. Joe's turns around and beats LaSalle by one. it it If you want to see exciting big-time basketball, you don't have to go to the it it ACC anymore, go Big Five. * it Well, as always Wilkes College got slighted by the local media. First, we : lt must commend Joe Gries for his play-by-play in WBRE's coverage of the* : King's, Wilkes and Scranton basketball teams. Gries, a veteran, is one of it * the best around. We would like to suggest that next year, when two of the* it local schools play, let the coach of the idle team be the color-man. At least it 'it this way, the color-man they have, will have knowledge of the game. The * it slight came by way of Ron Righter. At halftime of the Wilkes - King's* * game, Scranton's Bob Bessoir was interviewed. At the Wilkes - Scranton : : game, King's Ed Donohue was interviewed at halftime, so was Ron Righter it it interviewed at halftime of last week's King's - Scranton game? No, so what it · · it else is new? . it it ,lust a final note. We have never seen such bad officiating at the college it _it level as this seasop. Wh~re are the>: t!a~ing these ~fs, Iran? : lb;................................ ....................... * R bD t O O Y 400 yard medly relay and the 200yard freestyle. The score at this pointwasl3-3infavorofLycoming. Dave Gergen won the SO-yard freestyle giving Wilkes its first win. Michelle Maguire and Peggy Butchkavitz then took first and second in the 200-yard individual medly tieing the meet at 17 all. Taking seconds and thirds in the required diving and 200 yard butterfly put Wilkes two points down 25-27. Reed Bello and Frank Gardner were on the board for Wilkes as Maguire .. nd Drew Potera swam the butterfly• A big win came in for the Colonels as tri-captain Jim Edwards and Gergen took 1-2 in the 100 yard freestyle. At this point Wilkes jumped into the lead for the first time. The score was 33-28. John Moffatt and Maguire took seconds in the 200 yard backstrokt: and .the SOO yard freestyle respectively. Reed Bello again took a second in the optional diving event while Perry Lichtinger finished third. As the meet closed down to the last two events, Wilkes was down 43-45. The two remaining events B 1• 0 U, In B The Mother Brothers and the EE's were the big gainers last Friday in the Wilkes College Mixed League. The Brothers received a forfeit that nudged tliem one game behind the Atlantic Division leading Bud's who lost their first game of the year, but still took two of three from the 752 Crew. The EE's meanwhile swept the Nukes. Charlie Hagen 155-375 and Paul Miller 163416 were the big guns despite the fact that the EE's weren't able to pick up any ground on the Pacific Division leading Avengers (Lisa Prokarym 161-447 and Paul Kanner 185-501) who blanked the Vets Club II 3-0. Bill Keba's 175-457 helped the Whippets (2-1 vs. the BS'ers ) stay in second, two games in back of the Avengers. The Midwest Division remained clogged though the Aristocrats (Steve Kevitski 20.i-504) took the Asosrted Nuts (John Moffatt 191497 ) 2-1 and the Pack cruised past Good News, also 2-1. STANDINGS Atlantic Division Bud's Compressor & Supply Mother Brothers · Poky's 752Cres Veterans Club I 3-6 Midwest Division Aristocrats The Pack 5-4 5-4 8-1 7-2 4-5 4-5 were the 200 yard breaststroke and the 400 yard freestyle relay. Coach Greenwald knew Wilkes would win the last relay. The key race was therefore the breastroke. If Lycoming took a first and a second, the meet was over. Wilkes had to get a second place. There was talk of putting Edwards or Gergen i~ for tha~ eve~t, but Greenwald decided to stack with his three ~reaststrokers: Rob Doty, Butchkavltz and Alan Shaw. Lycoming had their best swimmers in the race and the anticipation was building. Doty and Butchkavitz swam a fantastic race finishing second and third. Cuttin _, Ree"d Bello four seconds off his best time Doty was just out touched for a first. Greenwald couldn't have asked for a finer performance. The relay team of Moffatt, Enrico .Ratti, Edwards and Gergen took first addingthefinishing touches to Wilkes' second win of the season. The team record now stands at 2.31. R ·1 .e SU ts Assorted Nuts Good News The Force 4-5 3-6 1-8 Pacific Division Avengers Whippets EE's BS'ers Veterans Club II Nukes 8-1 5-4 4-5 4-5 3-6 1-8 Others: Karl Blight 248-614, Rod Wyffels 525, Kathy Kulp 187-476, John Yudichak 195-519, Chris Fields 184-463. PIN PATTER: Karl Blight 099.7 ), Norm Rickles 071.5), and Bill Petrick 072.3) hold the men's high averages in their respective divisions, while Lisa Hughes 053.8) and Robbie Bale 047.7) lead the women. V-j ► ft.U.P, . . ADDED EXTRAS . . . Perry Licbtinger did a one-and-a-half burlesque in the lay-out position over at Wyoming Seminary's pool last week . . . Rob Doty went 2% laps of " nowheres" underwater receiving a round of applause .. . Meeting his old friend Ralph at the swim team party, Pat Slowey was in fine spirits . . . Speaking of the party, let's put it this way: It was incredible . . . The swim team thanks Mr. Petrillo for coming to all our home meets and showing his support. He's the No. 1 'fan ... Kim Bush, Peggy Butchkavitz and Joe Milazzo couldn't beat Ragstein's clock and were forced to pay the price. KASCHAK DENTIST - Coach Kaschak has announced that his brother, Carl, has opened a dentist's office in lower Bucks County on Holland Drive in Holland, Pa. His phone is 355-4242 and he welcomes Wilkes students. '•••••••••H••••••H••••••••••• ~.t'ORTSWRITERS . THE BEACON is still looking for sports writers. No experience is needed. All candidates for next year's SPORTS EDITOR position should contact E d White at the BEACON office. DECKOU R'S BEER -Across from Bishop Hoban Ph. 822-7045 -Imported Beers-Cold BeerCall in Advance fo t Kegs'and Quaftets (Must have LCB Card) ·1 ; ~ -10o/.D1$CQUNJ I BP- I_ I · PTHIS u::i'A~~~ITH COUPON· I I ~ I i I- I �February 7, 1988, The Beacon, Page 11 Colonels Fight For MAC Playoff Spot Last year, the Wilkes College men's basketball team blew three chances at getting into the Middle Atlantic Conference playoffs. This year's edition might not get a chance to blow any. The Colonels' season seems to be following the pattern of a typical Wilkes basketball game - great beginning and then everything falls apart. At one time, the Wilkes team was 4-1 ; last Saturday they fell to of crafty veteran mentor Ed Donohue traveled to beautiful downtown Selingsgrove last night for a meeting with a tough Susquehanna University squad in another MAC battle. The situation is this, only two of three local teams will go into the MAC playoffs. There are 13 league games for each team. J\fter last night, here are the remaining MAC games for each team - Wilkes : Tony Madden Checks Out the Royals the .500 mark for the first time this season. Going into Wednesday's 'CRUCIAL" game with Scranton, the Blue and Gold were 9-9 overall and 5-5 in the MAC. Scranton took a 11-9 overall mark and a 7-2 conference record into that game. King's, playing better than anybody right now, is 10-10 overall and 5-4 in the MAC. The Monarchs WCLH is selling buttons 1s~ 3rd Floor Darte -Book-Anet··· Record Mart FDU Madison away Saturday; and Juniata home on Feb. 11. Scranton: at Elizabethtown on Sat., at FDU Madison on Feb. 13 and Susquehanna home on Feb. 16. King's: Delaware Valley away tomorrow; at Elbabethtown Feb.14; and FO" Madison at home on Feb. 16. The fight for the two playoff spots could come down to one date Feb; 16, when all three teams play their final league games. Before the season started, Donohue told Righter, "At the end of the year, we'll (Scranton, King's and Wilkes) all be bunched together with the same records." Boy, was he right. Anyway, the way Wilkes has been playing lately, there won't be a problem when the playoffs roll around - Wilkes won't be in them. Last week, the Colonels went 0-3. It was the third time this year the Blue and Gold lost three straight. On Monday, the Colonels hosted a tough Division II Philadelphia Tex- SNITal5 I009S (OIIPAIIY We accept Moster Charge 8. Visa 18 S. Main St. . WIikes-Barre 39 West Market Street Wilkes-Borre, PA 19701 BOOKS • RECORDS & TAPES Phone: 822-1333 125-4767 Cliff and Monarch Notes Free Parking At Hotel Sterling PARKK ...110. .D tile team, which was ripe to ·be beaten. But instead, the Colonels showed the old, "play good first half, then roll over and die." In the Textil~ game, Wilkes had a chance to take a seven-point lead into the locker-room at the half, but blew it and instead went in leading by two. Then the second half blues came and the Colonels suffered a 76-64 decision to Herb Magee's Rams. Wilkes had three men in double-figures that night : Kendall McNeil with 25,' Pat Romich with 12, and Tony Madden with ten. On Wednesday, Wilkes traveled to meet Susquehanna in a key league game and came home with a disheartening 86-69 loss as the Crusaders blew away Wilkes in the second half. McNeil, who the week before had earned AII-ECAC weekly honors, led the Colonels with 20 tallies followed by Madden with 16, Mike McCarrie with 13 and Pat Romich with 11. Madden added 12 rebounds in the loss while Romich pulled down ten playing in place of starter Kevin Walker, who was out with the flu. "I'm really displeased with the way we are playing. I don't want to metion any names, but some guys just are not giving 100 per cent. We (asst. coach Steve Justice and Righter) will take into consideration a lot of what happens in these final games, when we get together next year, " said Righter. On Saturday, Wilkes hosted Lycoming College in a game where the Colonels expected to trounce the Warriors in revenge of an early season double-overtime loss. Instead, it was Wilkes that got beat, losing 65-60. The game did not count in the MAC standings. Mike McCarrie led Wilkes with 18 followed by Madden's 16 and Pat Mccue who exploded for ten points. ~1cNeil was held to six points. Following Saturday's away MAC battle with FDU in their bowling alley, Wilkes will host Lock Haven State Monday at 8. Prior to that game at 6 the Lyco JayVees will take on a community college. Then the Blue and Gold host Juniata in a MAC game on Feb. 16 before closing the season with Bloomsburg State at home on Feb. 18. TIP-INS: . . . 17 game stats show three Wilkesmen averaging in twinfigures - McNeil 17.1, McCarrie 15.2 and Madden 10.5 ... Madden, who was recently featured in the Philadelphia Daily News sports pages, leads in rebounds with 112 . . . Tony is one of the top candidates for post-season honors . . . be also leads the team in field goal pct. with .576 . . . Pat Mccue leads in assists (86) and steals (41) ... Dave Capin and Pat Romich showing a lot of bustle coming off the bench . . . look for a lot of action from the Valley West Connection (Madden, McCue and Capin) in the final games ... public thanks goes out to Matt Engel for his help with statistics ... Roger Davis does a good job with the book, now if he could only get to the games on time, bub Rog? ... Ken Pascoe keeping his stat crew in line ... King's is slated to be in next year's Colonel Classic to defend their 1988 crown ... Ed Donohue should get MAC's coach of the year award ... look for Marquette to upset Duke this week. Eddie White It's In The Cards For Bob Feldman When General Abner Doubleday modified the school-yard game of "nine old cats" into a more organized game, the General had no idea he would be creating a world-wide sport and multimillion dollar industry. Today baseball is enjoyed by people of all ages in dozens of countries around the world. In this country players like Pete Rose make millions at the game and team owners make more than enough to pay the name players. The sport has also spawned many other industries; bats, hats, gloves, and cards just to name a few. Most American men can remember their schoolboy days .. .· a time of creamsicles, jawbreakers, and bubble gum. The bubble gum was usually a complimentary item you received in the packs of baeball cards you bought. Baseball cards were an integral part of youth. You learned to trade them, flip them, shoot them, or if the old lady in the candy store was not looking, steal them. A schoolboy stock exchange evolved from cards as more often than not one Mickey Mantle was worth at least a Cardinals team picture and a Sandy Kofax. But by the time you were twelve or thirteen your mom probably threw .your cards away or your little brother stole them from your secret drawer. Today a Mickey-Mantle could be worth more than just a Sandy Kofax. You could get a few dollars H the card was in good condition. If you found a 1910 Honus Wagner cigarette card in your grandad's attic, it would bring you about $5,000. A 1954 Ted Williams card could put $2n0 in your pocket. If this strikes you as unbelievable, just talk to ace baseball card trader Bob Feldman. Bob is freshman R.O.T.C. cadet majoring in accounting. He puts his knowledge of accounting into practical use in his hobby of baeball card collecting. He has to be effecient just to keep track of the 60,000 cards he buys each year. Bob advertises in several hobby papers, and attends numerous card collector's conventions and baseball card club meetings. After talking with Bob, it is easy to see his hobby has become an enterprise. Bob's hobby interests lie mainly in collecting baseball cards and baseball paraphernalia, as well as rooting on the Phillies (he holds a season ticket to the Phillies games) . Bob has already transacted a deal in which he sold an autographed Greg Luzinski bat to a collector in Japan. Bob has also used his 2n0,000 card inventory to make some sales netting up to 500 per cent profit. As far as advice from the ace trader Bob says, " . .. the flea markets have dried up . . . and the cards of today will not increase in value like the cards of yesterday." Bob has not made any trads on campus yet but would be happy to look at any card you would be willing to sell. �I i i i ♦ i ♦ ♦ ♦ i ♦ ♦ i i ♦ I ~--..····-·-··............................J ---------------- ------ I I I I I I -- I I I I This year Valentine's Day falls on a Beacon Thursday. I .fn , keeping with the spirit of Cupid The Beacon will have a . I I I I special insert allowing everyone on campus to send his/her I I I sweetheart a personal message. It's free, Just drop off the .I I message at The Beacon of/ice located on t he 2nd/looro/ I Parrish or in The Beacon Box .i n the Library by Sunday, I February 10. --------------------------r I I I I I I � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 February 7th Date A point or period of time associated with an event in the lifecycle of the resource 1980 February 7 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College https://omeka.wilkes.edu/omeka/files/original/2b1916c5989d3e1ab00d0cab8ecb8d34.pdf 361109e973cc7537b1a6d9de08488df2 PDF Text Text Academic Standards Committee Proposes Change In Withdrawal Policy To 4 Weeks SURPRISE! - The Jr. Class had a surprise of their own last weekend when the film "The Rocky Horror Picture Show" was nowhere to be found on the day the film was to be presented. Colleen Gries, class presi~ent, and Jon Pliskin had to travel to New York eight hours before the showmg of the film as Bill Lewis and Janet Croft set up the projectors in the gym. Gries and Pliskin arrived back in Wilkes-Barre with a half-hour to spare. 'Jr. Class Surprise!' Almost Backfired "If anything can go wrong, it will. " Murphy's Law certainly came true and sent junior class officers and executive council members into a tail-spin this past Friday afternoon. It came to light that the film, "The Rocky Horror Picture Show," featured as the Junior Class Surprise was no where near the Wilkes College campus. The junior class originally decided to go through Student Government to acquire the film; after a preliminary application was filed, nothing more was done to actually get the film . Panic first set in about noon and shortly afterwards levelheadedness took over in the form of long distance calls to New York and California in order to clear the use of " Rocky Horror" and locate the nearest reels. At approximately 3:00 word came that the junior class could use the film . One catch - the film had to be picked up In New York City at Twentieth Century Fox. Without wasting much time Colleen Gries, junior class president, aided by Jon Pliskin began their journey to New York City. The weather was not the best but the remaining officers, executive council members and friends began gathering around 7 p.m. in the gym to set up. Popping corn, rolling out the tarps, setting up chairs and cranking up the basketball hoops took place. In keeping with the Wilkes grapevine, by the time the doors opened, the common question asked was "Did the movie get here yet?" That question was not able to be answered until about 10:30 when Ms. Gries, film in hand, came through the doors, relieved the built-up tension and gave everyone a good reason to smile. A near disaster was turned into another junior class success. Margaret Scholl In an attempt to raise the academic standards of the college, a proposal has been made in the Academic Standards Committee to change the withdrawal policy from 10 to four weeks, and only allow students to sign up for audits during the first week of classes, according to committee chairman, Dr. Owen Faut. "The problem is that students take courses, begin to fail , then withdraw. The result is that when transcripts are sent out to professional schools, a " W" is viewed as an "O". This is not doing the students any good," stated Dr. Faut. He continued that the next step students take is to audit a course. Eventually withdrawals and audits will be comparable to failures, and the academic standards of the institution are compromised. The proposal states that students will be allowed to audit a course only during the first week of classes. Withdrawals will be allowed through the fourth week of classes, shortening the 10 week period presently allowed. "The quality of the institution determines whether it is going to live or die, therefore upgrading the standards of the college is crucial," stated Dr. Gerald Hartdagen, Dean of Academic Affairs. There will also be a great deal of flexibility during the first week of classes, he explained. Dr. Hartdagen continued that it is hoped ~tudents and faculty will take the question of withdrawal seriously. "The faculty have an obligation to discuss reasons for withdrawal from a course with students and examine whether or riot the student has a good reason," he stated. The two reasons this proposal is being made are, first, to determine and maintain the academic standards of the institution. Second, the faculty is unable to control classes No Recent SC Parties Arouses SG Concern · Student Government president, Dave Blumfield expressed his concern about the party situation on campus at the SG meeting Monday night. Blumfield noted that the Student Center has not been used for parties in recent weeks, and that clubs seem to be reluctant to spon- 1980 Winter Weekend Approaching Fast; 'Best Weekend' PromisedFor Everyone In the International Olympics, the competitors experience the thrill of victory and the agony of defeat, but in Wilkes 1st Olympiad, you can only experience the thrill of victory, because February 8th, 9th and 10th will be a winning weekend for all involved. The purpose of the Wilkes 1st Olympiad is two-fold : to help raise funds for the United States Olympic Committee and to provide the best weekend for the students, faculty and administration. · The weekend is deemed to be such a success that our Public Relations Department has arranged for WNEP, WDAU and WBRE to provide live television coverage, as well as newspaper coverage from the Citizens' Voice, Times-Leader, and Sunday Independent. WCLH will be conducting an opinion poll, and The Beacon and Amnicola will be right there to capture t!le excitement at the events. Applications for entry into the Olympiad are still available, but the deadline is tomorrow, February 1st, so get yours in now. Each team (comprised of 10 guys and 10 girls), will represent a country. Each team is asked to provide their own country flag, a common identifying dress, and a coach. Each team member is asked to donate a minimum of fifty cents to be contributed to the United States Olympic Committee. Twenty member teams are necessary b~cause different events will take place at the same time. Rules and regulations can be obtained at the Student Government Office. The Olympiad wilL begin at 6: 30 at Kirby Pond : where all the teams, cheerleaders, strutters, and majorettes, will meet to march over to Ralston Field. Dean Arthur Hoover will lead the parade, carrying the American flag. An invocation will be given, and Mr. John Shehan, executive member of the Chamber of Commerce, will give an introductory speech. A ceremonial torch lighting and bird- releasing will also take place at the opening ceremonies. Volleyball will be played in the gym at 8:30, followed by the Senior's "Class Feud" at 10:00 in the CPA. Saturday afternoon will offer cross-country skiing, tlig-o-war, relay races, obstacle course, ice-skating, and traying, between 11 : 00 and 5: 00 at Kirby Park. "Get lei'd", come to a beach because students pass off work during the first weeks, knowing that they can drop the course, stated Dr. Faut. With this new move, the student finds out earlier whether or not he should be in the class, thus saving time and money. The new audit policy has passed the committee, and will be presented before the full faculty on March 6. If it passes, the policy will be in effect for the Fall semester 1980. The withdrawal policy will be voted on at the next Academic Standards Committee meeting, February 5. Patti Sparlow party Saturday night at 9: 00 in the gym. "East Coast Revue" will provide a variety of music and the party will be catered and mixers will be provided. Sunday is the finals for tug-o-war and volleyball. Also, in the _gym from 2:00 to 5:00 will be an All-Anthing- Goes competition, where you can win an all expense paid vacation to Atlantic City for one week. The weekend closes with a coffeehouse, featuring Marty Bear, where the awards for the first, second, and third place teams will be given. Even if you are not on a team for the Olympiad, come and watch. Give your favorite country support and ch~r them on, especially at the opening ceremonies. Official Olympic T-shirts will be one sale for the amazing price of $4.00, starting next week ; admission price is $1.25. So;-- support your athletes and round up your teams or just come and watch. Wilkes' 1st Olympiad. NOTICE Today is Mother Tucker Day. Be sure to sign up to let a "mother tucker" tuck you into bed tonight and read you a story. · sor parties. He further explained that SG has kept with its policy of sponsoring one major social event each month. Also, CC and IDC have sponsored some activities. Blumfield gave instructions to the SG representatives to go out and ask their consituents what they think should be done to improve the party situation. Each SG member is expected to come to next week's meeting prepared to discuss their findings. In related news, SG advisor Dean Arthur Hoover announced that the last day a social event can be held is April 30. A fund request from the Art Club for $250 to pay for five art workshops was voted upon. The workshops will be on painting, ceramics, advertising, commercial art, and photography. The motion was passed unanimously. Mike Stapleton, IDC president presented a request to help IDC and CC subsidize a Concert and Lecture series event. The Concert and Lecture Series is putting in $250 and SG, CC, and IDC are each putting in one third of $250. The show will feature karate expert Hidy Ochiai, and the date will be set and announced. The motion that SG grant $83.34 for the show passed unanimously. The used bookstore on the second floor of the Student Center will close tomorrow at 4:00. Students can pick up their unsold books and cash at the SG office on the second floor of Weckesser Hall from February 1 through February 14. Auditions for ' the Red Cross Variety Show will be February 20 at 7:30 in the CPA. Posters giving more information will be put up soon. Continued on Page 7 �Page 2, The Beacon, January 31, 1980 Faculty Members Question E//ecti1Jeness••····················································· Three Plans Proposed For Dike Renovation A public meeting concerning a Wyoming Valley flood protection study was held recently in the C.P.A. The study, which is currently being conducted by the U.S. Army Corps of Engineers, is investigating feasible plans for future flood protection in each one of four areas in the Wyoming Valley; Kingston- Edwardsville, Plymouth, Swoyersville - Forty Fort, and Wilkes-Barre and Hanover Township. The current results of the study and a proposal for flood protection were discussed and the River Commons would lose walking and jogging opportunities on the dike. The river itself would be partially hidden from view. Kirby Park would lose about 2.5 acres of playing fields. The probability of flood waters exceeding the height of the dikes under this plan is 45 percent. Such a flood occurs every once 170 years. The " Agnes" Plan would provide protection against flood waters equal to the height reached by those resulting from the Tropical Storm "Agnes" in 1972. The "Agnes" Plan.. ... sense of security to people behind since the probability of the dikes beflood, and a program of urban ing exceeded is only 4 percent, a , the dike," since other means of development will be necessary to flood protection could increase the flood of this severity occurs only deal with these problems. He sug- • quality of the protection when used once every 2500 years. gests that areas of the flood plain be with a system of higher levees. other issues concerning these used for primarily recreational • three plans include a benefit-cost Although not present at the open purposes, and that the first floor of meeting, James Case and Brian ratio, possibility of induced flooding many buildings be used to . house Redmond, members of the Earth and property acquisitions. The less valuable items and easily movand Environmental Sciences faculbenefit-cost ratio compares the proed objects in case of flood. ty, have also expressed their opitection benefits of each plan with All three members of the Ennions concerning flood protection. the environmental, economical and vironmental Science faculty agree Redmond feels that costs prohibit social costs of the same plan. It has that the proposed planf fail to take the implementation of the SPF been determined that the 290 Plan several important aspt:.,.ts of the " Plan: He states that the most had the greatest benefit-cost ratio problem into account. The plans, , , reasonable action to take at this and the SPF Plan had a lowest. however, are by no means definite point is to simply maintain the preThe SPF Plan also causes the and the study of the Wyoming sent dikes, perhaps adding on to most severe induced flooding, up to Valley area will continue. The upthem . According to Redmond, raisthree times that caused by the 290 dated information and results will ing the height of the dikes will acPlan. Induced flooding is caused b" then be presented at future public complish little since there has been a reduction in the amount of !:..... m meetings. evidence of water leaking under the an area, covered by the same quanMary Kay Pogar dike. This has occurred since the tity of water, resulting in deeper dikes are built on an earth fill and levels of water in the area. NOTICE water pushes through the dike at If any of these plans are put into Official Olympic T-shirts will be the base. Redmond maintains that effect, the base of the levees will on sale starting next week. any significant additions to the have to be widened. it will then be Regularly the shirts are $8.00, but height of the levee will only agnecessary to acquire those homes they will be sold to Wilkes College gravate the conditions at the base. and businesses which are in the students for only $4.00. There are , Ths problem may require replacearea of the proposed levee. only 100 of them, so buy yours now, ment of the entire base, which A number of citizens from the for the Wilkes First Olympiad, and would cause a marked increase in communities involved in the prohelp support the U.S. Olympic proposed costs of flood protection. posed plans voiced their opinions Teams. Case stresses that urban replaceconcerning the feasibility of the ment and development should also NOTICE plans. Many of those who offered be considered in the study. People Blood Day is next Thursday, opinions supported the proposal to living on the flood plain will have to february 7 in the gym. Everyone is • raise the levees, but stressed that contend with the possible loss of asked to come out and give blood. further studies of the situation in their community was needed before any definite plan could be carried out. Colonel James Peck, who represented the Army Corps of Engineers and conducted the. meeting, pointed out that the current results of the studies are not meant to be conclusive, and another report will be given in the spring of 1981. Construction of the new dikes will probably not begin until 1985. Among those expressing their opinions at Monday night's meeting was Dr. Bruce Berryman, Chairman of the Department of Earth and Environmental Sciences at Wilkes. Dr. Berryman felt that the proposed plans were "shortsighted" in considering only construction of higher dikes. Berryman stated that raising the See Joe, Bob, and Danny levees would only give " a false -----~•-----•-------·--.,;.;· \ MON.-THURS. 11 A .M.-9 P.M. lli•~iiSi~.i~IJ r'l1JIJ5.fl TIME FOR A FACE LIFT - Pictured above is a portion of the dike system which may be repaired for added flood protection. a outlined at the public meeting. would raise the dike 5 to 7 feet, at Several proposals for increased cost of $101 ,000,000. A total of 3.8 flood protection were presented, inacres from the Kirby Park area eluding reservoir systems, river would be lost, in addition to the loss diversion, river dredging, bridge of the view of the river by the River modifications, and island removal Commons. However, this dike or clearing. However, most of these , would provide protection against plans were eliminated for enmore sevete floods. The probability vironmental or economical of the water exceeding the height of reasons. Island removal and island the dikes would be 18 percent. A clearning were retained in the flood rising to the height of these study for further investigation. levees occurs once every 500 years Plans to construct levees and in this area. floodwalls were also proposed. The most drastic proposal is the These plans represent a major part SPF Plan, which would raise the ~~t~:~1~v~ ::d:r~t~i~· c1~; adequate flood protection in this area. Three different plans were outlined, each of which would raise the dikes to a different height ; the 290 Plan, the "Agnes" Plan and the Standard Project Flood (SPF ) Plan. The 290 Plan would raise the dike approximately two feet and would cost $30,000,000 . .Under this pl@, Pfe gnant? Need he}p? You'll fi nd Confidentia l Counseling and Pregnancy Testing at ALLENTOWN WOMEN'S CENTER 1 (215) 264-565 7 1~~~ ~!~d ~!s:~J!r!r~t::ra~ct governments approximately $213,ooo:ooo. Under this plan, the River Cotnmons would be reduced to one-hall its present area due to a widening of the base of the levee in addition to raising the height of the dike. The Kirby Park area would also be reduced by a total of 15.8 acres. The SPF Plan provides the greatest flood protection, however:, • i1Jr ll [1 l]ffl I] fl [lfliS ~flrl 5.IJ5.i[lffl5. i i i l r Wilkes-Barre, Pa. 18701 ~ i Boutique• Jewelry• Clothes Layaway Available i l We Accept MoS t er Charge & v,so \ ~ ~ ll r i 9 w. Northampton St. ~ . Record Mart Men's a nd Women·s hair styl ing ma nicures and perms BOOKS • RECORDS & TAPES 125-4767 Oiff and Monarch Notes J r J L_._._.._,_,,_.,_.,_.,_._J -Book--Ancl--· Coll frank or Pete for on appointn.it 124-DU 1S S. Franklin St. · Wilkes-Borre, Po. 288-3751 r l'\"'!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!~ j BIIOOKSHAIR SALON 18 S. Main St. . WIikes Barre TUES. , WED., FRI. & SAT. 11 :00 A .M.-5 :30 P.M. j NUSMHOBER 9 P z 0 ·Q. ~ 0 u ~ MIDTOWN PIZZA N e w Y ork Style Pizza We feature Sicilian style pizza squares, serve salads, hot platters and cold or hot hoagies. We ha ve specialties such as: ~ Stromboli, Calzone, Sausage Roll and Parmigiana Turnovers ~ ~ Receive $1.00 Off = ~ ~ ;;... on any large pie with this VALUABLE COUPON < > ~ ~ > = ~ t!j (j 0 ~ ~ 0 z . �January 31, 1980, The Beacon, Page 3 Status Concerning Dana Hall Verified; No Demolition Cited By Administration (_ When the college takes more steps in its redevelopment plans and more buildings are torn down, Dana Hall will be among the first to go. Dr. Andrew Shaw, Dean of Management, explained that as things stand right now he does not envision that happening in the near future. Last semester, it was reported that dorms not having emergency lighting systems would be getting them eventually. H9wever, a few of the 17 coeds residing at Dana were supposedly told by a member of the administration that their dorm would not be getting an emergency lighting system because it would cost too much money for a building that was going to be torn down anyway. The next day maintenance people began painting the interior of Dana including the unused third floor. A source said that the residents could not understand why the"" building was being painted if it was going to be torn down, and in addition they wanted to know why the third floor could not be used since it has plumbing, wiring and working fire alarms. Shaw noted that the third floor cannot be used because of requirements of the Department of Labor and Industry which include installation of sprinkler systems and other repairs. These repairs woUld "not be cost effective," explained Shaw, "They would cost the college an exorbitant amount of money." Shaw hinted that if the form was going to be torn down soon, the painting would not have been done because the college makes no major repairs to buildings scheduled for demolition. Eugene Manganello, Personnel and Systems Coordinator, and Shaw both expressed uncertainty about the third floor being painted and both doubted that any painting was actually done there. However, sources have said that the third floor was painted. Shaw noted that the exterior of the building was painted to make it pleasing to the community and it is possible that some paint may have accidentally been sprayed inside on the third floor and then touched up. Manganello suggested that the third floor may have been painted to test a new paint spreader the college recently bought before using it on the rest of the dorm. It was noted that Dana was one of the first buildings on which the paint spreader was used and Managanello commented, "it came out very well." As far as the fire alarms are concerned, Manganello explained that it is like the unused basements of nine out of ten buildings on campus. Even though these places cannot be used, the college is required to have fire alarms there. "Before we can occupy a building," stated Manganello, "we have to submit an architect's print to the Department of Labor and Industry to be approved." He further explained that anything missing from the print such as fire alarms and sprinkler systems, is added to the plans by the Labor and Industry Department and then stamped with a seal of approval. Then the building is inspected and if anything is missing when it is checked with the plans, the building You'll be amazed at all the opportunities and advantages the Army offers men and women with BSN degrees: • Excellent starting salaries and benefits , including a liberal vacation policy. • Real opportunity for advancement and professional growth-every Army Nurse is a commissioned officer. • No basic training for nurses ; just a basic orientation course to familiarize you with the Army Medical Department. • The chance to travel; time to do the things you enjoy. • Opportunity to qualify for specialized roles, teaching or additional education. Call collect to See if you qua Iify. cannot be used. If a building passes inspection, the college is given an occupancy permit which is then kept on file. Shaw added, "all of our buildings meet Labor and Industry requirements . . .or we could not use them." According to Manganello, emergency lights have been put in dorms even though the state does not require them. He stated that Business Manager Charles Abate takes inventory of all the buildings and that the ones that do not have emergency lighting systems will get them. Shaw pointed out that many buildings here have had a short life but the college "makes every effor to make them as livable and attractive as we can - we have got to keep these facilities as attractive as we can make them." Louis Czachor SITTING PRETTY - Dana Hall is one dorm most people feel will be the first to go if the college decides to build a new dorm. This summer, however, the building was painted on the exterior and the third floor which has been closed for the last two years was also painted. Could it be that Dana Hall is going to be saved? IDC Discusses Functions Of Emergency Alert Team IDC's Sunday night meeting opened with a short description of the functions of the Emergency Alert Team on campus and in the community. The presentation was given by Mark Chichik of the E.A.T., who stated that the team "handles emergency medical situations on campus when the nurses are not available," including week nights and weekends. The E.A.T. provides transportation and medical care in medical emergencies. In addition to responding to campus emergencies, the team also is available to the community in times of need. Members of the E.A.T. may be called upon to assist the Civil Air Patrol and the Red Cross Disaster Patrol. They also help at the blood drives sponsored at Wilkes. Chichik also mentioned a few of the problems which the team has encountered. One of these was funding. Last semester, the team requested funds from Student Government to purchase •new equipment such as splints and bandages. However, the Administra- tion decided to provide the E.A.T. with the necessary funds, since the team provides emergency care when the nurse is not on duty. Another problem that Chichik mentioned was the fact that many people on campus do not know about the E.A.T. To make students more aware of the team, flyers are being sent to all the dorms informing dorm students of the services the E .A. T. provides, and ways to contact any member of the team in case of emergency. At the IDC meeting, the Food Committee report was also given. Bruce Williams, Food Committee chairman, reminded IDC reps to use the suggestion box in the cafeteria for complaints or compliments about the food . Williams also reported on the response to the suggestions given by IDC members . .The food service will now serve bagels once a month, since many students enjoyed them last semester. The suggestion to have fruit juices at every meal was also considered, and the food service is looking into this possibility. It was mentioned that Valentine's Phyllls' Beauty Salon lowntown Wilkes-Ban, llbua: DAllY lOAI · 5:30PII ~- I_TNUIS. lOAI · 9'1 357 East South St. Wilkes-Barre, PA. P•l'JII• Starting at 5 15.0I s11-, .., c.... s., .... For on appointment coll 122-7027 301-677-4891 Day will be Mexican Day in the cafeteria, with different types of Mexican food being served that day. Other ideas for different food include: milkshakes on special days, strawberry shortcake and chocolate eclair ice cream bars. Under new business, IDC President Mike Stapleton offered suggestions for an IDC-sponsored party that would be held sometime this semester. Stapleton noted that, with the olds Commons building gone, a great deal of space behind Kirby Hall can now be utilized for an outdoor party in the spring. Other considerations for this area are an IDC-sponsored clam bake or block party. Stapleton also suggested that IDC sponsor a party in the Student Center, since so few parties have been held there this year. This led to an involved discussion concerning tbe reasons that few clubs or organizations have been willing to sponsor parties in the center. Some IDC reps felt that the $30 limit on profits from the parties provided little incentive to sponsor parties. Others suggested that the structure of the building itself might be another reason that groups are reluctant to hold a party in the center. Also under new business, the IDC representatives voted to bring karate expert Hidy Ochiai to Wilkes to put on a show. IDC voted to help pay for the show, which would hopefully be subsidized by CC and SG also. Stapleton stated that the Concert and Lecture Series will provide for one half the cost of the show. Mary Kay Pogar The Army Nurse Corps. ,-------------------------------- -- ---- - ---7 1 For more information, write: I : The Army Nurse Corps. : 1 Northeast Region, U.S. Army Recruiting : Fort George G. Meade, MD 20755 1 I Name _ _ _ _ __ __ _ _ _ _ _ _ __ _ _ _ _ _ 1 I Address _ _ __ __ _ _ _ _ _ _ _ _ __ _ Apt. _ _ : City. State. Z IP _ _ _ _ __ ___ _ _ _ _ _ _ _ _ _ : 1 1 Phone _ _ __ _ _ _ ~ - - - - - - - - Age _ _ . '-; I 1 C'ASS / NE RR C 1 L--------------- ---- -----------------------~ ENIM · CORDUROY -PLUS~ ARMY PANTS. PAINTER PANTS FARMER JEANS SWEATSHIRTS FLANNEL SHIRTS loutitiiue Fallli- et II 10% DISci)UN:• OFF ANY PURCHASE WITH THISCOUPON I PUBLIC SQUARI OR 1 I I I t I l ~ .Jff9~.llltf ™"II..MAlda-1 �Page 4, The Beacon, January 31, 1980 Salwitz Responds To Clanton Letter Let's Party?!?! The third weekend of the semester is quickly approaching and we still haven't had a party in the new Student Center. Does anyone know why? Dave Blumfield, Student Government president, asked SG members to find out why parties are not appealing and to come up with some solutions. We feel this is a move in the right direction considering the time and money put into that building to meet the students' needs. Some of the problems concern the hassle and amount of responsibility required to sponsor a party. Others feel that since profits are limited to $30 for each party held: clubs, dorms and organizations are finding other ways to raise money. There are probably numerous other problems that deal with party atmosphere and contribute to the lack of response. At the beginning of the year tickets for Student Center parties were a prize possession. Every organization eeuldn't wait to sponsor a party there. Now the enthusiasm nasdied. Let's hope SG finds the right solutions to this grave problem before the entire stUEient body leaves campus to enjoy themselves on the weekends. To the Editor: Dear Mr. Clanton, Concerning last ·week's letter in the Beacon: "RIGHT ON". However you made one mistake ... You are not "a BLACK" ... you are a person. Thank You, John Salwitz '80 Careers Seminar The Communj.cation Careers Seminar series continues next Tuesday, February 5 with Hugh Finn, WBRE reporterweatherman, as the guest speaker. Mr. Finn, who last year won the Associated Press's Joe Snyder Award for broadcast journalism, will focus on the similarities and differences between radio and television news broadcasting. The presentation will be supplemented by video-taped segments from news broadcasts. A question and answer period will follow. · The Careers Seminar will be held at 11 :00 A.M. in Kirby Hall room 102. All members of the Wilkes community are welcome. Concerned Student Commends Gries For Making Jr. 'Surprise' A Success Dear Fellow Students, This letter is written to commend the Junior Class President, Colleen Gries. Even though Colleen was recently written up in the Beacon for her achievements at Wilkes, I felt that her efforts this past Friday should be recognized by everyone. The Junior Class Surprise would have been abandoned if it were not for the sincere devotion Colleen possesses. Colleen's enthusiasm in Junior Class activities should gain her the respect of all. Perhaps, if there were alot more students with Colleen's spirit, the campus would be more active. I constantly hear people complain and gripe about how dull Wilkes college life is. However, none of the students I've heard complaining are ever willing to get involved in campus activities. They'd rather sit back and remain apathetic, while the same old familiar faces who are continually involved in activities, remain involved in an endeavor to please the apathy of others. Colleen Gries is an inspiration to our campus and must be congratulated for her dedication. On Friday afternoon, the Junior Class officers and the executive council discover_ed that they were lacking a film, namely "The Rocky Picture Horror Show," which was scheduled to be shown that evening. Colleen immediately began contacting people and at 3: 30 found out that if she wanted the movie to be shown, she would have to go to New York to get it. Well, Colleen did just that. She dropped everything and raced to New York so that the Junior Class Surprise would not turn out to be "NO SURPRISE." She was able to get back by 10:30 despite the snow, and we were able to show the film as scheduled. If Colleen -hadn't gone for the film, alot more of that complaining about campus life would have con- tinued and the Junior Class officers would have been the target for much of the complaints. Again, those who would complain would never have taken the steps necessary for making the Junior Class Surprise a success. I would like to thank Colleen and all other who were involved in making the Junior Class Surprise a success. I hope that others will take the time to thank them. also, and get iQvolved ! Sincerely, AConcerned Student NOTICE On Thursday, February 7, the Cooperative Education Staff will be in Student Center to discuss Summer & Fall job placements with interested students, from 11 : 00 to Don't Forget Ground Hog Day Root OfAllEvil Let me introduce to you the most powerful man on earth. He has been here •since the dawn of civilization (if there ever was such a thing ) and he is still omnipresent in our society today. Rich men, as well as paupers, are all captives of this man. He transcends all color barriers and is equally sought after by every race, color, and creed of man. He can make fools of wise men ; he can make strong men weak ; he can cure the sick; and he can corrupt the morals of the most ethical person. He has no voice yet he speaks to each of us every day. He has no body yet he exists in millions of different forms. His mere presence commands respect and power, yet in his wake he plants the seeds of envy, greed, and hatred. This man has relatives of all different denominations. This man knows no master and makes slaves of us all. People, let me introduce you to "The Man" who manipulates, guides, and controls every waking moment of most of our lives. His last name is Bill, his first name is Dollar, and he often takes on surnames like Five, Te.1, Twenty, or Fifty. Many students have chosen to attend this college because of the excellent education which can be obtained here. These students look upon education as the backbone for the adventure of experiences in future life. However, there are some students whose sole motive for coming to this college is their desire to make money. A vast number of people in our society equate happiness with the accomulation of material wealth. These people worship money and those who have it, holding all wealthy individuals above reproach or responsibility. These profit seekers are more concerned with a person's salary than what that person does for a living. These pecuniary people believe that it is the lack of money which is the root of all evil. Unfortunately. some students on this campus have been guided by this same profit motive. To better understand these previous statements; ask yourself why you have chosen to obtain an education at this college? Have you chosen your future career on the basis of its pay scale regardless of whether or not you feel that you will enjoy, be good at, or contribute to what you are doing? Do you measure success by the amount of money a person ha accumulated? Are you unhappy with your career choice hoping only that a salary will ease the tension and frustration? Is your career choice a personal decision, or has it been manipulated by the whims of peers? A student must attempt to seek personal answers to questions such as these so that he can better understand himself and his environment. Be honest with yourself and get in touch with your own genuine feelings.and emotions. Happiness should be the motivating force behind everything a person does. Do not let your pursuit of the unattainable "American Dream" lead you into a Fools' Paradise. David A. Clanton ---tbe-:>beaoon-.....-... USPS 11:12--01111 Editor-In-Chief Jim Edwards I :00. Saturday,Feb.2nd r• NOTICE Anyone interested hi doing photography work for the "Beacon" next year, contact Bob Gaetano at Gore Hall. •Maggie SCJys• » •• •1 t.~~a~'s 1!a~p~n~?u_ ~ -- -- -- -- Asst. Op-Ed F.ditor Margaret Scholl Asst. News Editor Louis Czachor Sue Freda The Theta Delta Rho Dinner Dance will be held February 8th at the Woodlands. A sit-down dinner will follow the cocktail hour. It is openbar and Phoenix will perform. Tickets are $25 a couple and are on sale j ' the Student Center at lunch hour. -r Op-Ed Editor Perry Lichtinger Bob Gaetano Donald Hall will read from his works and discuss .them on February 5th at 8 p.m. in the Dorothy Dickson Darte Center for the Performing Arts. A reception will follow . -- Copy Editor Patti Sparlow Advertising Mam:.;er Vanessa Martz Business Manager The Exhibit, "Old Masters' Prints" is currently on display in the Sor- ~ doni Art Gallery. The exhibit is on loan from the Lycoming County Historical Society and Museum. The show includes works of Picasso, Renoir, Direr, Rembrandt, Chagal, Lautrec, Homer, Sloan and others. ~ Gallery hours for the show are daily and Sundays 1-5 p.m., Thursday evenings 6-9 p.m. and Saturday from 10 a.m. to 5 p.m. Tours are invited and admission is without charge. The exhibit will remain in the gallery until February 4th. - News Editor Peter Steve Photographer Student Government will show the film "Frenzy" on Friday, Feb. 1st, in Stark 101. The showings will be at 7: 00 p.m. and 9:30 p.m. ~ Sports Editor Eddie White Ill Managing F.ditor BillTurcan - Circulation Mananger Michele Serafin REPORTERS : Cindy Ercolani. Lisa Gurka, Mary Kutz. Sue Loveitt. Gary Mack, Bill Miller, Rich Nordheim. Ana Nunez. Mary Kay Pogar. Darlene Schaffer, David Stahl. Advisor George Pawlush 1:~~~~~::~:. W!!lles-Barre, Pa. 1Kil6 Plllltllshed weekly during the school year from September to May except fer vaeation periods and semester breaks. Entered as second class postage paid la WUkes-Barre. Send form no. 35it to The Beacon. Wilkes College, Wilkn-Bartt, Pa. 111716. Subscription rate to non-stlldents: U per year. Advfflisillgrate: $Z.50percolumalnch. Phone: (7171 K2.l-t'51, Ext. H3 · All views expressed are those of the individual writer and not necessarily of the pabUcatiea of the college. •••••••---••••-----------• �) . January 31, 1980, The Beacon, Page 5 Outdoor Club Pursues Adventure While most of us were enjoying a turkey dinner prepared to perfection on Thanksgiving Day, members of the Outdoor - Adventure Club were having another delicacy - Chef- Boyardee- SkilletPizza. It wasn't so much the meal There are 26 active members in the club and they take part in such activities as backpacking, crosscountry skiing, ice-climbing (at Rickett's Glen), white-water rafting and canoeing, and rockclimbing. "As far as climbing goes, TOTALLY IN AWE - The serene beauty found by the. members or the club in the Adirondacks more than compensates for some or the rougher trails ahead. (Photo by Paul Torre) that was being enjoyed but the setting - the Adirondack Mountains in New York. The Outdoor Adventure Club has been in existence for over a year now. It was originally started by Paul Torre, this year's vicepresident; Loren Copeland is the president. Paul originated the club to bring people with the same interests together and "because it wasn't there and the school needed adventure." we practice locally and do the rest of our climbing in New York state," Paul explained. The club boast at being a "no experience needed" organization: you provide the active interest and enthusiasm in their activities and they will teach you the essentials for the outdoor sport that you. are interested in. "You have to spend the money on the necessary equipment but it is not a one-shot deal," Jim Makowski, active club Outer Limits by Flash Gordon member, stated, "you'll always have the eqiupment for your future endeavors." Many people will probably sit and wonder "why" people would want to take part in such activities that are potentially dangerous rather , than play it safe on a basketball team or such. Both Paul and Jim echo the same sentiments, "We acquire self-reliance in the outdoors and find a fellowship among the people we travel with. We try to instill the self-reliance in the new members. You're going out there for your own sake, not to show other people what you can do, but to show yourself." Comparing it to a basketball game, Jim explained further, "At a game, one team will win. Out there nature always wins ; it's clean and quiet, not like the city!'' Members of the club find nature the ultimate challenge; it's noncompetitive. The stakes seem high but you will be in competition with yourself. Those who went to the Adirond_ack Mountains over Thanksgiving break include: Paul Torre, Loren Copeland, Nick Golowich, Carl Germick, and Jim Makowski. While in the Adirondacks they hiked up Mt. Marcy, the highest peal:t in New York, with 50 mile an hour winds ONE OF THE BRAVER SOULS and a 20 ft. visibility range. - Jim Snell prepares to push off Because of weather conditions the again in his descent from the top of adventurers took the trail lip the a mountain. This is done by pushing Gothics Mountain instead of climbout and allowing yourself to drop ing it. several feet by giving slack to the It certainly doesn't seem from rope. (Photo by Paul Torre) the way Paul and Jim talk that they missed the traditional turkey dinner. "The skillet pizza was so good because we were so damn hungry." Being away in the Adirondacks gave the hikers a feeling of serenity as they fell asleep to the sound of the wind rolling down the mountains. Jim said, " It was like being away for weeks. It eraced everything; it was like coming back to a new semester." Other adventures that the club is planning are running the Lehigh River once again, having a crosscountry ski clinic (when it snows), and hiking in the Presidentials Mountain Range in New Hampshire and possioly Mr. Ranier, Washington. What would the average person get out of joining the club? "Whatever she or he put into it. If you try there is no denying you. The only thing holding you back is you're non-involvement." Paul emphatically stated with a definite voice of experience, "Knowledge comes easy. These activities are not for people who just want to try it once." The club welcomes anyone to to come to their meetings to see if the activities suit them. "We are looking for a new fresh blood to keep the club going strong," Paul commented. Meetings are held Thursdays at 11:00 in Stark Rm. 127. Today is the elections of new officers - and may the best man win! Robert Service expresses exactly how the club members feel about their adventures: I have clinched and closed with the naked North, I have learned to defy and defend; Shoulder to shoulder we have fought it out yet the wild must' win in the end. Margaret Scholl �Page 6, The Beacon, January 31, 1980 _ Dr. MahmoUd Fahmy Expresses His Pride Concerning Teaching And Global Education When the MSA Evaluation team recently came to Wilkes for their periodic report, they commented that the strength of Wilkes educational program began with its faculty. They did not mention any faculty members in particular, but, if they had made alist of the most outstanding members, the name of Dr. Mahmoud Fahmy would surely have been listed. The credentials of Dr. Fahmy, Associate Professor in t he.Department of Education, are exceptional in every respect. His past educational and professional background, as well as the long list of his current involvement in the community, all point to his strong commitment and deaication to education, and for J he better ment of society in general. Although now -residing in Dallas, P a., Dr. Fahmy was born in Alexandria, Egypt, where he attended both high school and college. In 1953, he received a Bachlor of Arts degree, with honors, from the University of Alexandria where he was also very active in student run political activities. His involvement lead to his being elected president of the Arabic Student Organization which served to unify and promote the opinions and voice of all Arabic students. Recognizing his ability and potential, the Egyptian government granted him a scholarship to continue his education in the· United States. By 1960, not only had he received his Master's Degree from Columbia University but, he also met and married his wife Irandukht who is also a teacher. The Fahmys now have three children : Roya who is presently a sophomore Hahnemann student, Raef and Randa both high school students in Dallas. After receiving his M.A ., he spent three years as a teaching assistant at Syracuse University. Then, he moved on to Bucknell University where he served as an Assistant Professor until 1968. When he left Bucknell, he then came ta Wilkes and has been here ever since. In 1973, he earned his Ph.D. from Syracuse and was promoted to an .Associate Professor at Wilkes. Since arriving here, Dr. Fahmy has also managed to teach part-time at Bloomsburg State College ('73) and the University of Pittsburg ( '76 ). " I am a teacher, and I am proud to be a teacher," he states. "I love my profession, and I respect the students individuality and personality. What excited me about teaching is it has a lot of potential. " Dr. Fahmy continues, " We're not dealing with objects but, with human beings who are full of promise for the future. It's very exciting to deal with the different personalities, and to be able to open new horizons." Concerning his role as a teacher here, Dr. Fahmy confides, "As a teacher, I have an open door policy. I want students to come to my office and talk whenever they want. I would do anything asked of me by a st udent or another teacher, day or night. " For twelve years, Wilkes College has been a big part of Dr. Fahmy's life. He confidently states that Wilkes is a very good college. As he puts it, "Wilkes is truely the Ive League school of northeast Pennsylvania." His view is this, "I look at Wilkes not as an institution but, as a community with it's people working together for a common goal. The administration, faculty, student body and staff working together to achieve high horizons." He also states, " I wouldn't send my children here if I didn't think it was a good college." Dr. Fahmy sees Wilkes College as being more than just an isolated place to teach students. " This college is an integral part of the community. We should be prepared to take leadership to promote the welfare of the Wyoming Valley. The students that graduate fram Wilkes are our ambassadors in the community. We have to be careful in what we say and do concerning local affairs. " Dr. Fahmy is the kind of teacher who believes the best way to teach is by example. " I'm teaching my students to be better than I am, to go beyond what I do," he states and adds. "Being involved is part of my responsibility to my community and to my country." After looking at the many civic and professional arganizations he works with, one would wonder where he finds the time to handle everything. Last Nevember, Dr. Fahmy was elected Director of the Back Mountain School Board. He also holds seats on the Board of Child Development Council, the Curriculum Council of the Intermediate Unit 18 in Kingston, the Citizens Advisory Council, the National Council for the Social Studies, the Pennsylvania Council for International Education, the American Association for Higher Education, and still others. The position Dr. Fahmy holds dearest is being coordinator for the Luzerne-Wyoming Counties Social Studies Council, which represents all public, non-public, parochial schools, as well as, colleges and ether professional organizatiens. It's function is to promote the (iUality of teaching social studies in the schools of this area. It's goal is to develop a forum . where teachers and professionals can meet and discuss issues. One such issue that has raised deep concern is American's lack of understanding of world affiars and international cultures. Dr. Fahmy comments, "We are the biggest, most powerful democracy on earth. We can not escape the responsibility to understand other cultures, and to provide leadership." Although it was recently mandated for the schools to help students as early as possible to get in touch with, understand and appreciate other cultures, Dr. Fahmy isn't at all pleased with the progress made. As he put it, ''.So far, we've done terribly." In a report by Ernest Boyer, U.S. Commissioner of Education, it is reported that less than one percent of the college-age group in the United States is enrolled in any couse which specifically teaches about international issues. It is also reported that only 2 percent of American students are taking a foreign language. Dr. Mahmoud Fahmy "Everything about this world is intertwined; food, economics, population and energy," Dr. Fahmy points -out. He elaborates, "Students have to understand that we are living in a global village. Either we live together or we perish." Dr. Fahmy is involved at the state and national level to promote this new imperative of Global Education. He mentions that, "The emphasis isn't on separate international knowledge but, on our intertwined destiny. In order for our children to understand this, it should be expressed in the educational system." Another issue that has special importance in this area, and one that Dr. Fahmy is involved with is the promotion of Ethnicity. Being selected coordinator of the Pennsylvania Ethnic Studies Center, Dr. Fahmy points out that the Wyoming Valley is a perfect example of many ethnic groups living side by side. According to Dr. Fahmy, " Being ethnic doesn't mean being chauvinistic as in putting other groups down. Yes, it means being proud of your own background and being American but, it also means understanding and appreciating other cultures." He points out, "Doing this makes you more American because, we are a nation of nations." Commenting about the state of education today, Dr. Fahmy says, "I'm proud to be a professional , but, education is treated as second class." He goes on, " It bothers me that we do not take teaching seriously. Teachers should think of themselves as professionals. " Concerning the future directions of education, Dr. Fahmy admits, "I'm aware that the market for teachers is tight. l would like to see Wilkes and other colleges preparing students for alternative possibilities in the social sciences." He continues, "Areas such as working with children outside the school, or working with the aged, in mental health or social work, and other opportunities should be open to students of education. We should ' give them this . >pportunity ." In closing, Dr. Fahmy sincerely says, "This is my life; to facilitate communication between people, to bring them together. All my activities in the community go towards promoting Wilkes. We have a good faculty, the students are good and the facilities are good. People should know this.' ' Perry Lichtinger NOTICE The Earth and Environmental Science Deparment will sponsor a bake sale in the Student Center today beginning at 11 a.m. . Starting a sales career at X erox is an education unto itself. Xerox sales teams don't just knock on doors. They determine our clients' needs and work out solutions. Xerox has a unique sales training program which gives our people the competitive edge they need in a rapidly changing marketplace. Xerox sales teams are a study in aggressive leadership. And they built a path for your advancement. At Xerox, we know how to-reward hard work. Our sales teams advance quickly and enjoy their success. And, of course, sales come easier when you work for a leader. Our equipment is well known for a high ·degree of dependability and our clients know that . They also know that they get what they want when they need it . Graduate into a Xerox sales career. We're your information center of the future . Check with your college placement office for campus interview dates and schedules. Then talk to our campus representatives about careers that can't be duplicated. XEROX Xerox is an affirmative action employer (male/ fema le). �- - - - - ---- - - - - Careers In Communications---------- January31, 1980, T!eBeacon,Page7 !Seminar Features Dunleav~ Teacher Evaluf!tlons "The two ingredients of a broadcaster are glamour and grit," said Debbie Dunleavy, co-anchorperson for WDAU-TV news in a Communications Seminar held January 22. She continued to say that the glamour is the surface side, or what the viewer sees. " It's being recognized almost everywhere you go," she stated. She believes that this alone could not carry anyone for very long. "Although it's fun, there's got to be something underneath," said the anchorwoman. The other side is the grit, a combination of soul, fortitude and caring. "Caring is especially hard. Journalists have to stive to remain uncynical because of all the ugly topics covered in the news," said Ms. Dunleavy. People can become Debbie Dunleavy impenetrable and any caring fades - - - - - - - - - - - - - away, then they become callous 'no'. "The media can't take no for · and cynical, she e~lained. "It is · an answer," said the · anchorvery important to care about what woman. you are saying as a In the beginning of her broadnewscaster, "she said. Another casting career, Debbie Dunleavy aspect of the grit is dealing with had two sentiments. One, everyone people you must in order to get was cynical and two, broads should stories, especially when they say be out of broadcasting. "I was determined to do a good job of informing the public," she explains. The public needs to know the parameters of their world, and it is through the news they find this out. "My main objective, however, is to become respected as a writer in the industry," she said. · Starting out as the newsroom slave, "I did all the jobs nobody else wants to do," explained Debbie Dunleavy. The she was soon doing radiocasts and weekend reporting. She stated although obstacles come up daily, her first obstacle was getting someone to give her a break with no academic or practical experience in the field. A graduate of Wilkes with a degree in English, she stated both academic and practical experience could be very helpful for jobs in the communications field. Ms. Dunleavy finds her job constantly challenging, exciting, and sometimes exasperating, but "I am very happy at my work and I love reaching out and touching the minds of the people through my broadcasts," she said. I Patti Sparlow HERFFJONES COLLEGE RING FESTIVAL SAVE UP TO $18.951 May End Th lS Year Student Government has cona vitalization project for the camducted evaluations of professors for pus. A student with a project in a three years, but 1980 may be the class could use his talent to enhance last year. the college. An art student, for inAccording to Ana Nunez, a stance, could paint a mural on a member of Student Government campus wall rather that on a canAcademic Committee, the evaluavas. The Academic Committee tions were instituted with two obwould coordinate the student with jectives: giving students an imput his task. Another idea is for the into the quality of their education committee to unify the students apand helping guide students in selecproach, especially on college ting courses and r~"fessors. policy. ' Thirdly, the committee The second objective was rarely could pull together the range of met, Nunez says, because "The _ various other academic commitfreshmen were limited by core retees. • quirements. Regular students were The fate of the student evalualimited by requirements of their tions should be known by the end of major, and even if you used evaluathis year. tions for your electives, half the David Stahl time you'd find the class was closed at the Registrar's Office. You took what was open." Furthermore, students consult the grapevine to find out the merits or drawbacks of a course of professor. The form of the evaluation was acceptable to faculty and students last year, but there was still problems. "Each member of Student COPUS will conduct a voter Government had to go into registration drive on February 7, anywhere from twenty to twerityfrom 11:00 to 1:00 at the Student six classrooms before finals," Center Cafeteria. Nunez says. "Evaluations come at a bad time - most people have stuTom Farley, communications director of COPUS, said "COPUS is dying to do. And it takes a lot 6f spensering this so students can use manpower to hit all the classes. In the clout that the law gives thein. order to do it effectively and effi· An impertant thing that COPUS ciently, we would have needed an stands for is increased financial army of clerks and secretaries. " aid, and some legislators have a The evaluators had to get the permission of the instructors, so better aid record than others. The eighty-nine courses were evaluated more students that vote in this in 1978. Sometimes, an evaluator district, the liklier he will support financial aid." would go into a class only to find it had been evaluated already. According to Farley, COPUS will "This was all very discouraging have people there if any student has because the students didn't use a question, though, "The forms are them this year," Nunez says. easy to understand. It's not like a tax form ." Farley said. "And, it Meanwhile, Student Government, dcezn't take more than a couple of at their January 21 meeting, decidminutes to fill it out. You really ed to wait for a faculty report have very little to go through to get before making a decision. Nunez the right to vote and be heard." propesed at the meeting that if that David Stahl report is refected by student government, they could go to an outside agency to construct and administer the evaluations. That faculty report concerns TREC, which is attempting to establish a criterion for teacher efContinued from Page l fectiveness. In other words, a proThe film committee announced fessor that has the qualities listed in that the Alfred Hitchcock film the report should be an effective "Frenzy" will be shown tomorrow teacher. Because faculty commitat 7:00 and 9:30 p.m. in the CPA. tee's usually meet once a month, The academic committee the report should come out in reported that teacher- course February. . · evaluations will be suspended until "One purpose of the evaluations the findings of the Teacher has been to give students some inRecognition and Effectiveness put into the quality of the course or Committee (TRECl are analyzed. professor." Nunez continues, "This The committee is also looking into could be expanded if Dean Hartthe possibility of having an outside dagen, the new Academic Dean, agency develop an evaluation form decides to recognize the evaluato be used in future evaluations. tions as a basis for promotion and Blumfield announced that his tenure. That way students would evaluations of SG committees are have some say in faculty matters." compl~ted and his evaluations of Professors would have to let students evaluate them by doing SG representatives will be finished by the end of the week. this. Another matter concerns the SG It was announced that tickets for Academic Committee, which met in the Steve Forbert concert are on the summer and decided that the sale now in the bookstore. Tickets "cost and labor of the evaluations cost $6.00 if purchased in advance was not a warranted focus of the and will be $7.00 at the door. committee," Nunez reported . If the Two new representatives were evaluations are discontinued, welcomed to SG. They are senior Nunez gives three possible duties Sue Suchanic and freshman that the Academic Committee "Cowboy" Bill Ronayne. could fulfill. First, it could focus on Louis Czachor COPUS Holds Registration For Students Student Govt. HERE'S HOW! - $10.00 OFF ON ANY ULTRIUM"RING • •• PWS SELECT A CBS RECORD, TAPE OR CASSmE (VALUES TO $8.95), WHEN YOU ORDER A 10K GOLD OR ULTRIUM.RING! SEE MUSIC SELECTION WHEN YOU ORDER.* * MUSIC SELECTION HAS NOW BEEN POSTED IN BOOKSTORE Special offer available, and ring orders taken a t : l Place: \ BOOKSTORE Date: _ __FR _I_D_A_Y~,_F_E_ BR _U _ A_R_Y_l_ _ _ _ _ __ Time: 10 a .m. to 4 p.m. DEPOSIT REQUIRED: $10.00 NEW RING STYLES NOW ON DISPLAY , . �Page 8, 'lbe Beacon, January 31, 1980 The Problems Of Hotel Life; CC Announces Valentines Party What Are Conditions Like? The Hotel Sterling with approximately 110 student residents is one of the largest resident areas in Wilkes. One question constantly being asked is, what are the living conditions like in the hotel? According to the hotel manager, Murray Popky, the hotel has "adequate rooms and living conditions." He believes that the rooms are of a reasonable size with an extra added feature that the dorms do not have ; namely a private bathroom facility for each room. In his opinion the rooms are equal to, if not better, than the dorm rooms on campus. Kevin O'Brien, one of the hotel resident assistants, agrees that the rooms are adequate. "The rooms in the hotel are about the same size as the ones in New Men's," he stated. He also added that the private bathrooms are a welcome conve. nience to most of the residents. However, the hotel is not a new building. Popky agreed that, "The hotel is an old building and this causes some problems." He added that the hotel tries to solve these problems as soon as they are discovered. " There's only so much which can be done due to the cost of maintenance on an older building such as this one. We try our best and I believe we solve the problems which are brought to our attentions." He stated that the hotel has a limited work force which further limits the amount which can be done in a given period of time. Some of the problems which have arisen in the hotel include bug~, leaky pipes, rhodents and dripping ceilings. Director of Housing Paul Adams states that there are problems at the hotel, stating, "Any major problems result in room changes whenever possible." He adds, "all problems dealing with the hotel are to be reported to the RA's and then in turn they are reported to the hotel maintenance and the college. This keeps us up to date on the hotel situation.' ' Commuter Council announced that their upcoming activities are well O'Brien said, "The students are underway. The St. Valentine's Day informed from day one that any Party will be held February 15 with problems should be reported to the the top 40's group "Chance" performing. Poly-Care will be catering RA's. " · As for past problems he said, "We had some problems with the event. Mixers will be provided. The other major upcoming event bugs and rhodents but the rooms were sprayed and we haven't had is the St. Patrick's Party which will be held on March 14 at the Sterling any new complaints about them. '' With the increase in enrollment Hotel. Expected to perform is the the number of students living in the group "Nature's Way. " Proposed hotel has also increased. Popky ideas for the party include having believes that the students are better green punch and green beer. It was also mentioned at Monthis year then in previous years. "There have been fewer incidents day's meeting that there might be involving the college students this an Ice-Skating party sometime in year than in the past," he remark- the near future at the Coal Street ed. " I have very few complaints Ice-A-Rama. Anyone interested inwith the conduct of the students helping with the event in any way is who are living in the hotel this asked to come to the Social Comyear, " he added, " and they seem to mittee meeting on Tuesday, like it here because the college is · February 5. The Committee meets having difficulty getting many of on the first floor of Weckesser Hall the students to leave the hotel for in the board room. The Beacon Valentine's Extra dorm space on campus. " O'Brien concurs that most of this was also announced during the year's students do not like to leave the hotel. "We have trouble moving the students into dorms. Many of them do not want to go. " He added, "Most of the hotel residents this Jan. 28 marked a new pilot proyears are freshmen and it seems that they have heard some stories ject from the Admissions Office, about New Men's and the other the Admissions Telethon. Thirtydorms. They tend to believe these three Wilkes College students manstories and are not eager to move to ned the phones and spoke to potential students answering their inthe dorms. " Adams stated that the college is quiries about Wilkes, college life, trying to relocate as many students and procedures_ in applying. The from the hotel as they can. " It's not trained student callers used both so much due to problems in the Chase Hall and the Alumni House to hotel, instead it's a matter of cost. talk to area students and provide It costs ·the college a great deal to them with the maximum amount of keep large numbers of students in information about Wilkes. Many of the hotel and we're trying to reduce, the Wilkes students who called also this cost by relocating the hotel assisted the Alumni in their Telethon. Mrs. Debbie Stratton, students to dorms." The college and the hotel agree assistant Dean of Admissions, that the hotel is an older building noted that student callers were with several problems which could " anxious to help and excited," and inconvenience and cause discom- added that the students felt that fort to the student residents who they could identify with the high live there. They insist that the pro- school students' questions and worries. blems are being dealt with. Bill Turcan Ana Nunez Adm. Telethon Pilot Project Involvement Stressed In 2nd. Visitation Day Student Panel discussions, seminars and tours are included in the activities that students accepted at Wilkes College will attend during Visitation Day, scheduled for Sunday, April 13. Visitation Day, sponsored by the Admissions Office, had a large response Last year. Although it was a new idea, some 900 students, parents, faculty and Wilkes vounteers turned out to help future underclassmen get used to life at Wilkes. The basic idea behind Visitation Day is group involvement. Seminars and discussions introduce student service personnel, detail procedures in registration, provide information on curriculum and financial aid and even prepare parents for changes to expect in their sons and daughters when they begin college in the fall. One of the strong points in the program is the amount of support by Wilkes students. Approximately 90 students assisted visitors in touring the college facilties, provided directions and informed students of campus organizations at the student booth display . The booth displays, featuring 50 clubs and organizations, were " an extremely successful" portion of Visitation Day, according to Mrs. Debbie Stratton, Assistant Dean of Admissions. Stratton emphasizes that Wilkes student involvement is an integral part of Visitation Day and anticipates continued support this year. The program boasts success in that 74 percent of those involved in last year's events registered for the Fall semester. Although no specific schedule has been adopted for the 1980 Visitation Day the Steering Committee is presently improving on last year's attempt and plans a busy day for the 541 presently accepted students. Members of the 1980 Visitation Day Steering Committee include: Art Hoover, Brad Kinney, Eugene Manganello, George Pawlush, Jon Pliskin, Gay Meyers, Nancy Onuschak and Elaine Slabinski. Ana Nunez meeting. The Beacon will be carrying a special Valentine's centerfold which will be made up of personal Valentine messages. Anyone interested in having their valentine message printed is reminded that the deadline for their message is February 11. All messages should be dropped off.in the Beacon box in the library, or dropped off at the paper's office at -Parrish Hall or given to any staff member. The same policy used for the "Letters to the Editor" will apply to the Valentine messages. At the end of the meeting, Joe Knox reminded everyone that COPUS is in the middle of a letter writing campaign. All students are urged ·to write a letter to their senators about the Reauthorization of the Higher Education Act (H.R. 5192). Sample copies of a mock letter are available on request in the COPUS office. All letters should be duplicated and dropped off at the COPUS office on the second floor of Weckesser Hall. Darlene Schaffer KIRBY HEALTH CENTER ANNEX 63 N. FRANKLIN ST. WILKES-BARRE 824-8921 MON.-FRI. 8:30 a.m. to 5:30 p.m. Evenings by Appointment Confidential services available regardless of age, sex, marital status, or ability to pay. MANAGEMENT OPPORTUNITIES OPENINGS IN SCIENTIFIC/TECHNICAL/MEDICAL AND GENERAL MANAGEMENT Uniformed Milltary Divisions of the Department of the Navy have some openings available. They include: SCIENTIFIC/TECHNICAL MEDICAL Aviation (Pilot training and RN / MD/ DO/ DD/ DDS/ Systems Maintenance) Allied Fields ' Computer Programming/ GENERAL Technology Accounting/ Finance Engineering (Civil / Morine/ Administration / Personnel Mechanical / Electrical / Electronic) Transportation Nuclear Power Operation/ Operations Instruction BENEFITS: Personnel con expect an Ocean Systems/ Diving and Salvage excellent benefits package which Oceanography/ Meteorology · includes 30 days annual vocation , QUALIFICATIONS: Minim'um generous medical / dental / life BS/ BA degree (college juniors and insurance coverage and other taxseniors may inquire). Federal free incentives. Dependents benefits regulations require that applicants be are also available. Extensive training no more than 27 years old (adjustable program is provided. A planned up to 3 years for Veterans and ore promotion program is included with a requirements vary for Medical commission in the Naval Reserve. Program), to ensure full opportunity PROCEDURE: The Naval Officer for career advancement. Relocation Information Team will be on campus overseas or domestically required. in the near future. Sign up today for a Applicants must poss rigorous mental personal interview at the placement and physical examinations and office or coll 717 / 826-6292. <Equal qual ify for security clearance. Opportunity Employers, U.S. Citizenship Required. �January 31, 1980, The Beacon, Page . King's Edges Ladies 67-65; BET••rvv"llr ,,,'/Lrv Entertain Scra~ton Wednesday ,.,. DDlY .I..J D Since the last Beacon, the Wilkes College women's basketball team had a 2-1 week to update their overall record to 10-5. Last night the ladies traveled tq Selinsgrove to meet Susquehanna and this Saturday the Colonelettes will be in Allentown to meet Muhlenberg College. On Feb. 4, they again travel to Bloomsburg to meet the Bloom State Huskies before hosting the Royalettes of Mike Strong and Scranton University on Feb. 6 at 6: 15 prior to the men's contest between the two schools. On Feb. 9 the ladies will travel to Nanticoke to meet L.C.C.C. A week this past Sunday, the ladies hosted Upsala" College from East Orange, N.J. and downed the Yikes 74-68 in the MAC contest. Diane Kendig, who continues to lead the nation in scoring, led all scorers with 33 tallies followed by freshman Joanne Gismondi with 12 and senior Lynn Yedlock who netted 15. This past Saturday the ladies traveled to Doylestown and met the Aggies of Delaware Valley College. Former Meyers standout Mary Jo Frail scored 16 points to lead Wilkes to the 71-64 victory. Wilkes, behind most of the game took the lead with five minutes left to play and never looked back. Diane Kendig chipped in 16 for coach Nancy Roberts' team and Yedlock added 11 tallies. In between the road trips to Doylestown and East Orange, the ladies hosted rival King's College and fell in a heartbreaker 67-65. Earlier in the season, Wilkes fell at the "big gym on North Main Street" 8476 to the Lady Monarchs. In the King's game, Kendig again led the way with 29 points followed by Mary Jo Frail with 12 and Lynn Yedlock and Stacey Keely with ten each. Keely has really been playing well of late and could be a great one before her career ends at Wilkes. Kendig added five steals in the game while Frail recorded four take-aways. Yedlock controlled the boards with 11 rebounds followed by Keely with eight and Kendig with seven. Frail and Gismondi each garnered six assists in the game. The King's-Wilkes game was like the one the men would play the next night - a barn burner. The first half saw the Lady Monarchs lead 31-30 at intermission. The lad switched hands during the second period before King's took the lead in the last few seconds and Wilkes missed a lay-up as the buzzer sounded for the loss. King' s was led by the sister combo of Terri and Mary Beth Bowler, who combined 46 points. Terri tallied 30 in the game while Mary Beth contributed 16. Mary Kay Boos netted 14 for King's. In the recently released Middie Atlantic Conference stats, Kendig leads the country in scoring with a 26.0 average and is fifth in the nation in freethrow percentage with a .810. Mary Jean Farrell is tied for tenth in that category with a .730 percentage. As a team, KEELY FOR TWO - Wilkes freshman forward Stacey Keely goes up for two in the Colonelettes recent heart-breaking two-point loss to King's College. (PHOTO BY GAETANO) Diane Kendig leads the MAC in scoring with a 28.7 average. Rounding out the top five are: Mary Beth Bowler of King's (26.7) , Becky Martin of Western Maryland (24.2) , Widener's Maureen McGinn with (21.3) and Suzanne Spangler of Drew (19.0 ). Kendig is also ranked number seven in the MAC's free-throw PCT with a .760. Wilkes · is fifth in free-throw percentage with .609 and sixth in team defense with 54.2 points allowed per game. "I'm very proud of the way the girls have been playing and putting out," commented head coach Nancy Roberts. "Each girl is giving us over 100 per cent." Bob Waskiewicz Gary Mack Ice Hockey Win; Skate By King's The Wilkes College ice hockey team started off the new decade with a bang Saturday as they trounced rival King's 7-I. Eric Farber scored his first of two goals with 6:28 remaining in the first period. Denny Jacobs made a grand return to the team, also scoring two goals. Mark Ungvarski collected two assists. The return of Jacobs and the play of Farber, who sharpened his skills in the hockeyrich Boston area over Christmas Recess.seemed to spark the team. Second-period goals by Jack Manley and Dave Samsel gave Wilkes a 4-0 lead after two periods. Farber scored his second goal only 20 seconds into the third period, but King's Bill Fruworth was credited with a goal just 17 seconds later to make it 5-1. Goalie Jim "Bangor" Kovacs' bid for his first NEPHL shutout was spoiled when the puck bounced off a Wilkes defenseman's stick and over Kovacs' shoulder, hitting the crossbar and barely falling over the gold line. Jacobs and Ed Ohmott scored 89 seconds apart later in the third period to up the final score to ~.. . The players expressed their appreciation to those fans who attended and ask for their continuing vocal support. Wilkes has ten games remaining in the NEPHL before spring vacation. BASEBALL BASEBALL MEETING Coach Dave Kaschak has announced that a baseball meeting will be held Thursday, Feb. 7, at 11:30 at Weckesser Annex. All baseball prospects are asked to attend and raffle tickets will be,due. BASEBALL WHITE LINES . by Eddie White Ill Well, their at it again! If you read or listen to the local media following last week's victory over King's College by the w; lkes basketball team, you thought we lucked out. Some of the radio people came on the air and instead of sending best wishes to Wilkes for a job well done, they spoke of how the King's basketball program was going downhill since.it went from Division II to III two years ago. And that two losses to Wilkes this year proved that. What a ounch of idiots! Most of these media members are King's grads and have Monarch basketball permanently planted in their brain. When they spoke of the glory days of Division II, they did not note, however, that King's never, ever, came close to winning any national titles. In all those years of Division II, King's went to the NCAA playoffs only once and was beaten in the first game by Bloomsburg State. That's it, no other playoff positions. Scranton won i, national title in basketball in Division III in 1976 and earlier in the decade, the Wilkes wrestling team won a national championship in Division tll. But not King's. They never came close. These same media "sports experts" were the same ones who went bananas last year when King's got in the Division HI Middle Atlantic Conference playoffs. But, now with a losing season looking them in the face and a chance that the Monarchs will go winless against area rivals - Scranton and Wilkes - they look for avenues of escape. King's right now is in trouble. They lost all+star Ken Casey before the season started. He transferred to Bloomsburg State. Then a few weeks into the season, junior guard Steve Locnikar left the team. And most recently, junior forward Jim Shea quit the club. No one really knows what is going on up there at the "big gym on North Main Street," but something is wrong. One radio media member this past week called Division III "just a step above high school." What does he think WilkesBarre is, a big city like Los Angeles, where it can support Division I schools and sports. Another media member was quoted as saying "Division III is nothing, Division I is where it's at." And these are the same guys who cry when they don't get the Wilkes "Division III" scores on time for their broadcasts. If the latter feels Division I is so great why doesn't he cover a Wilkes wrestling match live. It's a good idea. but they're too busy giving hours and hours of coverage to a bunch of nine-year old gymnastic creeps. We must commend the Wilkes College student body for its support in last week's game with King' s. It was a great crowd and the fans were in good taste. Their support will be needed on Feb. 5 and 6 when the wrestlers meet Penn State on the fifth for a top-twenty ranking and the basketball team meets Scranton U. for what could decide the first place in the MAC. You know PSU will have a big crowd on hand so we need all you folks there. And "Duh U" is going to bring down its bunch of loonies called the "Royals Club," so we need your support. And the teams thank you for it. Coach Ron Righter of the Wilkes cagers said if the Colonels could have crowds every game like the King's contest, His team would not lose a home game. And you Jmow, he's right. . We send out best wishes to coach Nancy Roberts and her women's basketball team who are enjoying a fine season. Diane Kendig is leading the country in scoring and the girls are having a super year. Roberts and Righter are two top candidates for the Beacon's "Coach of the Year" award. Baseball season is just around the corner, believe it or not, and the Wilkes College baseball team, one of the finest Division III programs in the country, should enjoy another playoff-filled season under second year coach Dave Kaschak. Last year was a rebuilding year for Wilkes in Kaschak's initial collegiate coaching season while losing a host of All-Americans from the previous year. But with a great crop of lettermen returning and a host of talented freshmen , 1980 should be another year Wilkes goes to the NCAA Regionals and hopefully the NCAA World Series. Bishop Hoban took the local AAA high school first half title last week. Their assistant coach is Jim Maloney, a Wilkes masters grad. Chet Hine's team is led by Mickey Banas, the brother of Wilkes basketballer George "The Marine" Ba nas. AA winners were John Hopkins' G.A .R. tea m led by the best player in the league Barry Francisco. Many feel Hopkins is the finest area high school mentor. ,. �Page 10, The Beacon, January 31, 1980 Scranton Here Wed.ForCrucialMACTilt Last week's Beacon story on the Wilkes men's basketball team spoke of a three-game losing streak. This week, we talk about a two-MAC-game winning streak which has given the Blue and Gold bonafide playoff hopes. The Colonels, going into last night's league game with Susquehanna University in Selinsgrove, Pa., were 5-4 in the MAC behind Scranton which is 6-1 in the MAC North-East. . Wilkes will host Lycoming College this Saturday at the "little house on the praire (Wilkes Gym) " at 8 and it should be a good game for Ron Righter's crew as they are out for blood against the Warriors who beat Wilkes in double-overtime earlier this year in Williamsport. Next Wednesday the Wilkes Gym will be the setting for "the big one" when the Colonels meet' Scranton University's Royals a.k.a. "Big Bob's bead-men" or "the highflying rock and rollers.'' This game could decide who will finish in the top spot in the MAC North-East. Oniy two teams from the NorthEast section will make the MAC playoffs. Scranton is currently first followed by Wilkes and King's. Whoever wins that section hosts the MAC playoffs. Albright and E-town will probably be the other two teams involved in that tourney. Since the last Beacon, the Colonels lost one MAC game but came back to win two league games over King's and Delaware Valley. Wilkes took an overall mark of 9-6 into Monday's home game with Division II power Philly Textile and 26 points on 13 of 16 shooting from yesterday's match-up with Sus- the field . Mike McCarrie who was named to the ECAC team the week quehanna. A week ago Monday, the Blue and before, had 18 tallies and Tony Gold traveled to Elizabethtown and Madden chipped in 16. McNeil had came awy with a 65-50 loss. Righter eight rebounds while Madden conwas displeased with the per- tributed six. Nifty Nafty Hage had a formance of his troops and an- super game for King's and kept Ed nounced that he was going to shake Donohue's team in the game. Writers in this area have said things up by making some changes how people can't get into Division II in the starting lineup. In that Etown loss, oniy two Wilkesmen hit around here. But tell that to the packed house on Wednesday. Those for double figures with Kendall McNeil scoring 17 and "Michael J. " -people were going crazy. And you can bet your house that the gym McCarrie 15. Kevin Walker's five will be the same way on next rebounds led Wilkes. Wednesday when the Royals come Well Colonel faithful could not to town. wait for Wednesday's rematch It was the first time in history against King's. First, because it that a Wileks team had beaten was King's and second they wanted King's twice in one season. Earlier to see what changes Righter would employ. In fact, Righter made-only this year, Wilkes downed the one change - and that was starting Monarchs 77-76 in a TV game at the. "big gym on North Main Street." freshman fire-plug Ross Zanghi, a Three key figures in that game 5-6 guard from Scranton at the point were not around for the second in place of soph Pat Mccue. The move paid off with Zanghi match-up. Steve Locnikar and Jim registering eight assists and eight Shea, junior members of King's points. McCue who shared the play- have quit since then and Artie ing time with Zanghi came on to Meigh was suspended. On Saturday the Colonels travelspark the team with seven assists. It was a brilliant move by Righter ed to Doylestown, Pa. to meet a and came at a great time against tough Delaware Valley team in a MAC encounter. It also meant that rival King's. In that King's game, which came Righter and assistant Steve Justice before a packed house at the Wilkes would be coaching in front of their Gym, the Monarchs displayed hometown fans. They didn't disapheart oniy to lose to the Blue and point their fans as Wilkes garnered Gold 85-77. Kendall McNeil, who a 87-81 victory for its second was nominated to the ECAC all-star straight league win. McNeil, the weekly team for his performance in hottest shooter in the MAC right the 2-1 week, led the Colonels with now, was 11 of 18 enroute to a game high 25 points. Also netting twin figures for the Blue and Gold were Kevin "J .J." Walker with 23 and Mike McCarrie with 22. McNeil and Walker each had ten rebounds. Mc- followed by Walker with 94 . .. McCue has 76 assists followed by McNeil with 41 •• • Walker has 24 blocked shots . .. Mark Sovyrda doing good job as always . .. stat-man Bob Waskiewicz has gone back to Mt. St. Mary's. Eddie White Cue led the playmakers with ten assists. "The Del Val game was a big win for us," said Righter. •~First, it was a MAC game and with King's losing to Scranton earlier in the day it put us in great shape for the second playoff spot in the MAC. Secondly, it came in front of my hometown fans which really meant a lot to me and I thank the team for that. And thirdly, Del Val played an inspired game and we still beat them . We t "owed a lot out there and we'll be ready when Scranton comes to town. I would like to publicly thank all the fans who came to the King's game. They don't realize how much that means to the guys.'' Last week Wilkes received news that it was among 30 Division Ill teams considered by the NCAA for the top 15 rankings. Quite an accomplishment for a team which was 9-15 a year ago. TIP-INS: ... with the win over Del Val, Wilkes equalled its win total (nine) of a year ago ... it was the fourth win on the road for Wilkes after.-winning only ONE road game last year . . . Kevin Walker is among the MAC's leading field goal shooters with a .600 percentage after nine games ... other league percentages include: McCarrie (.576), Madden (.536) and McNeil (.517) . .. Mccue is among the top foul shooters with a .842 ... McCarrie had 145 tallies in eight league games while McNeil had 145 in nine ... Mccue has 53 assists . . . overall 15 game stat leaders: field goals attempted (199) and made (99) McNeil; free throws attempted (71) and made (49) McNeil; points (247) McNeil; and average (16.4) McNeil; rebounds Madden with 95 lf :J: Mike McCarrie DON'T MISS THESE - Fan support will be needed on Feb. 5 and 6 at the Wilkes Gym. On the 5th, Penn State comes to town to wrestle Wilkes and this meet could decide a top-twenty ranking for_either team. And on the 6th, the University of Scranton basketball te'am will meet Wilkes in what could decide who takes first place in the MAC North-East and who hosts the MAC playoffs. Show up and support your team. Bud's, Avengers Keep On Winning Bud's and the Avengrs continued as the pacesetters as the Wilkes College Mixed League completed its second week last Friday. Bud's Karl Blight (258-641) and Robbie Bale (187-507) helped their team shatter Poky's 3-0 to stay atop the Atlantic Division. The Mother Brothers stayed close though, sweeping the Veterans Club I. The surprising Avengers (Paul Kanner 210-478) took two of three from the Whippets to up their Pacific Division lead to two games. The BS'ers, the Vets Club II (Stan Ray 505) and the Whippets all share the second spot. The Midwest Division is the most closely contested grouping as three teams are tied for the top spot. The Assorted Nuts U-2 vs. Good News) , the Pack (2-1 vs. The Force) and the Aristocrats ( 1-2 vs. the 752 Cew despite Tom Maguire's 215-559) are all knotted with 3-3 slates. CA11e/, ~,t,t,;"' . . . SPOIYIIII IOODS COMPANY We accep t Moster Charge & Visa 39 West Market Street Wilkes-Borre, PA 19701 Phol'\E!: 822 -1333 COOL CAT - While Ross Zanghi and Pat Romich go wild in game against King's, coaches Justice and Righter keep cool as Wilkes downs the Monarchs for the second time this season. (Gaetano) Free Parking At Hotel Sterling PATIKK IRKE OWNQ - Standings: Atlantic Division Bud's Compressor & Supply Mother Brothers 752Crew Veterans Club I Poky's 6-0 4-2 3-3 2-4 2-4 Midwest Division Aristocrats Assorted Nuts The Pack Good News The Force 3-3 3-3 3-3 2-4 i-5 Pacific Division Avengers BS'ers Whippets Veterans Club II EE's Nukes 5-1 3-3 3- 3 3-3 1-5 1-5 Others: Leo Orlandini 494, Bill Petrick 543, Lisa Hughes 494, Joe Pelchar 505, and Bruce Fendler 520. Pin Patter: Karl Blight was elected Vice-President in a special run-off election. The league is planning on sending a top-notch team to two highly respected intercollegiate bowling tournaments later in the semester. ~ ......, ....................""'i II SRYICE Pia's s1■DC1 I I i I ~ ~ .. ~ I I . SIAININ I 531-395.MoinSt. Wi lk es-Barre, Po. i f ..............., ........4 829-9209 Inspection Station 1~-m12rson's ~Y ·r J ~ ,: ~ I':! - TONIGHT AND FRIDAY FLETCHER to serue s-piriis �January 31, 1980, The Beacon, Page 11 PENN STATE HERE TUESDAY Wilkes has been sailing along with an eight-match winning skein and 9-2 overall record, but the biggest challenge of the season lies ahead of the Colonels wrestlers. R1ght about this time ( midseason ) some wrestlers begin to lose interest and it' s the job ' of his t~ammates and Coach John Reese to lift his spirits again. Some wrestling teams just coast through the second season to say the least. This year's match-up is even, although National Mat News and Amateur Wrestling News favor the Nittany Lions. The State College team is currently ranked 11th by AWN and 17th by NMN. If our Colonels pull it off, it will definitely mean a N aitonal ranking. Penn State is literally " stacked" in the first seven weight classes and the Reesemen will vs. Dan Miner, if healthy, junior, Chambersburg. In last week' s action Wilkes wrestled only one match due to Elizabethtown backing out of the dual. "This summer the Elizabethtown coach asked to be dropped form our schedule due to the inferiority of his Division III team to our Division I team and I thought it was understandable," noted Coach Reese. "But evidently he thought he could be erased from our schedule for the 1980 meet, and he didn't realize the scheduling meeting was for 1981," added Reese. The week layoff didn't bother the wrestlers as they trounced Lycoming last Saturday, 41-12. Johnson started things on the right foot when he posted a 12-0 superior decision at 118. Johnson took a 2-0 lead after the first, 4-0 after two and scored eight points in the third for the five team points. Outstanding freshman Mark Popple kept things going with a 7: 12 fall over highly touted John O'Shea at 126. Billig then followed with a fall in 3: 03. Nelson scored a take,town with : 17 seconds remaining to edge his opponent, 6-5. After Troutman got caught in a pin, Densberger retaliated with another Blue and Gold fall at the 6:47 mark. Miner was forced to default due to a leg injury atl67. Bart Cook and Rick Smith combined for two pins in a total time of 3:30 at 177 and 190. Smith highlighted the evening when he decked his foe in only : 14 seconds. Matzelle iced the cake with a 15-11 decision to cap off the evening. Bob Gaetano Tankmen Tie Lycoming; Rematch This Saturday , a free styler by swimming the After swimming Lycoming and distance events. He broke his own Western Maryland this past week team record in the 200 yard the swim team picked up a tie and a freestyle. loss respectively bringing its The combination of Maguire record to a 1-3-1 for the season. Bush in the 200 yard butterfly event Competing in Williamsport last was again successful. The sole . Wednesday, January 23, the ColWestern Maryland swimmer was onels came from behind to tie disqualified due to two false starts Lycoming by winning the last event leading the way for Wilkes to take of the meet. At one point Wilkes was an easy 1-2 sweep. It demonstrated losing 29-14 with the final score bethat total concentration is needed ing 52-52. Michelle Maguire and Dave · for a start in any swimming race. With the excitement of the first few matches already terminated and Winning the 100 yard freestyle Gergen led the pace for Wilkes by the big EIWA tourney one month away. here are the statistics of the Coland taking second in the 50 yard earning two first place finishes onel matmen. They could be helpful for setting personal goals (4 matfreestyle event, Edwards had one of each. Maguire won the two toughest his better days. ches). events of any swim meet, the 200 MAJ. SUP. TEAM Wilkes dominated the diving yard butterfly and the 500 yard Weight, Name W L D DEC. DEC. PINS PTS events, as usual, with Bello taking freestyle. Also taking a second in 118-Eddie Johnson 4 3 1 1 1 O 18 two firsts in both events. Frank the 160 yard individual medly, 126-Mark Popple 4 3 0 1 O I 1 !l Gardner took a third in the required Maguire put a total of 13 points on 126-Billy Dodge 4 0 0 0 0 I I. 8 diving and Lichtinger took third in the board for the team. 134-Bryan Billgi"' 9 2 o I O 7 4 8 the optional. After the optional divGergen captured victories in the 142-Steve DeGiso 3 3 o I I O I 2 ing and with only two events to go, two sprint events, the 60 and 100 142-Lenny Nelson 4 1 O 2 I O 1 6 Wilkes was down 44-43. freestyle, which were both very 150-Mark Troutman 5 2 O O I 2 2 3 Western Maryland took first and close races. 158-Mar'k Densberger 9 I o· 1 2 4 4 7 second In the 200 yard breastroke In other events Reed BeHo and 167-DanMiner 5 4 2 I O O I 9 and won the 400 yard freestyle Perry Lichtinger took seconds and 177-BartCook 5 2 0 I I 2 2 4 relay. The only point earned for the thirds respectively in the optional 177-Pete Creamer 4 2 o I O O I 6 Colonels in those two events was by and required diving events. Judg190-Rick Smith 9 1 1 1 1 2 3 9 Butchkavitz who took a third in the ing for the diving was not at its best Uni-Bob Matzelle 8 1 0 0 O I 2 7 breastroke. and Bello was robbed out of a first in the required diving event. The half of its schedule, but the have to win at least three of The Colonel · swimmers' next difference between first and second Blue and Gold grapplers must those bouts to stay close entermeet is this Saturday at the King's was 158.70 to 157.10. keep accelerating and set their ing the final three categories. College pool at 2 p.m. A rematch Kim. Bush finished second in the goals at Eastern Inter- Reese will be depending on the will be held with Lycoming and The 200 yard butterfly and third in the collegiate Wrestling Associa- services of Bart Cook, senior Beacon gives odds in favor of 500 yard freestyle . She and Maguire tion championships. co-captain at 177 to defeat his Wilkes coming out on top. have consistently proven With 11 meets behind them, adversary, as well as junior themselves as valuable assets to the Wilkes wrestlers will at- Rick Smith, Walden, Vt. and the team by earning important Added Extras ... If the coaches , tempt to win their next 10 senior Bob Matzelle. The Lions points in these two events. don't watch it they may lose swimEnrico Ratti took a third in the mers from injury due to flying kick duals. The Colonels ~were ex- lost three tough wrestlers in 200 yard freestyle. John Moffatt boards ... Early morning practice is pected to beat S.U.N.Y. at Dan Pfautz, Sam Sallitt and and Pat Slowey grabbed second and turning out to be an exclusive acBinghamton last night and Jim Sleeper and replaced them third in the 200 yard backstroke tivity for some. What's the matter should fare well on their road with mediocre wrestlers at 177, while Peggy Butchkavitz and Rob people, forgot to set your alarms? trip for a triangular meet with 190 and unlimited respectively. Doty did the same in the 200 yard ... Apologies extended to John MofConnecticut and Southern ConIf the Wilkes lightweights can breastroke. fatt for mentioning him in this necticut Saturday. pull through, the Blue and Gold Heading into the last event of the paper last week. No one knew he The "BIG SHOWDOWN" bet- will have it wrapped up while meet Wilkes was down 52-45. The was going to get so upset ... Before ween our Colonels and Penn the heavyweights tie the bow. Colonels could either tie or lose the the Lycoming meet Kim Bush and meet. The event was the 400 yard others bowled a few games to State University is slated for At 188, Wilkes will be hurt by freestyle relay and swimming for loosen up. Pat Slowey kept her from Tuesday, February 5 at our the injury to Eddie Johnson. Wilkes were Moffatt, Ratti, Jim Ed- telling dirty jokes on the way home Gymnasium. Wilkes dumped PSU's Mike DeAugustino wards, and Gergen. Each swimmer however ... Dinner after the meet the Lions last year 29-12 and the should conquer here. 126 did a personal best for the year to wasn't bad but then again that was NOTICE: Cocah Dave all-time series record is Mark Popple, freshman, win the event and tie the meet. It only if one had patience. Kaschak, intramural director, deadlocked, 1-1. But Penn State Wilkes-Barre, will tac:.-kle was one of the best races all year. has announced that all 8: 00 was suffering a bad 78-79 frewshman Steve Bass; 134 Versus Western games will not start until the the eighth-ranked wrestler in Maryland women's basketball team is the nation, Bryan Billig, junior, In Saturday's home contest done with practice. Anyone against Western Maryland Wilkes New Tripoli, will face 10th violating that rule is subject to suffered its third defeat losing by a ranked Bob Bury. 142 - Bernie suspension. score of 59-44. . . Fritz, ps"u vs. Lenny Nelson, Across from Bishop Hoban freshman, Richalnd, N.J.; 150 ..... - . - - - . - . . . - - - - - - ~ Gergen showed his verSctility as Ph. 822-7045 Rosenberger vs. Mark ' Troutman, freshman, Toms -Imported BeersRiver, N.J. 158 Jeff -Cold BeerBroadhead vs. Mark Call in Advance A.O.-A. 2 2 Molo's 1 0 Densberger vs. Mark "A" Division foi' Kegs and Quarlers 1 1 PrepH 3 0 Barons 3 1 Densberger, senior co-captain, Chumlies (Must have LCB Card) 1 2 Crazy Horse 2 0 Buckateers 2 1 Danville; 167 - John Hanrahan Benton Boys 1 2 CAOS Skywalkers 2 1 ,0 3 Champagne Jam T-SHIRTS Sophia's 0 2 Bedford 0 3 SWEATSHIRTS & JACKETS ------------..wr DECK OU R'S BEER INTRAMURAL BASKETBALL Januzzi's Pizza and Hoagies 125 Academy Street Home Delivery OPEN 7 DAYS 11-1 CUSTOM PRINTED ~ RETAIL & WHOLESALE • COMPANIES• CLUBS ~) , so,oocs •'"o"•"'" ) CALL FOR FA ST QUALITY SE RVICE .,,;J:'r 'Firs ~ WILKES ;.BARRE UNIFORM CENTER 86 S. Main 825-6393 "B-1" Division Harriers SemBoys ROTC Diaz Monsoon Broth. Eat Them 3 2 1 1 1 0 "B-2" Division Bob Ballers 2 0 Sleazy 0 0 1 2 2 3 "B-3" Division Whippets I Chico's Vets Scrap Pack Whippets II Dartans 0 2 2 0 2 0 2 1 1 2 1 2 0 3 �--------------------------This year Valentine's Day falls on a Beacon Thursday. In keeping with the spirit of Cupid The Beacon will have a . special insert allow i ng everyone on campus to send their sweetheart a personal message. lt'sfree , just drop off the message at The Beacon office located on th e 2nd floor of I Parrish or in The Beacon Bt>x in the Library by Sunday, I February 10. ----------------------- � Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon Newspaper Collection, 1947-present Description An account of the resource <p>This is Wilkes University's <em>Beacon</em> Newspaper collection, 1947-present. We also have digitized copies of the <em>Beacon's</em> predecessors, <em>The Bucknell Bison Stampede</em>, 1934-1935 and <em>The Bucknell Beacon</em>, 1936-1947 June. It should be noted that Wilkes University does not have a complete set of issues for the Bucknell Bison Stampede and Bucknell Beacon. For researchers who are interested in seeing the complete issues for these publications, please contact <a href="https://researchbysubject.bucknell.edu/scua">Bucknell University's Special Collections Department</a>.</p> <p></p> <p>Missing Issues:</p> <p>1947 August 8th<br />1947 September 5th<br />1947 October 3rd<br />1947 October 17th<br />1947 October 31st<br />1947 November 21st<br />1947 December 19th<br />1948 September 9th<br />1950 April 28th<br />1953 April 10th<br />1962 February 2nd</p> Creator An entity primarily responsible for making the resource The Beacon staff is comprised of Wilkes University students who are advised by a full-time faculty member of the Communication Studies Department. Date A point or period of time associated with an event in the lifecycle of the resource 1934-present Rights Information about rights held in and over the resource Copyright of the Wilkes Beacons is retained by Wilkes University. Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Source A related resource from which the described resource is derived Professor Emeritus Harold Cox digitized the collection from 1934-1970 and created a <a href="https://beaconarchives2.wilkes.edu/">legacy website</a>. Digital Archives student John Jenkins digitized the collection from 1970-present. Special thanks goes to Communication Studies Professor Dr. Kalen Churcher, Editor-in-Chief Kirsten Peters, Beacon staff member, Emily Cherkauskas, and other Beacon staff for their help in acquiring digitized copies of the Beacons from 2006 onward. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Wilkes Beacon 1980 January 31st Date A point or period of time associated with an event in the lifecycle of the resource 1980 January 30 Format The file format, physical medium, or dimensions of the resource PDF Language A language of the resource English Type The nature or genre of the resource Newspaper Creator An entity primarily responsible for making the resource Communication Studies Department Publisher An entity responsible for making the resource available Wilkes College